Previous Article | Next Article 
Molecular and Cellular Biology, May 2004, p. 3692-3702, Vol. 24, No. 9
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.9.3692-3702.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
In Vitro Processing of the 3'-Overhanging DNA in the Postcleavage Complex Involved in V(D)J Joining
Tadashi Nishihara, Fumikiyo Nagawa, Hirofumi Nishizumi, Masami Kodama,
Satoshi Hirose, Reiko Hayashi, and Hitoshi Sakano*
Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan
Received 27 October 2003/
Returned for modification 4 December 2003/
Accepted 2 February 2004

ABSTRACT
The postcleavage complex involved in V(D)J joining is known
to possess a transpositional strand transfer activity, whose
physiological role is yet to be clarified. Here we report that
RAG1 and RAG2 proteins in the signal end (SE) complex cleave
the 3'-overhanging structure of the synthetic coding-end (CE)
DNA in two successive steps in vitro. The 3'-overhanging structure
is attacked by the SE complex imprecisely, near the double-stranded/single-stranded
(ds/ss) junction, and transferred to the SE. The transferred
overhang is then resolved and cleaved precisely at the ds/ss
junction, generating either the linear or the circular cleavage
products. Thus, the blunt-end structure is restored for the
SE and variably processed ends are generated for the synthetic
CE. This 3'-processing activity is observed not only with the
core RAG2 but also with the full-length protein.

INTRODUCTION
V(D)J joining plays key roles in activating and diversifying
the antigen receptor genes. In the initial phase of V(D)J joining,
the protein products of recombination-activating genes (RAG1
and RAG2) (
39,
48) recognize the recombination signal sequences
(RSS), each consisting of a conserved 7-mer (CACAGTG) and a
conserved 9-mer (ACAAAAACC), separated by a spacer of constant
length of either 12 or 23 bp (
6,
17,
35,
44,
45,
46,
52,
53).
For the coordinate cleavage of RSSs, synaptic complex formation
of the 12- and 23-RSSs is required (
8,
18,
59). RSS DNA is cleaved
by RAG proteins in two successive steps, nicking and hairpin
formation (
31,
58). A nick is first introduced at the coding
and 7-mer border on the top strand. The resulting 3'-hydroxyl
group (3'-OH) then attacks the bottom strand to form a hairpin
structure at the coding end (CE) and a blunt end at the signal
end (SE). After the cleavage of RSSs, the SEs stably stay with
the RAG proteins in vitro (
2,
18,
21,
36). Physical association
of the CEs with the SE complex has been shown to occur in vitro
(
18,
56). This association in the presence of other repair proteins
appears to be necessary for the CE processing in vivo (
18,
20,
41,
56,
60).
In the joining phase of V(D)J recombination, CEs are processed and ligated to form a coding joint. Several factors are required in DNA end joining, including the Ku heterodimer (Ku70/80), the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), Artemis, XRCC4, and DNA ligase IV (4, 11, 14, 15, 27, 28, 34, 38, 42, 43, 54, 61). It has been shown that the Artemis/DNA-PKcs complex opens the hairpin a few nucleotides from the tip, generating the 3'-overhanging structure (30, 50). After the hairpin opening, the CEs are modified by nucleotide deletions and additions for junctional diversification (50). For nucleotide additions, terminal deoxynucleotidyltransferase (TdT) has been reported to be responsible for the non-germ line encoded nucleotides (N) (13, 24). In contrast, the exact mechanism for the nucleotide deletions remains largely unknown. The RAG proteins are known to mediate the strand transfer of the SE to the hairpin CE or to the double-stranded (ds) DNA, resulting in the aberrant joining products in vitro (3, 19, 26, 32). The 3' flap endonuclease activity was also reported for the RAG proteins and was suggested to be a candidate for the CE processing activity (47). However, this activity was SE independent and requires Mn2+.
In the present study, we examined the SE complex for the 3'-processing activity using 3'-overhanging DNA. This is because the RAG proteins remain bound to the SEs in vivo even after the RSS has been cleaved (2, 40). Here, we report that the RAG proteins in the SE complex can process and cleave the 3' overhang of the ds DNA in vitro in two successive steps.

MATERIALS AND METHODS
Preparation of proteins.
The glutathione
S-transferase (GST)-tagged truncated RAG1 protein
(amino acids 384 to 1040) was coexpressed either with the GST-tagged
truncated RAG2 protein or with the GST-tagged full-length RAG2
protein (amino acids 1 to 383 or 1 to 527, respectively) in
HEK-293T cells (
56), purified with glutathione-agarose affinity
chromatography (
52), and dialyzed against 25 mM Tris-HCl (pH
8.0)-2 mM dithiothreitol (DTT)-150 mM KCl-10% glycerol. The
proteins used in the experiments illustrated in Fig.
6 were
dialyzed against a different buffer containing 25 mM Tris-HCl
(pH 8.0), 2 mM DTT, 150 mM NaCl, and 20% glycerol. These two
buffers showed little difference in the 3'-processing activity
of the RAG proteins. Porcine high-mobility-group 1 (HMG1) protein
was prepared as described previously (
1). The RSS cleavage activity
of the full-length RAG2 was about 60% of that of the truncated
core RAG2.
DNA substrates.
Oligonucleotides were synthesized and purified with high-pressure
liquid chromatography and/or by electrophoresis in a denaturing
polyacrylamide gel. The strands and their sequences were as
follows, with 7-mer and 9-mer signal sequences underlined: 12-SE
top strand (49-mer), 5'-
CACAGTGCTCCAGGGCTGA
ACAAAAACCTCCTAGGGTTGCAGCTGACTC-3';
23-SE top strand (60-mer), 5'-
CACAGTGGTAGTACTCCACTGTCTGGGTGT
ACAAAAACCTCCTAGGGTTGCCATGGACTC-3';
top strand of the 12-ST, 5'-
CACAGTGCTCCAGGGCTGA
ACAAAAACCTCCTAGGGTTGCAGCTGACT-3';
bottom strand of the 12-ST, 5'-AGTCAGCTGCAACCCTAGGA
GGTTTTTGTTCAGCCCTGGAG
CACTGTGGACCTAATAC-3';
59-nucleotide (nt) top strand of the ds DNA, 5'-CTTAATACGACTCACTATAGGGCTATGTACTACCCGAACCACCAACCTAATACGACGAA-3'.
Oligonucleotide substrates were 5' end labeled with [

-
32P]ATP
(Amersham Biosciences) by using T4 polynucleotide kinase (New
England Biolabs) or 3' end labeled by annealing with appropriate
complementary oligonucleotide and filling in 1 nt with [

-
32P]
dGTP or [

-
32P]dCTP (Amersham Biosciences) by using a Klenow
fragment (3' exo
; New England Biolabs). To prepare the
3'-dideoxy oligonucleotide, the oligonucleotide was extended
with ddCTP or ddGTP (Roche Diagnostics) by using terminal deoxyribonucleotide
transferase (Roche Diagnostics). An internally labeled strand
was prepared by ligating the 5'-
32P-labeled 3' half (5'-GAGTCAGCTGCAACCCTAGGA
GGTTTTTGTTCAGCCCTGGAG
CACTGTG-3')
to the unlabeled 5' half (5'-GACCTAATAC-3') in the presence
of the complementary strand by using T4 DNA ligase (New England
Biolabs). The labeled oligonucleotide was purified from a denaturing
polyacrylamide gel and reannealed to the indicated complementary
strand. Annealed DNA was further purified by electrophoresis
in an 8% polyacrylamide gel, eluted from gel slices with an
elution buffer (0.2 M NaCl, 1 mM EDTA, and 20 mM Tris-HCl [pH
7.5]), and purified with reversed-phase column chromatography
(Elutip-d; Schleicher & Schuell).
3'-Processing reactions.
To examine the SE requirements, 12-SE DNA (8 nM) and 23-SE DNA (8 nM) were incubated with RAG1 (10 µg/ml), RAG2 (10 µg/ml), and HMG1 (8 µg/ml) proteins at 37°C for 120 min in binding buffer (25 mM MOPS [morpholinepropanesulfonic acid]-KOH [pH 7.0], 5 mM Tris-HCl [pH 8.0], 2.4 mM DTT, 90 mM potassium acetate, 30 mM KCl, 0.1 mg of bovine serum albumin [BSA]/ml, and 2% glycerol) containing 10 mM MgCl2. The labeled ds DNA (200 cpm/µl) was added and incubated at 37°C for 60 min. In all other experiments, the unlabeled or labeled 12-SE DNA (20 nM or 200 cpm/µl, respectively) and its partner biotinylated 23-SE DNA (20 or 8 nM, respectively) were incubated with RAG1 (10 µg/ml), RAG2 (10 µg/ml), and HMG1 (8 µg/ml) proteins at 37°C for 100 min in 20 µl of the binding buffer containing 10 mM CaCl2. Streptavidin-coated magnetic beads (Dynabeads M-280; 10 µg/µl) were added, and the reaction mixture was incubated at 37°C for 20 min. After incubation, magnetic beads and supernatant were separated by use of a magnet stand. The beads were washed four times at room temperature with 30 µl of binding buffer containing 10 mM CaCl2 and resuspended in the binding buffer containing Mg2+ (10 mM if not otherwise specified). The labeled or unlabeled substrate ds DNA (200 cpm/µl or 5 nM, respectively) was added to the SE complex and incubated at 37°C. To examine the effect of the Mg2+ concentration, the SE complex was reconstituted and isolated with 1 mM CaCl2 instead of 10 mM CaCl2. DNA was extracted from the reaction mixture by using phenol-chloroform-isoamyl alcohol (25:24:1), precipitated with ethanol, washed with 70% ethanol, dissolved in formamide dye mix, and electrophoresed in a denaturing polyacrylamide gel.
Transposition.
The SE complex was reconstituted by using the biotinylated 12-SE DNA (16 nM) and the labeled 23-SE DNA (12 nM) in a buffer containing 1 mM MgCl2, 25 mM MOPS-KOH (pH 7.0), 5 mM Tris-HCl (pH 8.0), 2.8 mM DTT, 60 mM potassium acetate, 60 mM NaCl, 1 mg of BSA/ml, and 8% glycerol. The bead-bound SE complex was washed three times with wash buffer (25 mM MOPS-KOH [pH 7.0], 2.4 mM DTT, 90 mM potassium acetate, 210 mM KCl, 1 mg of BSA/ml, and 2% glycerol) and once with a Tn buffer (25 mM MOPS-KOH [pH 7.0], 2.4 mM DTT, 45 mM potassium acetate, 30 mM KCl, 0.1 mg of BSA/ml, and 2% glycerol). The amount of the isolated SE complex was estimated by a count of the 32P incorporated into the complex. The target plasmid (pBluescript II SK [Stratagene]) (25 ng/µl) was incubated with the SE complex (0.1 nM) at 37°C in the Tn buffer containing 3 mM MgCl2. After the transposition reaction, sodium dodecyl sulfate (0.5%) and proteinase K (1 mg/ml) (Roche Diagnostics) were added and incubated at 55°C for 60 min. DNA was extracted from the reaction mixture by using phenol-chloroform-isoamyl alcohol (25:24:1), precipitated with ethanol, resuspended in a Tris-EDTA buffer, electrophoresed in a 1% Tris-acetate-EDTA agarose gel, transferred to a nylon membrane filter, and autoradiographed. The SE complex was reconstituted with the unlabeled 23-SE DNA in parallel and assayed for the 3'-processing activity in the Tn buffer containing 3 mM MgCl2.
Isolation of the complexes containing ST intermediates.
After the 3'-processing reaction, the complex was reisolated with magnetic beads from the reaction mixture and washed once with the wash buffer containing 1 mM CaCl2 and four times with the Ca2+-free wash buffer. The isolated complex was resuspended in the binding buffer containing 10 mM MgCl2.
Enzymatic treatments of reaction products.
For the calf intestine alkaline phosphatase (CIP) treatment, DNA extracted from the reaction mixture was incubated at 37°C for 30 min with 0.5 U of CIP (Roche Diagnostics) in the manufacturer's buffer. For the T4 polynucleotide kinase treatment, DNA was incubated with 2 U of polynucleotide kinase in the manufacturer's buffer at 37°C for 30 min. For restriction enzyme treatment, DNA was incubated at 37°C for 120 min with 1 U of PvuII or BsrGI (TaKaRa Biochemicals) in the manufacturer's buffer. For the exonuclease V (exoV) treatment, DNA was incubated at 37°C for 120 min with 2 U of exoV (Amersham Biosciences) in 67 mM glycine-NaOH (pH 9.4)-10 mM ß-mercaptoethanol-6.7 mM MgCl2.
Purification and endonuclease treatment of each cleavage product.
Each cleavage product was separated by electrophoresis in a 15% denaturing polyacrylamide gel and eluted from the gel slice with the elution buffer. DNA was precipitated with ethanol, washed with 70% ethanol, dissolved in a Tris-EDTA buffer, and treated at 25°C for 10 min with mung bean nuclease (3.56, 10.7, or 32 U/ml) (TaKaRa Biochemicals) in 50 mM Tris-HCl (pH 5.2)-30 mM NaCl-10 mM ZnSO4. DNA was extracted by phenol-chloroform-isoamyl alcohol (25:24:1), concentrated by 1-butanol extraction, dissolved in formamide dye mix, and electrophoresed in a 16.5% denaturing polyacrylamide gel.

RESULTS
The SE complex processes the 3'-overhanging structure.
To examine the CE processing activity of the SE complex, the
complex was reconstituted with 12-SE, 23-SE, and RAG1/RAG2 proteins
in the presence of HMG1, and incubated with various ds DNA samples
labeled at the 5' end of the top strand. As shown in Fig.
1A,
ds DNA with the 3' overhang (4 nt or longer) was cleaved by
the SE complex in the presence of Mg
2+. No cleavage was found
to occur near the blunt end or the recessed 3' end of ds DNA.
In the ds DNA with a 15-nt 3' overhang, three major cleavage
sites were detected in the ss DNA region, at or near the ds/ss
junction (Fig.
1B). The reaction was much reduced when either
the 12- or the 23-SE was omitted, and it was totally abolished
without the SEs (Fig.
1B). In the ds DNA region, cleavages were
weakly detectable, even in the absence of the SEs, at or near
the ds/ss junction. These cleavages were probably due to the
3' flap endonuclease activity, previously reported for the RAG
proteins (
47), because the reaction was enhanced by Mn
2+ and
did not require the presence of SEs (Fig.
1B). We also examined
the 3' CE processing by using uncleaved RSSs. However, since
our reaction did not include repair factors such as Artemis,
the 3'-overhanging CEs were not generated and unprocessed hairpins
accumulated (data not shown).
The cleaved 3' overhang is transferred to the SE.
To study the fate of the cleaved 3' overhang, the 3'-terminal
nucleotide was labeled in the overhang (Fig.
2A) and the labeled
ds DNA was incubated in the presence of Mg
2+ (Fig.
2B). Three
types of reaction products were detected: one (Z) was a slow
migrating species, and two (X and Y) were fast migrating species
compared with the uncleaved substrate (Fig.
2A). Since none
of these species were detected when the 5' end of the top strand
was labeled, they should represent the reaction products cleaved
from the 3' overhang (data not shown). Formation of species
X, Y, and Z was totally abolished when either RAG1 or RAG2 was
omitted (Fig.
2A). It should be mentioned that the SE complex
containing the mutant RAG1 (D708A) (
12,
23) failed to generate
any of these reaction products (Fig.
2A, right). The substrate
was efficiently cleaved at higher Mg
2+ concentrations, e.g.,
10 mM (Fig.
2B). With Ca
2+, the subspecies of Z that are a few
nucleotides longer than those generated with Mg
2+ were found
after prolonged incubation (>2 h) (data not shown). At all
Mg
2+ concentrations tested, species Z appeared first, peaked
at an early time, and then slowly diminished, while species
X and Y appeared later and continued to accumulate with time.
The three bands of species Y, migrating at 13, 14, and 15 nt
(designated Y1, Y2, and Y3, respectively), were the cleaved
3'-overhanging structure. The faster-migrating species X was
assumed to be the circular form of the species Y, because it
was resistant to the exonucleolytic cleavage, as will be discussed
later. The third species, Z1 and Z2, each consisting of a cluster
of three bands, migrated slower than the 12- and 23-SEs. Since
the species Z appeared transiently during the cleavage, we assumed
these bands to be the reaction intermediates. To study the structural
nature of the species Z and its possible relationship to the
SEs, we labeled the 12-SE at the 3'-terminal nucleotide of the
bottom strand and reconstituted the SE complex. The complex
was incubated with the unlabeled 3'-overhanging ds DNA in the
Mg
2+-containing buffer. After the reaction, DNA was extracted,
electrophoresed, and autoradiographed. On the autoradiogram,
slower migrating bands newly appeared behind the 12-SE, whose
mobilities were identical to that of the Z1 band (Fig.
3A).
These new bands, as well as the Z1 band, were cleaved into three
smaller fragments of 55, 56, and 57 nt by PvuII digestion. Since
the 12-SE DNA contained a PvuII cleavage site 42 nt downstream
from the signal end, we assumed that the Z1 bands were generated
by the transfer of the 3' overhang from the ds DNA to the 12-SE
(Fig.
3A). Similar results were obtained for Z2 by using the
3'-labeled 23-SE (data not shown). We assume that transfer of
the 3' overhang to the SE is due to the attack by the SE on
the 3' overhang. This is because the experiments with the 3'-dideoxy
SE revealed that the 3'-OH group of the 12-SE is required for
the generation of 12-STs (Z1), but not 23-STs (Z2), and vice
versa (Fig.
2A). We also found that formation of the cleavage
products Xs and Ys requires the 3'-OH of the 12- or 23-SE (Fig.
2A). Henceforth, the strand transfer intermediate (Z) will be
referred to as ST DNA.
The 3' overhang sequence transferred to the SE is precisely cleaved off.
To examine whether the ST DNA is contained in the SE complex,
we isolated the SE complex after the incubation with the 3'-overhanging
ds DNA (Fig.
3B). The SE complex was immobilized on streptavidin-coated
magnetic beads with biotinylated 23-SE. The ds DNA with the
32P-labeled 3' overhang was allowed to react with the SE complex
in the presence of 1 mM Mg
2+ for 30 min. The bead-bound SE complex
was washed with the Mg
2+-free buffer, and DNA was extracted
from the complex, electrophoresed, and autoradiographed. Almost
all of the unreacted substrate and species X and Y were washed
out from the complex. However, the 12- and 23-STs remained with
the SE complex even after the washing (Fig.
3B). When the washed
complex was reincubated in the Mg
2+-containing buffer, the 12-
and 23-ST bands disappeared, yielding the species X and Y bands
(Fig.
3B). We performed a similar experiment with the unlabeled
3'-overhanging ds DNA and the 12-SE labeled at the 3' end of
the bottom strand. Again, most of the 12-ST DNA remained in
the complex after washing. When the complex was subsequently
incubated in the Mg
2+-containing buffer, the 12-STs gradually
disappeared. No cleavage products (species X and Y) were seen
in this autoradiogram, because the 3' overhang of ds DNA was
not labeled in this experiment. These results support the idea
that the species X and Y are generated from the 12- and 23-STs
by the resolution reaction of the strand transfer intermediates.
To demonstrate the resolution process more directly, we reconstituted the SE complex with the 12-ST instead of the 12-SE. The 12-ST DNA was labeled with 32P at the 5' end of the bottom strand, paired with the 23-SE, and incubated with the RAG1, RAG2, and HMG1 proteins in the Mg2+-containing buffer. The ST band of 58 nt (bottom strand) was converted to the 12-SE of 48 nt (Fig. 4A). Even STs with overhangs as short as 1 nt were cleaved (data not shown). We then labeled the 12-ST at the 3'-terminal nucleotide of the bottom strand and performed the same cleavage reaction. This time, two faster migrating cleavage products (X and Y) appeared (Fig. 4A). The band Y showed the electrophoretic mobility expected for the cleavage product of the 12-ST nicked at the ds/ss junction. The other product, band X, was assumed to be the circular form of the linear cleavage product, band Y (see below). Similar cleavage products were also generated from the labeled 23-ST when it was paired with the 12-SE (data not shown). The cleavage of the 12-ST was significantly reduced when the 12/23 rule was violated by pairing with the 12-SE (Fig. 4A). These results indicate that the 3' overhang in the ST, transferred from ds DNA to the SE, is indeed cleaved in the SE complex. We examined whether the resolution reaction is HMG dependent. It was found that the HMG protein is dispensable in the ST cleavage reaction (data not shown). Although HMG slightly stimulates the ST cleavage, this could be due to the stimulating effect of the HMG on the SE complex reconstitution rather than on the catalysis.
Linear and circular DNA fragments as cleavage products.
We then studied the structures of species X DNA by using various
enzymes that attack the DNA ends, e.g., alkaline phosphatase
(which removes the terminal phosphates), T4 polynucleotide kinase
(which phosphorylates the 5'-OH end), and exonuclease V (which
removes linear DNA from both ends). None of these enzymes altered
the mobilities or the intensities of the bands for X DNA (data
not shown). These results indicate that the species X DNA is
in the circular form. To confirm this notion further, both X
and Y bands were purified from a denaturing polyacrylamide gel
and digested partially with mung bean endonuclease (Fig.
4B).
Band Y was degraded quickly, generating a ladder of small nucleotides.
In contrast, band X was converted to a slower-migrating band,
whose mobility was the same as that of the band Y of 10 nt (Fig.
4B). At higher concentrations of the mung bean nuclease, a ladder
of degradation products appeared (Fig.
4B). When the phosphate
at the ds/ss junction was labeled in the 3' overhang of the
12-ST, bands X and Y were also generated after the incubation
of the SE complex in the Mg
2+-containing buffer (Fig.
4A). These
results indicate that the 3' overhang of 10 nt was precisely
cleaved at the ds/ss junction in the 12-ST, resulting in the
circular (X) or linear (Y) product. We examined the length effect
of the 3' overhang on the formation of circular DNA product
(X). We found that only linear products (Y) were generated with
short 3' overhangs (2, 4, and 6 nt) (data not shown). With longer
3' overhangs (8 and 10 nt), both linear (Y) and circular (X)
products were generated. The terminal 3'-OH in the overhang
appeared to be essential in generating the circular product
(X). When the 3' end nucleotide, deoxycytosine, was replaced
with a dideoxycytosine, band Y was produced without the generation
of band X from the 12-ST (Fig.
4A). Similar results were also
obtained with the 3'-overhanging ds DNA when the end nucleotide
in the overhang was replaced with a dideoxynucleotide (data
not shown). These results indicate that the ST is resolved in
two alternative pathways: one generating the circular product
(X), and the other generating the linear form (Y). Neither reaction
requires an external energy source, such as ATP. The Y band
is probably generated by hydrolysis, while the X band appears
to be produced by intrastrand transesterification: a water molecule
or the terminal 3'-OH of the overhang attacks the phosphate
at the ds/ss junction of the ST. To examine whether the resolution
of the ST molecule can occur with other nucleophiles, we tested
1,2-ethanediol and glycerol in the 12-ST cleavage reaction.
In a 20% denaturing polyacrylamide gel, the alcoholyzed Y migrated
more slowly than the hydrolyzed Y (Fig.
5). The shifted mobilities
correlated with the sizes of the alcohol molecules used in the
reaction.
Full-length RAG2 has a 3'-processing activity comparable to that of the truncated RAG2.
It has been reported that the C-terminal region of the full-length
RAG2 inhibits the RAG-mediated transposition activity (
9,
57).
Since the 3'-processing and the transposition reactions are
mechanistically similar, we examined whether the C-terminal
region of the RAG2 also affects the 3'-processing activity.
We reconstituted the SE complex either with the full-length
RAG2 or with the truncated RAG2 lacking the C-terminal region.
As shown in Fig.
6A, the transposition activity was significantly
reduced with the full-length RAG2 as reported previously (
57).
The double-ended insertion products predominate over the single-ended
ones under the Mg
2+ condition without polyethylene glycol (Fig.
6A and unpublished observation by T. Nishihara). The predominant
generation of double-ended insertion products was also reported
by Neiditch et al. (
37). In our experiments, the amount of transposition
products peaked before 10 min in 3 mM Mg
2+ and then diminished.
Transposition products did not accumulate even after 120 min
with either core RAG2 or full-length RAG2 (data not shown).
Gellert and colleagues reported that the transposition products
increased and then diminished in 25 mM Mg
2+ but accumulated
in 5 mM Mg
2+ (
33). This discrepancy is probably due to the difference
in the reaction procedures. According to their study, RSS cleavage
and SE complex formation can proceed during the transposition
reaction (
33). This would result in the accumulation of transposition
products during the reaction and mask the effect of disintegration.
In our study, the SE complex was first purified and then used
for the transposition assay. Thus, the transposition products
did not accumulate. Unlike the transposition activity, the 3'-processing
activity under identical buffer conditions was not affected
by the presence of the C-terminal region of the full-length
RAG2 (Fig.
6B). It should be mentioned that the full-length
RAG2 also supported the cleavage of the 4-nt 3' overhang (data
not shown).

DISCUSSION
Mechanism of the 3' processing of the overhanging DNA with the SE complex.
In the present study, we have found that the SE complex cleaves
the 3'-overhanging structure of the ds DNA under the physiological
metal condition. The 3'-overhanging structure is attacked by
the SE complex imprecisely near the ds/ss junction and transferred
to the SE. The transferred overhang is then resolved and cleaved
precisely at the ds/ss junction. Thus, the blunt-end structure
is restored for the SE and variably processed ends are generated
for the CE DNA. The cleavage and transfer of the 3' overhang
is likely to occur by transesterification: the 3'-OH group of
the SE attacks the substrate DNA near the ds/ss junction, resulting
in a covalent linkage of the SE to the 3' overhang (
26). However,
it is still possible that the 3' overhang is cleaved by a mechanism
other than the strand transfer. Further study, e.g., on the
stereochemical course of reaction, is needed to clarify this
issue. Unlike the RAG-mediated transposition (
33), reversal
of the strand transfer is not favored, and the 3'-processed
ds DNA is thus released from the SE complex (data not shown).
The transferred 3' overhang is then cleaved from the SE by hydrolysis,
alcoholysis, or circular DNA formation. This resolution is strikingly
similar to the reaction mediated by the human immunodeficiency
virus type 1 integrase, which removes two nucleotides from the
3' end of the viral DNA via hydrolysis, alcoholysis, or circular-dinucleotide
formation in vitro (
10). A catalytic DDE motif, found in the
transposases and retroviral integrases, is also found in the
RAG1 protein (
12,
23,
25). We have found that the SE complex
reconstituted with the mutant RAG1 (D708A), which has a mutation
in the DDE motif (
12,
23), failed to mediate both steps in the
3'-processing reaction (data not shown).
The 3'-processing reaction is similar to but distinct from the transposition and disintegration reaction.
The first step in the 3'-processing reaction can be regarded as the initial transposition reaction targeting the distorted DNA structure (26, 55). However, the 3'-processing and transposition reactions are different in the subsequent steps. The transpositional strand transfer to the ds DNA is followed by the reversal reaction that removes the SE from the transposition product and reseals the target DNA (33). This reaction was proposed to explain at least in part why the RAG-mediated transposition does not usually occur in cells (33). In contrast, strand transfer to the 3' overhang is followed by the release of the 3'-processed ds DNA and by the hydrolysis-mediated resolution of the ST intermediate, accumulating the cleavage products.
It should be noted that the C-terminal region of the full-length RAG2 has different effects on the 3'-processing and the transposition and disintegration reactions: the 3'-processing activity was not affected by the presence of the C-terminal region of RAG2, whereas the transposition activity was significantly reduced (Fig. 6) (57). We suppose that the presence of the C-terminal region of RAG2 may interfere with the accessibility of the target ds DNA (9, 57), but not with the 3'-overhanging end. It is possible that the C-terminal region of the RAG2 may play a role in preventing the harmful transposition in cells (9, 51, 57) while maintaining the 3'-processing activity.
Implication for the junctional diversification in V(D)J joining.
It is important to determine that the 3'-processing activity detected in vitro in the present study plays a role in processing the hairpin-opened CEs in vivo. It has been reported that the hairpin opening yields mainly the 3'-overhanging structure in the CE (7, 29, 30, 49). Since the 3' overhang can be cleaved at variable sites near the ds/ss junction in vitro (Fig. 1), this cleavage, if it also occurs in vivo, may contribute to the diversity at the junctional sequences of antigen receptor genes. In contrast, the cleavage on the ST occurs precisely at the ds/ss junction (Fig. 4). Restoration of the blunt-end structure at the SE is consistent with the observation that most signal joints do not contain any nucleotide addition or deletion (50).
In the double-strand break repair, nucleotide removal is usually necessary to tailor the DNA ends suitable for ligation. It has been reported that the Artemis/DNA-PKcs complex possesses the 3' and 5' overhang endonuclease activities that may be involved in the repair and processing of the CEs (30). Variable CE processing may require other nucleases with different cleavage site preferences. Since the SE complex tends to cleave at sites in the 3' overhang that are more 5' than those of Artemis/DNA-PKcs (30), it could contribute more junctional diversity than the Artemis/DNA-PKcs alone, if the SE complex is actually involved in the CE processing in vivo.
To examine the CE processing by the SE complex in vivo, mutant RAGs defective in the 3'-processing activity will be helpful. Reconstitution of the postcleavage processes in vitro, which depend on repair factors such as Ku, will also be necessary. Although these attempts are now under way, some recent findings are encouraging. First, studies with the mutant RAGs have suggested that the RAG proteins may play an architectural role in the postcleavage phase of V(D)J recombination (20, 56). If this is the case, the RAG proteins are likely to associate with or stay near the CEs in the SE complex (2, 18, 40). Second, unlike the 3' flap endonuclease, the 3'-processing activity of the SE complex is high when Mg2+ is present in vitro (Fig. 1B). Third, among the known strand transfer activities of the SE complex, only the 3' processing could have a physiologic role, preventing a potentially harmful transposition in cells. Finally, the 3'-processing activity is not affected by the presence of the C-terminal region of the RAG2 (Fig. 6), while the transposition activity is significantly reduced (57). The C-terminal region of the RAG2 may be important in preventing the harmful transposition (9, 51, 57) while maintaining the CE processing activity, although it has yet to be verified that this occurs in cells.
The RAG-mediated transposition can be found in Saccharomyces cerevisiae cells (5) but rarely occurs in the mammalian cells. However, the SE complex appears to possess the strand transfer activity in the mammalian cells, because the RAG-mediated hybrid joining has been reported for the extrachromosomal recombination with the truncated RAG proteins (16, 51). A similar observation was also made for the antigen receptor loci in the Ku gene knockout mice where the hairpin CEs accumulate (4, 61). The hybrid joining may result from the unregulated strand transfer of the SE on the CEs before hairpin opening.
V(D)J recombination may be a reversal of an accidental insertion of a transposable element into a primordial V gene, which was exploited later by the vertebrate immune system during evolution (45). In the initial phase of V(D)J joining, the RAG proteins cleave the RSS by a mechanism similar to that of transposition or that of retroviral integration (22, 58). The SE complex has been reported to possess the transposition activity in vitro, while such harmful transpositional strand transfer is rarely seen in vivo. It is tempting to assume that the strand transfer activity of RAG proteins is utilized to diversify the antigen receptor genes in V(D)J joining by removing the 3' overhang from the hairpin-opened CEs. However, this, of course, must be verified in the in vivo system in the future.

ACKNOWLEDGMENTS
We are grateful to D. G. Schatz for providing us with the expression
vectors for RAG proteins. We also thank Hitomi Sakano for critical
reading of the manuscript and Takeshi Imai for discussion.
This work was supported by grants from Japan Science and Technology Corporation, the Ministry of Education, Culture and Science, and the Mitsubishi Foundation.

FOOTNOTES
* Corresponding author. Mailing address: Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan. Phone: 81-3-5689-7239. Fax: 81-3-5689-7240. E-mail:
sakano{at}mail.ecc.u-tokyo.ac.jp.

Present address: Radiobiology Division, National Cancer Center Research Institute, Tsukiji, Chuo-ku, Tokyo 104-0045, Japan. 

REFERENCES
1 - Adachi, Y., S. Mizuno, and M. Yoshida. 1990. Efficient large-scale purification of non-histone chromosomal proteins HMG1 and HMG2 by using Polybuffer-exchanger PBE94. J. Chromatogr. 530:39-46.[Medline]
2 - Agrawal, A., and D. G. Schatz. 1997. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell 89:43-53.[CrossRef][Medline]
3 - Agrawal, A., Q. M. Eastman, and D. G. Schatz. 1998. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature 394:744-751.[CrossRef][Medline]
4 - Bogue, M. A., C. Wang, C. Zhu, and D. B. Roth. 1997. V(D)J recombination in Ku86-deficient mice: distinct effects on coding, signal, and hybrid joint formation. Immunity 7:37-47.[CrossRef][Medline]
5 - Clatworthy, A. E., M. A. Valencia, J. E. Haber, and M. A. Oettinger. 2003. V(D)J recombination and RAG-mediated transposition in yeast. Mol. Cell 12:489-499.[CrossRef][Medline]
6 - Difilippantonio, M. J., C. J. McMahan, Q. M. Eastman, E. Spanopoulou, and D. G. Schatz. 1996. RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination. Cell 87:253-262.[CrossRef][Medline]
7 - Ding, Q., Y. V. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek. 2003. Autophosphorylation of the catalytic subunit of the DNA-dependent protein kinase is required for efficient end processing during DNA double-strand break repair. Mol. Cell. Biol. 23:5836-5848.[Abstract/Free Full Text]
8 - Eastman, Q. M., T. M. Leu, and D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85-88.[CrossRef][Medline]
9 - Elkin, S. K., A. G. Matthews, and M. A. Oettinger. 2003. The C-terminal portion of RAG2 protects against transposition in vitro. EMBO J. 22:1931-1938.[CrossRef][Medline]
10 - Engelman, A., K. Mizuuchi, and R. Craigie. 1991. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell 67:1211-1221.[CrossRef][Medline]
11 - Frank, K. M., J. M. Sekiguchi, K. J. Seidl, W. Swat, G. A. Rathbun, H. L. Cheng, L. Davidson, L. Kangaloo, and F. W. Alt. 1998. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396:173-177.[CrossRef][Medline]
12 - Fugmann, S. D., I. J. Villey, L. M. Ptaszek, and D. G. Schatz. 2000. Identification of two catalytic residues in RAG1 that define a single active site within the RAG1/RAG2 protein complex. Mol. Cell 5:97-107.[CrossRef][Medline]
13 - Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, and D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261:1175-1178.[Abstract/Free Full Text]
14 - Grawunder, U., D. Zimmer, S. Fugmann, K. Schwarz, and M. R. Lieber. 1998. DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes. Mol. Cell 2:477-484.[CrossRef][Medline]
15 - Gu, Y., S. Jin, Y. Gao, D. T. Weaver, and F. W. Alt. 1997. Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination. Proc. Natl. Acad. Sci. USA 94:8076-8081.[Abstract/Free Full Text]
16 - Han, J. O., S. B. Steen, and D. B. Roth. 1997. Ku86 is not required for protection of signal ends or for formation of nonstandard V(D)J recombination products. Mol. Cell. Biol. 17:2226-2234.[Abstract]
17 - Hiom, K., and M. Gellert. 1997. A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage. Cell 88:65-72.[CrossRef][Medline]
18 - Hiom, K., and M. Gellert. 1998. Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination. Mol. Cell 1:1011-1019.[CrossRef][Medline]
19 - Hiom, K., M. Melek, and M. Gellert. 1998. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell 94:463-470.[CrossRef][Medline]
20 - Huye, L. E., M. M. Purugganan, M. M. Jiang, and D. B. Roth. 2002. Mutational analysis of all conserved basic amino acids in RAG-1 reveals catalytic, step arrest, and joining-deficient mutants in the V(D)J recombinase. Mol. Cell. Biol. 22:3460-3473.[Abstract/Free Full Text]
21 - Jones, J. M., and M. Gellert. 2001. Intermediates in V(D)J recombination: a stable RAG1/2 complex sequesters cleaved RSS ends. Proc. Natl. Acad. Sci. USA 90:12926-12931.
22 - Kennedy, A. K., A. Guhathakurta, N. Kleckner, and D. B. Haniford. 1998. Tn10 transposition via a DNA hairpin intermediate. Cell 95:125-134.[CrossRef][Medline]
23 - Kim, D. R., Y. Dai, C. L. Mundy, W. Yang, and M. A. Oettinger. 1999. Mutations of acidic residues in RAG1 define the active site of the V(D)J recombinase. Genes Dev. 13:3070-3080.[Abstract/Free Full Text]
24 - Komori, T., A. Okada, V. Stewart, and F. W. Alt. 1993. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science 261:1171-1175.[Abstract/Free Full Text]
25 - Landree, M. A., J. A. Wibbenmeyer, and D. B. Roth. 1999. Mutational analysis of RAG1 and RAG2 identifies three catalytic amino acids in RAG1 critical for both cleavage steps of V(D)J recombination. Genes Dev. 13:3059-3069.[Abstract/Free Full Text]
26 - Lee, G. S., M. B. Neiditch, R. R. Sinden, and D. B. Roth. 2002. Targeted transposition by the V(D)J recombinase. Mol. Cell. Biol. 22:2068-2077.[Abstract/Free Full Text]
27 - Li, Z., T. Otevrel, Y. Gao, H.-L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli, and F. W. Alt. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079-1089.[CrossRef][Medline]
28 - Lieber, M., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, and M. Gellert. 1988. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55:7-16.[CrossRef][Medline]
29 - Livak, F., and D. G. Schatz. 1997. Identification of V(D)J recombination coding end intermediates in normal thymocytes. J. Mol. Biol. 267:1-9.[CrossRef][Medline]
30 - Ma, Y., U. Pannicke, K. Schwarz, and M. R. Lieber. 2002. Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell 108:781-794.[CrossRef][Medline]
31 - McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, and M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387-395.[CrossRef][Medline]
32 - Melek, M., M. Gellert, and D. C. van Gent. 1998. Rejoining of DNA by the RAG1 and RAG2 proteins. Science 280:301-303.[Abstract/Free Full Text]
33 - Melek, M., and M. Gellert. 2000. RAG1/2-mediated resolution of transposition intermediates: two pathways and possible consequences. Cell 101:625-633.[CrossRef][Medline]
34 - Moshous, D., I. Callebaut, R. de Chasseval, B. Corneo, M. Cavazzana-Calvo, F. Le Deist, I. Tezcan, O. Sanal, Y. Bertrand, N. Philippe, A. Fischer, and J. P. de Villartay. 2001. Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell 105:177-186.[CrossRef][Medline]
35 - Nagawa, F., K. Ishiguro, A. Tsuboi, T. Yoshida, A. Ishikawa, T. Takemori, A. J. Otsuka, and H. Sakano. 1998. Footprint analysis of the RAG protein recombination signal sequence complex for V(D)J type recombination. Mol. Cell. Biol. 18:655-663.[Abstract/Free Full Text]
36 - Nagawa, F., M. Kodama, T. Nishihara, K. Ishiguro, and H. Sakano. 2002. Footprint analysis of recombination signal sequences in the 12/23 synaptic complex of V(D)J recombination. Mol. Cell. Biol. 22:7217-7225.[Abstract/Free Full Text]
37 - Neiditch, M. B., G. S. Lee, M. A. Landree, and D. B. Roth. 2001. RAG transposase can capture and commit to target DNA before or after donor cleavage. Mol. Cell. Biol. 21:4302-4310.[Abstract/Free Full Text]
38 - Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, and G. C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551-555.[CrossRef][Medline]
39 - Oettinger, M. A., D. G. Schatz, C. Gerka, and D. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248:1517-1523.[Abstract/Free Full Text]
40 - Perkins, E. J., A. Nair, D. O. Cowley, T. Van Dyke, Y. Chang, and D. A. Ramsden. 2002. Sensing of intermediates in V(D)J recombination by ATM. Genes Dev. 16:159-164.[Abstract/Free Full Text]
41 - Qiu, J. X., S. B. Kale, H. Yarnell Schultz, and D. B. Roth. 2001. Separation-of-function mutants reveal critical roles for RAG2 in both the cleavage and joining steps of V(D)J recombination. Mol. Cell 7:77-87.[CrossRef][Medline]
42 - Rooney, S., J. Sekiguchi, C. Zhu, H. L. Cheng, J. Manis, S. Whitlow, J. DeVido, D. Foy, J. Chaudhuri, D. Lombard, and F. W. Alt. 2002. Leaky Scid phenotype associated with defective V(D)J. coding end processing in Artemis-deficient mice. Mol. Cell 10:1379-1390.[CrossRef][Medline]
43 - Roth, D. B., J. P. Menetski, P. B. Nakajima, M. J. Bosma, and M. Gellert. 1992. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70:983-991.[CrossRef][Medline]
44 - Sadofsky, M. J. 2001. The RAG proteins in V(D)J recombination: more than just a nuclease. Nucleic Acids Res. 29:1399-1409.[Abstract/Free Full Text]
45 - Sakano, H., K. Huppi, G. Heinrich, and S. Tonegawa. 1979. Sequences at the somatic recombination sites of immunoglobulin light-chain genes. Nature 280:288-294.[CrossRef][Medline]
46 - Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, and S. Tonegawa. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy-chain genes. Nature 286:676-683.[CrossRef][Medline]
47 - Santagata, S., E. Besmer, A. Villa, F. Bozzi, J. S. Allingham, C. Sobacchi, D. B. Haniford, P. Vezzoni, M. C. Nussenzweig, Z. Q. Pan, and P. Cortes. 1999. The RAG1/RAG2 complex constitutes a 3' flap endonuclease: implications for junctional diversity in V(D)J and transpositional recombination. Mol. Cell 4:935-947.[CrossRef][Medline]
48 - Schatz, D. G., M. A. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell 59:1035-1048.[CrossRef][Medline]
49 - Schlissel, M. S. 1998. Structure of nonhairpin coding-end DNA breaks in cells undergoing V(D)J recombination. Mol. Cell. Biol. 18:2029-2037.[Abstract/Free Full Text]
50 - Schlissel, M. S. 2002. Does artemis end the hunt for the hairpin-opening activity in V(D)J recombination? Cell 109:1-4.[CrossRef][Medline]
51 - Sekiguchi, J. A., S. Whitlow, and F. W. Alt. 2001. Increased accumulation of hybrid V(D)J joins in cells expressing truncated versus full-length RAGs. Mol. Cell 8:1383-1390.[CrossRef][Medline]
52 - Spanopoulou, E., F. Zaitseva, F. H. Wang, S. Santagata, D. Baltimore, and G. Panayotou. 1996. The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell 87:263-276.[CrossRef][Medline]
53 - Swanson, P. C., and S. Desiderio. 1998. V(D)J recombination signal recognition: distinct, overlapping DNA-protein contacts in complexes containing RAG1 with and without RAG2. Immunity 9:115-125.[CrossRef][Medline]
54 - Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, and F. W. Alt. 1993. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260:207-210.[Abstract/Free Full Text]
55 - Tsai, C. L., M. Chatterji, and D. G. Schatz. 2003. DNA mismatches and GC-rich motifs target transposition by the RAG1/RAG2 transposase. Nucleic Acids Res. 31:6180-6190.[Abstract/Free Full Text]
56 - Tsai, C. L., A. H. Drejer, and D. G. Schatz. 2002. Evidence of a critical architectural function for the RAG proteins in end processing, protection, and joining in V(D)J recombination. Genes Dev. 16:1934-1949.[Abstract/Free Full Text]
57 - Tsai, C. L., and D. G. Schatz. 2003. Regulation of RAG1/RAG2-mediated transposition by GTP and the C-terminal region of RAG2. EMBO J. 22:1922-1930.[CrossRef][Medline]
58 - van Gent, D. C., K. Mizuuchi, and M. Gellert. 1996. Similarities between initiation of V(D)J recombination and retroviral integration. Science 271:1592-1594.[Abstract]
59 - van Gent, D. C., D. A. Ramsden, and M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85:107-113.[CrossRef][Medline]
60 - Yarnell Schultz, H., M. A. Landree, J. X. Qiu, S. B. Kale, and D. B. Roth. 2001. Joining-deficient RAG1 mutants block V(D)J recombination in vivo and hairpin opening in vitro. Mol. Cell 7:65-75.[CrossRef][Medline]
61 - Zhu, C., M. A. Bogue, D.-S. Lim, P. Hasty, and D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379-389.[CrossRef][Medline]
Molecular and Cellular Biology, May 2004, p. 3692-3702, Vol. 24, No. 9
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.9.3692-3702.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Nishihara, T., Nagawa, F., Imai, T., Sakano, H.
(2008). RAG-Heptamer Interaction in the Synaptic Complex Is a Crucial Biochemical Checkpoint for the 12/23 Recombination Rule. J. Biol. Chem.
283: 4877-4885
[Abstract]
[Full Text]
-
Raghavan, S. C., Swanson, P. C., Ma, Y., Lieber, M. R.
(2005). Double-Strand Break Formation by the RAG Complex at the Bcl-2 Major Breakpoint Region and at Other Non-B DNA Structures In Vitro. Mol. Cell. Biol.
25: 5904-5919
[Abstract]
[Full Text]
-
Nagawa, F., Hirose, S., Nishizumi, H., Nishihara, T., Sakano, H.
(2004). Joining Mutants of RAG1 and RAG2 that Demonstrate Impaired Interactions with the Coding-end DNA. J. Biol. Chem.
279: 38360-38368
[Abstract]
[Full Text]