![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, Falmer, Brighton, United Kingdom
Received 21 May 2004/ Returned for modification 30 June 2004/ Accepted 24 September 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Two classes of SUMO ligases have been identified. Proteins in the first category contain C3HC4-like RING domains, while proteins in the second category do not. Members of the first category include the Saccharomyces cerevisiae proteins Siz1 and Siz2 (16) and the mammalian PIAS family of proteins (20, 32, 38). Members of the second category include the RanBP2 and Pc proteins (18, 33). In S. cerevisiae (budding yeast), the SIZ1 and SIZ2 genes are not essential for viability, and null mutants do not show the severe cell and nuclear morphologies (16) that are observed with mutants that are defective in other components of the sumoylation system (17, 39). It remains unclear if there are additional SUMO ligases in S. cerevisiae or if the SUMO ligases serve to facilitate only a subset of SUMO conjugation reactions, with the remainder being driven by direct interactions with the E2-like conjugator.
In Schizosaccharomyces pombe (fission yeast), SUMO is encoded by the pmt3 gene (44), while the SAE heterodimer and the SUMO conjugator are encoded by the fub2, rad31, and hus5 genes, respectively (1, 12, 40, 44). Early analyses of rad31 and hus5 mutants indicated that cells defective in SUMO conjugation were sensitive to DNA-damaging agents, such as UV and ionizing radiation (IR), and to the DNA synthesis inhibitor hydroxyurea (HU) (1, 40). These results imply that sumoylation is required for the DNA damage response in fission yeast. Several DNA replication and repair proteins have recently been shown to be sumoylated. These include PCNA in S. cerevisiae (14, 41), topoisomerase I and thymine DNA glycosylase in humans (9, 25, 27), topoisomerase II in both humans and S. cerevisiae (2, 24), and Rad22 (the homologue of Rad52) in S. pombe (12). In the case of S. cerevisiae PCNA, sumoylation occurs on two sites in the protein, one of which is also targeted by ubiquitin. Sumoylation of PCNA occurs during normal S phase, while mono- and polyubiquitination are required for different modes of replication past DNA damage (14, 41).
The precise function of SUMO modification remains unknown. Unlike ubiquitination, sumoylation does not target proteins for proteasome-mediated destruction. SUMO modification has been reported to have a range of effects on protein function, but there is no unifying theme underlying how these effects are mediated. In some cases, SUMO and ubiquitin compete for the same lysine residue, e.g., in the cases of I
B
and PCNA (7, 14, 41). Sumoylation has been proposed to antagonize both ubiquitin-dependent degradation (in the case of IB) and ubiquitin-mediated changes in protein function (in the case of PCNA). SUMO modification has also been shown to affect protein localization and protein-protein interactions. For example, sumoylation of PML is required for the recruitment of Daax and Sp100 to discrete subnuclear bodies termed PODs (15, 22, 46), and sumoylation of RanGAP1 is required for its association with RanBP2 (23, 35).
Smc6 (Rad18) is a member of the SMC family of proteins and interacts with Smc5 (Spr18) to form the core of an Smc5-6 complex in fission yeast (8, 21) that is required for several aspects of DNA metabolism. Smc6 mutants (rad18.X and rad18.74) have been characterized as defective in recombinational repair processes (21, 31) and in the maintenance of the DNA integrity checkpoint in the presence of persistent unrepaired DNA damage (45). Unlike proteins involved in homologous recombination and checkpoint functions in fission yeast, the Smc5-6 complex also has an essential function (21). The nature of this defect is unclear, but it results in spontaneous checkpoint activation (10) and may be related to chromosomal fragmentation over several generations of growth (28). Smc6 (Rad18) and Smc5 (Spr18) have been shown to form a high-Mr complex (8) which contains several non-SMC proteins (26; see also the accompanying paper [39a]), namely, Nse1, Nse2, Nse3, and Rad62.
We demonstrate here that Nse2 is an autosumoylating SUMO ligase and confirm that it is part of the Smc5-6 complex. Using an in vitro sumoylation assay to analyze constituents of the Smc5-6 complex, we found that Smc6 (Rad18) and Nse3 are sumoylated in an Nse2-dependent manner but that Smc5 (Spr18) and Nse1 are not. Mutations of two residues in the C3HC4 RING-like domain of Nse2 resulted in a loss of in vitro SUMO ligase activity, and a corresponding strain (nse2.SA) containing the mutated gene as a single copy was viable but failed to efficiently sumoylate Smc6 (Rad18) in vivo. nse2 deletion cells were inviable, whereas nse2.SA cells were viable but sensitive to DNA-damaging agents and to the DNA synthesis inhibitor HU.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
18 leu1-32 h–) unless otherwise stated. rad18.X was described previously (21), rad18.74 was obtained from M. O'Connell (45), and rad18.T2 and rhp51.d were described elsewhere (29, 39a). The nse2 open reading frame (ORF) was amplified from cDNA by a PCR using the following primers: E32_EcoRI (5' GAATTCAAATGAGTGTGAAGCACAATTAAAAAC 3') and E32_NcoI (5' CCATGGGACTAAGCTTCTTTTAAATTAC 3'). The rad18 (smc6) and spr18 (smc5) ORFs have been described elsewhere (8, 21). The nse1 and nse3 ORFs and partial sequences of smc6 (rad18) and nse2 were described in the accompanying paper (39a). The nse2 ORF was deleted by transformation of a diploid strain with a DNA fragment comprising 1 kb of the nse2 5' region, ura4, and 1 kb of the nse2 3' region. The 5' region was amplified by use of the following primers: Nse2_KpnIF (5' CTGGTACCGAATCAGACGAGCAAGAATCTCG 3') and Nse2_XhoIR (5' GTGCTCGAGTCATTTACGATTCCATTCGAG 3'). The 3' region was amplified by the use of primers Nse2_EcoRIF (5' GAATTCTATTTACATTGTAGTACTGATCCCGG 3') and Nse2_PstIR (5' CTGCAGCATCAACAGTTGTTCTGCCTCTCAGAC 3'). Truncated forms of Nse2 were created as described by Sergeant et al. (39a). The nse2.SA mutant was created by use of the primers Nse2_C195S,H197A.F (5' CCCAATATTATCGACAGCCTCTAATGCTTTTTATGAAAAAGATGC 3') and Nse2_C195S,H197A.R (5' GCATCTTTTTCATAAAAAGCATTAGAGGCTGTCGATAATATTGGG 3'). The nse2.SA mutant sequence was integrated into the genome with the ura4 gene cloned between the 3' end of the nse2 ORF and the nse2 3' region amplified as described above. A wild-type control (nse2.CH) containing the ura4 gene adjacent to the wild-type nse2 sequence was created in parallel in a similar manner. Proteins were expressed in Escherichia coli as glutathione S-transferase (GST) fusions by use of a modified form of pGEXGH (a gift from H. Lindsay, Sussex, United Kingdom) or as His-tagged proteins by the use of pET15b (Novagen). For expression in S. pombe, cDNAs were cloned into pREP42MH or pREP41MH under the control of a modified form of the nmt1 promoter (6).
Protein methods and in vitro sumoylation assay. An in vitro sumoylation assay was used as described previously (12). pmt3.GG and pmt3.GG,K30R were created by site-directed mutagenesis as described elsewhere (J. Ho F. Z. Watts, submitted for publication). Gel filtration was performed with 200-ml exponentially growing cultures. Cells were harvested, washed, and then resuspended in 1 ml of lysis buffer (45 mM HEPES [pH 6.8], 300 mM KCl, 5 mM EGTA, 12 mM NaF, 10% glycerol, 80 mM ß-glycerophosphate, 0.1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 3 mM MgCl2, and a protease inhibitor cocktail consisting of 5 µg each of trypsin inhibitor, pepstatin, leupeptin, and aprotinin/ml, 10 µg each of bestatin and E-64/ml, and 50 µg of chymostatin/ml). The cells were then broken in a ribolyser, and cell debris was removed by centrifugation twice at 45,000 x g for 10 min. Proteins (1.5 mg) were loaded onto a Superdex 200 column, and 0.5-ml fractions were collected. Fifteen microliters of each fraction was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Total cell extracts were prepared by the use of trichloroacetic acid as described by Caspari et al. (5). Ni2+ pull-down experiments were performed as described previously (12). Immunoprecipitation was undertaken with cells in which the genomic smc6 (rad18) gene was N-terminally tagged with the c-myc epitope (8) as in the accompanying paper (39a).
Anti-SUMO antisera were raised as described previously (12), anti-GST antisera were a gift from S. Morley (Sussex, United Kingdom), anti-Smc5 (Spr18) antisera were described previously (8), and anti-Smc6 (Rad18) and anti-Nse1 antisera were described in the accompanying paper (39a). Anti-Nse2 antisera were prepared by the use of a recombinant Nse2 protein, which was prepared by thrombin cleavage of GST-tagged Nse2 to remove the GST, followed by injection into New Zealand White rabbits. The antibodies were affinity purified with glutathione-Sepharose beads to which GST-Nse2 had been cross-linked. Anti-tubulin monoclonal antibodies were purchased from Sigma.
Analysis of DNA damage and HU sensitivity. UV and IR sensitivities were analyzed as described previously (30). HU and methyl methanesulfonate (MMS) sensitivities were analyzed by plating cells on yeast extract-agar plates containing 6 mM HU or 0.005% MMS. Synchronous cultures were prepared with lactose gradients (3). G2 cells were irradiated with 200 or 400 Gy of IR before incubation at 30°C. Samples were taken at 20-min intervals postirradiation for DAPI (4',6'-diamidino-2-phenylindole) staining. Pulsed-field gel electrophoresis was performed with 20 A595 units of untreated exponentially growing cells or treated cells at various times after exposure to 450 Gy of IR. The cells were washed twice with CSE (20 mM citrate-phosphate [pH 5.6], 40 mM EDTA, 1.2 M sorbitol) and then incubated with 5 ml of CSE containing zymolyase (1.5 mg/ml) at 37°C for 1 h. The cells were then resuspended in 300 µl of TSE (10 mM Tris-HCl [pH 7.5], 45 mM EDTA, 0.9 M sorbitol) and warmed to 37°C. Next, 1.3 volumes of 1% LGT agarose were added, and 100-µl aliquots were dispensed into a plug mold. The cells were lysed by incubating the plugs in a solution containing 50 mM Tris-HCl (pH 7.5), 25 mM EDTA, and 1% SDS for 90 min at 55°C. The plugs were then transferred to a solution containing 1% lauryl sarcosine, 0.5 mM EDTA (pH 9.5), and 0.5 mg of proteinase K/ml and incubated at 55°C for 48 h. Fresh proteinase K was added (to 0.5 mg/ml) after 24 h. The plugs were inserted into wells in 0.8% agarose gels in 1x Tris-acetate-EDTA. The gels were run for 48 h with a pulse time of 1,800 s at 2 V/cm and an angle of 100°. The gels were then stained with ethidium bromide and photographed.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
SUMO ligase activity. The cDNA encoding the Nse2 ORF was cloned into the E. coli expression vector pGEX and transformed into E. coli cells, and the GST-tagged fusion protein was purified by the use of glutathione-Sepharose from induced cell extracts as described in Materials and Methods. The resulting protein migrated close to the predicted size of 55 kDa for GST-tagged Nse2 (Fig. 2A, lane 2). In order to determine whether Nse2 has SUMO ligase activity, we assayed the fusion protein by using a previously established in vitro sumoylation system (12). SUMO has been shown to be capable of forming chains in vitro, as determined by the production of high-Mr SUMO-containing species in vitro in the absence of a target protein (16). The production of these conjugated species is dependent on the addition of the E1-like SAE heterodimer, the E2-like conjugator Hus5, and Pmt3 (SUMO) (data not shown). Under conditions in which the level of the E2-like conjugator Hus5 was kept low (0.05 µg/µl), the level of SUMO conjugates also remained low (Fig. 2B, lane 1). Under these conditions, the addition of Nse2 (0.2 µg/µl) resulted in a substantial increase in the level of SUMO chains (lane 2). This is consistent with Nse2 having SUMO ligase activity when assayed for SUMO chain formation.
|
Nse2 is itself sumoylated. Many of the previously characterized SUMO ligases have been demonstrated to be sumoylated themselves (18, 36, 43). To determine whether Nse2 can also be modified by SUMO, we tested Nse2 labeled with [35S]methionine (by in vitro translation) as a potential substrate in the in vitro sumoylation assay described above. Figure 2C indicates that the incubation of 35S-labeled Nse2 with the SAE heterodimer, Hus5, and SUMO (Pmt3.GG) resulted in the appearance of slower migrating forms with sizes consistent with their being sumoylated species of Nse2 (lane 2). The presence of these species was dependent on SAE, Hus5, and Pmt3 (data not shown), further confirming that they are sumoylated forms of Nse2.
At least three modified forms of Nse2 were observed (Fig. 2C, lane 2). These may have arisen due to the use of more than one SUMO acceptor site or to the production of SUMO chains. Sumoylation occurs on lysine residues that are generally in the context of a consensus sequence, 
KxE (where is a hydrophobic amino acid). Nse2 has 17 lysine residues. We separately tested the N-terminal 178-aa (1-178) region of Nse2 and a C-terminal fragment of 127 aa (114-250) which contains the C3HC4 RING-finger-like domain for the ability to be sumoylated in vitro. Figure 2D, lane 2, indicates that there was a weak modification of the N-terminal fragment when it was incubated in the presence of all of the assay components (compare lane 2 to the situation in the absence of added Pmt3.GG [lane 1]). In contrast, when the C-terminal fragment was used in the in vitro assay, we found a more profound modification in the presence of all of the assay components (compare lane 4 to the situation in the absence of added Pmt3.GG [lane 3]).
Nse2 complexes. Nse2 was recently identified as a component of the Smc5-6 complex in fission yeast (26; see also the accompanying paper [39a]). The SMC proteins Smc6 (Rad18) and Smc5 (Spr18) form the core of a multiprotein complex in S. pombe. We investigated whether Nse2 is present in S. pombe extracts solely in a Smc6 (Rad18)-containing complex or whether it is also present in other complexes or in a monomer form. Total soluble cell extracts prepared from wild-type S. pombe were analyzed by gel filtration as described in Materials and Methods, and the resulting fractions were analyzed by Western blotting. Figure 3 indicates that the majority of the Nse2 protein comigrated with Smc6 (Rad18). Nse2 was present in fractions 7 to 9, which corresponded to molecular masses of >670 kDa. In contrast, Smc6 (Rad18) and Smc5 (Spr18) were present in these fractions but were also abundant in fractions 10 and 11, corresponding to molecular masses of approximately 670 kDa. The absence of Nse1 and Nse2 from fractions 10 and 11 suggests that there may be other forms of the Smc6-Smc5 (Rad18-Spr18) complex, one of which contains Nse1 and Nse2 and another that does not. An alternative explanation is that Nse1 and Nse2 are less tightly associated with the complex and dissociate during purification. Nse1 and Nse2 were also observed in fractions 23 to 26 and in fractions 21 and 22, respectively, consistent with the sizes expected for the monomeric Nse1 and Nse2 proteins.
|
|
To demonstrate that Smc6 (Rad18) is sumoylated when expressed at wild-type levels, we performed immunoprecipitation with extracts of cells in which Smc6 (Rad18) was tagged with Myc in the genome (Fig. 4F, lanes 1 and 5), using an untagged strain as a negative control (lanes 3 and 6). Probing the Western blots with anti-Pmt3 antisera indicated two modified forms of Smc6 (Rad18) after a long exposure of the film (lane 5), at 155 and 175 kDa, which were absent from the negative control (lane 6). This demonstrates that Smc6 (Rad18) is sumoylated in vivo when expressed at wild-type levels. Since Smc6 (Rad18) has roles in the DNA damage response, we were interested to determine whether sumoylation of the protein was affected by the exposure of cells to DNA-damaging agents. Even after a short exposure of the film, strong bands of sumoylated Smc6 (Rad18) were observed for cells 3 h after the treatment of cells with MMS (0.01%) (lane 8), in contrast to the weaker levels of sumoylation in untreated cells (lane 7).
The RING domain of Nse2 is required for sumoylation in vitro. To determine whether the C3HC4 RING-finger-like domain of Nse2 is required for its sumoylation activity, we mutated Cys195 and His197 to Ser and Ala, respectively. The mutant protein (Nse2.SA) was expressed in E. coli, and its sumoylation activity was assayed in vitro for both the ability to promote SUMO chain formation and the ability to act as a SUMO ligase for Smc6 (Rad18). Figure 5A indicates that, whereas wild-type Nse2 has the ability to form high-Mr SUMO-containing species (lane 3), this ability is lacking in the Nse2.SA mutant protein (lane 4). Figure 5B indicates that, as previously observed in Fig. 4A, the wild-type Nse2 protein increased the level of sumoylated Smc6 (Rad18) forms (lanes 3 and 4) compared to equivalent reactions lacking Nse2 (lane 2). In contrast, the Nse2.SA mutant protein was not able to promote the appearance of modified forms of Smc6 (Rad18) (lane 5).
|
The nse2.SA mutant has reduced levels of sumoylated Rad18 (Smc6). Smc6 (Rad18), Smc5 (Spr18), and Nse1 are all essential genes (8, 21, 26). We therefore determined whether or not nse2 is essential for viability. One copy of the nse2 gene was deleted from a diploid strain (see Materials and Methods), and tetrads were dissected from sporulating heterozygotes. Each tetrad resulted in only two viable colonies, all of which were ura–, indicating that nse2 is essential for cell viability. This confirms the results of MacDonald et al. (26). We were next interested in determining whether cells containing the nse2.SA mutation were viable. The nse2.SA mutant sequence was therefore integrated into the genome as the sole copy of nse2 (see Materials and Methods). Colonies containing the nse2.SA mutant gene were successfully obtained by use of a haploid strain for transformation, indicating that the mutation does not result in lethality. Backcrossing ensured that suppressor mutations were not required for this viability.
The nse2.SA mutant strain grew equally well at a range of temperatures (25 to 36°C), with generation times resembling those of the wild type, indicating that it is not temperature sensitive. By performing Western blotting, we showed that the level of Nse2 protein in nse2.SA cells was identical to that observed in wild-type total cell extracts (data not shown). Probing total cell extracts with anti-Pmt3 antisera demonstrated that the total sumoylation levels in nse2.SA (Fig. 5D, lane 6) resembled those observed for wild-type cells (lanes 1 and 7). This was in contrast to the situation seen for deletion mutants of the other SUMO ligase, pli1 (lane 5) (Ho et al., submitted), and for rad31.d, hus5.17, and hus5.62 mutants (lanes 2 to 4), in which sumoylation levels were substantially reduced. We have also shown by gel filtration that the Smc5-6 complex was not disrupted in the nse2.SA mutant (data not shown).
We have shown that in vitro, the Nse2.SA protein has a reduced ability to direct the sumoylation of Smc6 (Rad18). To determine whether the sumoylation of Smc6 was affected in the nse2.SA strain in vivo, we performed Ni2+-agarose affinity purification as described for Fig. 4E. Extracts were prepared from nse2.SA and wild-type cells that had been transformed with either the pREP41MH empty vector control or pREP41MH-Smc6 (Rad18). nse2.SA and wild-type cells transformed with pREP41MH-Smc6 (Rad18) expressed similar levels of Myc-His-Smc6 (Rad18) (Fig. 5E, lanes 1 and 3, respectively), indicating that the stability of the expressed Smc6 (Rad18) protein was not affected in the mutant strain. After the purification of Myc-His-Smc6 (Rad18) by Ni2+-agarose affinity chromatography from extracts prepared from wild-type cells that had been transformed with pREP41MH-Smc6 (Rad18), bands corresponding to SUMO-containing species of 155 and 175 kDa were observed (Fig. 5E, lane 7). These species were absent from equivalent purification reactions from extracts of wild-type cells that had been transformed with the empty vector (Fig. 5E, lane 8). In contrast, the high-Mr SUMO-containing species were barely detectable in extracts prepared from nse2.SA cells that had been transformed with pREP41MH-Smc6 (Rad18) (Fig. 5E, lane 5). These data indicate that the sumoylation of Smc6 (Rad18) is substantially reduced in vivo in nse2.SA cells.
The nse2.SA mutant is sensitive to DNA-damaging agents and to HU. Since the Smc5-6 complex is required for a range of functions associated with the response to DNA damage in addition to its essential function, we tested the response of the nse2.SA mutant to DNA-damaging agents and to exposure to the replication inhibitor HU. Figure 6A and B indicate that the nse2.SA mutant was significantly, but not dramatically, sensitive to both UV and ionizing radiation compared to wild-type cells. It was markedly less sensitive to UV and IR than is the nse2-1 allele (26). Strikingly, nse2.SA colonies appeared more slowly than wild-type cells after exposure to UV (data not shown). This is reminiscent of the response we observed for rad18.X cells when they were exposed to UV, for which colony formation was retarded substantially (data not shown). nse2.SA cells were also sensitive to both HU (6 mM) and MMS (0.005%), a similar profile to that seen for rad18.X cells (Fig. 6C).
|
We next investigated interactions between the nse2.SA mutant and some of the rad18 alleles. Double mutants of nse2.SA with rad18.X and rad18.74 were not viable, and a nse2.SA rad18.T2 double mutant grew more slowly than a rad18.T2 mutant. Epistasis analysis indicated that nse2.SA and rad18.T2 are epistatic in their response to IR (data not shown), but not in their response to UV (Fig. 6E). To confirm that the nse2.SA repair defect is epistatic with rhp51-dependent homologous recombination repair, as previously demonstrated for the rad18.X mutant (21) and the nse2-1 allele (26), we performed epistasis analysis for nse2.SA and rhp51.d. nse2.SA was epistatic with rhp51.d for its response to both UV and IR (Fig. 6F and data not shown). Furthermore, like the rad18.X mutant, nse2.SA was not epistatic with mutations in the nucleotide excision repair pathway (swi10.d and rad16.d [data not shown]).
We compared the cell cycle arrest kinetics of wild-type, nse2.SA, and rad18.74 cells. Interestingly, asynchronous cultures of nse2.SA and rad18.74 cells both contained a small proportion of elongated cells and cells with aberrant chromosomes (data not shown), suggesting that there is a mitotic defect in these cells. We analyzed checkpoint profiles of irradiated synchronized cultures after irradiation by DAPI staining to determine whether the cells were able to arrest the cell cycle in response to DNA damage. G2-phase cultures were exposed to 200 or 400 Gy of ionizing radiation, and the percentages of cells that passed mitosis were monitored. As observed with wild-type cells, nse2.SA and rad18.74 cells arrested the cell cycle after exposure to IR in a dose-dependent manner (Fig. 6G) and returned to the cell cycle with similar kinetics to the wild type.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In S. pombe, a complete loss of SUMO conjugation results in very sick cells that cannot be propagated beyond microcolonies (1, 44). Here we demonstrated that the essential nse2 gene has SUMO ligase activity. We also demonstrated that the highly conserved Cys and His amino acids in the C3HC4 RING-finger-like domain are required for SUMO ligase activity in vitro. The requirement for this RING-finger-like domain has also been observed for Siz1 and some of the PIAS proteins (19, 32, 42). Our data show, however, that the inviability of the nse2 null mutant is not a consequence of a lack of Nse2-dependent SUMO ligase activity.
We and others (26, 39a) have shown that Nse2 is a component of the S. pombe Smc5-6 complex. Previous reports of C3HC4-like domain-containing SUMO ligases have not identified these proteins as existing as part of larger protein complexes, although RanBP2, a member of a separate class of SUMO ligases, is a component of the nuclear pore (33). Gel filtration of S. pombe cell extracts indicated that the majority of the Nse2 protein in these extracts was in the Smc5-6 complex, with only a small amount present in the monomer form. Nse2 was not observed in any other high-Mr complexes. We cannot determine directly whether there is free functional Nse2 in intact cells or whether the small quantity of monomeric Nse2 seen in our fractionation studies was a result of the dissociation of Nse2 from the Smc5-6 complex during the preparation of extracts. However, our data strongly suggest that the major role of Nse2 is performed as part of the Smc5-6 complex.
Of the six components of the Smc5-6 complex, we have shown that three (Smc6 [Rad18], Nse3, and Nse2 itself) are sumoylated in an Nse2-dependent manner in vitro, whereas Smc5 (Spr18) and Nse1 do not appear to be modified. Furthermore, Smc6 (Rad18) was sumoylated in vivo and the levels of the modified form increased substantially after exposure to MMS, implicating that the sumoylation of Smc6 (Rad18) has a role in the DNA damage response. The modification was dramatically reduced in the nse2.SA mutant. In vitro, the Nse2.SA mutant protein had lost its SUMO ligase activity, and it is reasonable to predict on the basis of the function of the RING domain in ubiquitin ligases that this will also be the case in vivo. This would imply that one function of Nse2 is to promote the sumoylation of Smc6 (Rad18). It is intriguing that Nse2 appears to bind via its N terminus to Smc5 (Spr18) (39a) and that it sumoylates the Smc5 partner protein Smc6 (Rad18) via the RING motif in the C terminus. The fact that the ligase-dead nse2.SA RING domain mutant was viable whereas a deletion mutant was inviable may indicate that, in addition to its SUMO ligase activity, Nse2 plays an essential structural role in the Smc5-6 complex. Whatever the essential function of Nse2 is, our data show the following two separate functions of Nse2: an essential role (possibly in the integrity of the Smc5-6 complex) and a nonessential role promoting the sumoylation of targets (one of which is Smc6 [Rad18]).
An analysis of the phenotype of the nse2.SA mutant showed that it was similar to, but somewhat less severe than, those of rad18.X and rad18.74. Specifically, there were similarities in the responses of the different mutants to UV, ionizing radiation, HU, and MMS. nse2.SA mutants were also deficient in the repair of double strand breaks (as judged by PFGE), and the slow growth of nse2.SA colonies after exposure to UV may also suggest that the mutant has a reduced ability to repair UV-induced damage. Mutants with defects in the related protein in S. cerevisiae (Mms21) are also sensitive to DNA-damaging agents, including UV, ionizing radiation, and MMS. The mms21-1 mutant displays increased spontaneous mitotic segregation, which is consistent with a deficiency in the repair of single strand DNA breaks, possibly arising during DNA replication (34).
The UV- and IR-sensitive phenotypes of the nse2.SA mutant also resembled, but were slightly less severe than, those of the rad31.d mutant and the hus5 mutants, hus5.17 and hus5.62, which are defective in one-half of the SUMO activator and the SUMO conjugator, respectively (1, 13, 40). In contrast, the rad31.d and hus5 mutants were more sensitive to MMS and displayed a slow growth phenotype. The similar sensitivities to UV and IR of the nse2.SA, rad31.d, and hus5 mutants suggest that while, by analogy with the situation in other organisms, many proteins may be sumoylated in S. pombe, the loss of Nse2-dependent sumoylating activity (which may be limited to a small number of targets) may account for a significant proportion of the rad31.d and hus5 mutant UV- and IR-sensitive phenotypes.
Taken together, our data suggest that the Nse2-dependent SUMO modification of several target proteins is an important aspect of the DNA damage response that involves the Smc5-6 complex. Indeed, we have identified Smc6 (Rad18) as a target of SUMO modification in vivo and have shown that this largely depends on the integrity of the ligase domain of Nse2. Several other components of the Smc5-6 complex, including Nse2 itself, are targets of Nse2 ligase in vitro, although this remains to be verified in vivo. The presence of the majority of soluble cellular Nse2 in the Smc5-6 complex further suggests that the major role of Nse2 is its function as part of this complex. The synthetic lethality of nse2.SA with the rad18.X and rad18.74 mutants suggests that sumoylation of Rad18 may be required for its stability. One intriguing possibility is that the Smc5-6 complex localizes Nse2 to additional target proteins, perhaps in response to DNA damage or during DNA replication. Further biochemical and genetic analyses will determine whether this is the case.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bachant, J., A. Alcasabas, Y. Blat, N. Kleckner, and S. J. Elledge. 2002. The SUMO-1 isopeptidase Smt4 is linked to centromeric cohesion through SUMO-1 modification of DNA topoisomerase II. Mol. Cell 9:1169-1182.[CrossRef][Medline]
3. Barbet, N. C., and A. M. Carr. 1993. Fission yeast wee1 protein kinase is not required for DNA damage-dependent mitotic arrest. Nature 364:824-827.[CrossRef][Medline]
4. Bernier-Villamor, V., D. A. Sampson, M. J. Matunis, and C. D. Lima. 2002. Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108:345-356.[CrossRef][Medline]
5. Caspari, T., M. Dahlen, G. Kanter-Smoler, H. D. Lindsay, K. Hofmann, K. Papadimitriou, P. Sunnerhagen, and A. M. Carr. 2000. Characterization of Schizosaccharomyces pombe Hus1: a PCNA-related protein that associates with Rad1 and Rad9. Mol. Cell. Biol. 20:1254-1262.
6. Craven, R. A., D. J. Griffiths, K. S. Sheldrick, R. E. Randall, I. M. Hagan, and A. M. Carr. 1998. Vectors for the expression of tagged proteins in Schizosaccharomyces pombe. Gene 221:59-68.[CrossRef][Medline]
7. Desterro, J. M., M. S. Rodriguez, and R. T. Hay. 1998. SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2:233-239.[CrossRef][Medline]
8. Fousteri, M. I., and A. R. Lehmann. 2000. A novel SMC protein complex in Schizosaccharomyces pombe contains the Rad18 DNA repair protein. EMBO J. 19:1691-1702.[CrossRef][Medline]
9. Hardeland, U., R. Steinacher, J. Jiricny, and P. Schar. 2002. Modification of the human thymine-DNA glycosylase by ubiquitin-like proteins facilitates enzymatic turnover. EMBO J. 21:1456-1464.[CrossRef][Medline]
10. Harvey, S. H., D. M. Sheedy, A. R. Cuddihy, and M. J. O'Connell. 2004. Coordination of DNA damage responses via the Smc5/Smc6 complex. Mol. Cell. Biol. 24:662-674.
11. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu. Rev. Biochem. 67:425-479.[CrossRef][Medline]
12. Ho, J. C., N. J. Warr, H. Shimizu, and F. Z. Watts. 2001. SUMO modification of Rad22, the Schizosaccharomyces pombe homologue of the recombination protein Rad52. Nucleic Acids Res. 29:4179-4186.
13. Ho, J. C., and F. Z. Watts. 2003. Characterization of SUMO-conjugating enzyme mutants in Schizosaccharomyces pombe identifies a dominant-negative allele that severely reduces SUMO conjugation. Biochem. J. 372:97-104.[CrossRef][Medline]
14. Hoege, C., B. Pfander, G. L. Moldovan, G. Pyrowolakis, and S. Jentsch. 2002. RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419:135-141.[CrossRef][Medline]
15. Ishov, A. M., A. G. Sotnikov, D. Negorev, O. V. Vladimirova, N. Neff, T. Kamitani, E. T. Yeh, J. F. Strauss III, and G. G. Maul. 1999. PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J. Cell Biol. 147:221-234.
16. Johnson, E. S., and A. A. Gupta. 2001. An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106:735-744.[CrossRef][Medline]
17. Johnson, E. S., I. Schwienhorst, R. J. Dohmen, and G. Blobel. 1997. The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16:5509-5519.[CrossRef][Medline]
18. Kagey, M. H., T. A. Melhuish, and D. Wotton. 2003. The polycomb protein Pc2 is a SUMO E3. Cell 113:127-137.[CrossRef][Medline]
19. Kahyo, T., T. Nishida, and H. Yasuda. 2001. Involvement of PIAS1 in the sumoylation of tumor suppressor p53. Mol. Cell 8:713-718.[CrossRef][Medline]
20. Kotaja, N., U. Karvonen, O. A. Janne, and J. J. Palvimo. 2002. PIAS proteins modulate transcription factors by functioning as SUMO-1 ligases. Mol. Cell. Biol. 22:5222-5234.
21. Lehmann, A. R., M. Walicka, D. J. Griffiths, J. M. Murray, F. Z. Watts, S. McCready, and A. M. Carr. 1995. The rad18 gene of Schizosaccharomyces pombe defines a new subgroup of the SMC superfamily involved in DNA repair. Mol. Cell. Biol. 15:7067-7080.[Abstract]
22. Li, H., C. Leo, J. Zhu, X. Wu, J. O'Neil, E. J. Park, and J. D. Chen. 2000. Sequestration and inhibition of Daxx-mediated transcriptional repression by PML. Mol. Cell. Biol. 20:1784-1796.
23. Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88:97-107.[CrossRef][Medline]
24. Mao, Y., S. D. Desai, and L. F. Liu. 2000. SUMO-1 conjugation to human DNA topoisomerase II isozymes. J. Biol. Chem. 275:26066-26073.
25. Mao, Y., M. Sun, S. D. Desai, and L. F. Liu. 2000. SUMO-1 conjugation to topoisomerase I: a possible repair response to topoisomerase-mediated DNA damage. Proc. Natl. Acad. Sci. USA 97:4046-4051.
26. McDonald, W. H., Y. Pavlova, J. R. Yates III, and M. N. Boddy. 2003. Novel essential DNA repair proteins Nse1 and Nse2 are subunits of the fission yeast Smc5-Smc6 complex. J. Biol. Chem. 278:45460-45467.
27. Mo, Y. Y., Y. Yu, Z. Shen, and W. T. Beck. 2002. Nucleolar delocalization of human topoisomerase I in response to topotecan correlates with sumoylation of the protein. J. Biol. Chem. 277:2958-2964.
28. Morishita, T., Y. Tsutsui, H. Iwasaki, and H. Shinagawa. 2002. The Schizosaccharomyces pombe rad60 gene is essential for repairing double-strand DNA breaks spontaneously occurring during replication and induced by DNA-damaging agents. Mol. Cell. Biol. 22:3537-3548.
29. Muris, D. F., K. Vreeken, A. M. Carr, B. C. Broughton, A. R. Lehmann, P. H. Lohman, and A. Pastink. 1993. Cloning the RAD51 homologue of Schizosaccharomyces pombe. Nucleic Acids Res. 21:4586-4591.
30. Murray, J. M., A. M. Carr, A. R. Lehmann, and F. Z. Watts. 1991. Cloning and characterisation of the rad9 DNA repair gene from Schizosaccharomyces pombe. Nucleic Acids Res. 19:3525-3531.
31. Murray, J. M., H. D. Lindsay, C. A. Munday, and A. M. Carr. 1997. Role of Schizosaccharomyces pombe RecQ homolog, recombination, and checkpoint genes in UV damage tolerance. Mol. Cell. Biol. 17:6868-6875.[Abstract]
32. Nishida, T., and H. Yasuda. 2002. PIAS1 and PIASxalpha function as SUMO-E3 ligases toward androgen receptor and repress androgen receptor-dependent transcription. J. Biol. Chem. 277:41311-41317.
33. Pichler, A., A. Gast, J. S. Seeler, A. Dejean, and F. Melchior. 2002. The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108:109-120.[CrossRef][Medline]
34. Prakash, S., and L. Prakash. 1977. Increased spontaneous mitotic segregation in MMS-sensitive mutants of Saccharomyces cerevisiae. Genetics 87:229-236.
35. Saitoh, H., R. Pu, M. Cavenagh, and M. Dasso. 1997. RanBP2 associates with Ubc9p and a modified form of RanGAP1. Proc. Natl. Acad. Sci. USA 94:3736-3741.
36. Saitoh, H., D. B. Sparrow, T. Shiomi, R. T. Pu, T. Nishimoto, T. J. Mohun, and M. Dasso. 1998. Ubc9p and the conjugation of SUMO-1 to RanGAP1 and RanBP2. Curr. Biol. 8:121-124.[CrossRef][Medline]
37. Saka, Y., P. Fantes, T. Sutani, C. McInerny, J. Creanor, and M. Yanagida. 1994. Fission yeast cut5 links nuclear chromatin and M phase regulator in the replication checkpoint control. EMBO J. 13:5319-5329.[Medline]
38. Schmidt, D., and S. Muller. 2002. Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc. Natl. Acad. Sci. USA 99:2872-2877.
39. Schwienhorst, I., E. S. Johnson, and R. J. Dohmen. 2000. SUMO conjugation and deconjugation. Mol. Gen. Genet. 263:771-786.[CrossRef][Medline]
39. Sergeant, J., E. Taylor, J. Palecek, M. Fousteri, E. Andrews, S. Sweeney, H. Shinagawa, F. Watts, and A. Lehmann. 2005. Composition and architecture of the Schizosaccharomyces pombe Rad18 (Smc5-6) complex. Mol. Cell. Biol. 25:172-184.
40. Shayeghi, M., C. L. Doe, M. Tavassoli, and F. Z. Watts. 1997. Characterisation of Schizosaccharomyces pombe rad31, a UBA-related gene required for DNA damage tolerance. Nucleic Acids Res. 25:1162-1169.
41. Stelter, P., and H. D. Ulrich. 2003. Control of spontaneous and damage-induced mutagenesis by SUMO and ubiquitin conjugation. Nature 425:188-191.[CrossRef][Medline]
42. Takahashi, Y., T. Kahyo, E. A. Toh, H. Yasuda, and Y. Kikuchi. 2001. Yeast Ull1/Siz1 is a novel SUMO1/Smt3-ligase for septin components and functions as an adaptor between conjugating enzyme and substrates. J. Biol. Chem. 276:48973-48977.
43. Takahashi, Y., E. A. Toh, and Y. Kikuchi. 2003. Comparative analysis of yeast PIAS-type SUMO ligases in vivo and in vitro. J. Biochem. (Tokyo) 133:415-422.
44. Tanaka, K., J. Nishide, K. Okazaki, H. Kato, O. Niwa, T. Nakagawa, H. Matsuda, M. Kawamukai, and Y. Murakami. 1999. Characterization of a fission yeast SUMO-1 homologue, Pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol. Cell. Biol. 19:8660-8672.
45. Verkade, H. M., S. J. Bugg, H. D. Lindsay, A. M. Carr, and M. J. O'Connell. 1999. Rad18 is required for DNA repair and checkpoint responses in fission yeast. Mol. Biol. Cell 10:2905-2918.
46. Zhong, S., S. Muller, S. Ronchetti, P. S. Freemont, A. Dejean, and P. P. Pandolfi. 2000. Role of SUMO-1-modified PML in nuclear body formation. Blood 95:2748-2752.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
), 200 Gy of IR (
), or 400 Gy of IR (
). Samples were taken at 20-min intervals and fixed in methanol. They were stained with DAPI and calcofluor, and the percentages of cells that passed mitosis were assessed.