Neurobiology Programme, The Babraham Institute, Babraham, Cambridge, United Kingdom,1 Department of Pharmacology, College of Medicine, National Creative Research Initiative Center for Alzheimer's Dementia and Neuroscience Research Institute, MRC, Seoul National University, Seoul, South Korea2
Received 9 June 2004/ Returned for modification 21 June 2004/ Accepted 6 September 2004
| ABSTRACT |
|---|
|
|
|---|
ß or cyclin-dependent kinase 5. The increase in MAPK activation was a discrete effect of APPV717I-CT100 transgene expression as near identical changes were observed in single APPV717I-CT100 mice. Age-dependent deficits in memory were also associated with tauV337M and APPV717I-CT100 expression. The data reveal distinct routes to abnormal tau phosphorylation in models of AD and FTDP-17 and suggest that in AD, tau irregularities may be linked to processing of APP C-terminal fragments via specific effects on MAPK activation status. | INTRODUCTION |
|---|
|
|
|---|
Our development of the FTDP-17 and AD models allowed us to address a number of additional questions by crossbreeding the single transgenic mice to produce a "combined" transgenic mouse. Hence, comparisons across the transgenic lines of the extent of tau phosphorylation and the activity status of kinases known to phosphorylate tau provided an analysis of any differences between the tauopathy models and also evidence of interactions between tau and APP C-terminal fragment metabolism. This latter possibility, which is of specific relevance to AD where tauopathy and amyloidopathy coexist, has been suggested by data obtained with neuronal cell lines showing that Aß can activate GSK-3
ß and ERK1/2, both tau kinases (39, 48). However, the most compelling data derive from in vivo studies, where injection of Aß fibrils into the brains of mice expressing an FTDP-17 mutation leads to increased numbers of neurofibrillary tangles (18). Mice expressing familial AD APP and FTDP-17 tau mutations in combination have also shown increased formation of tau-positive neuropathology compared to mice expressing only the tau mutation (31). To examine the evidence of possible cross talk between tau and APP C-terminal fragments in more detail, the present work focused on molecular aspects of tau phosphorylation. The work also used behavioral tests, including a task of olfactory memory, to assess the functional effects of any molecular changes identified.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Founder animals were intercrossed with (C57BL/6J x CBA/Ca)F1 mice to establish lines. Hemizygous tauV337M and APPV717I-CT100 mice from the experimental lines chosen were mated to produce hemizygous tauV337M x APPV717I-CT100 combined, hemizygous tauV337M, hemizygous APPV717I-CT100, and wild-type animals.
In situ hybridization. Brain sections from transgenic and littermate wild-type mice were cut on the sagittal plane at 12 µm and mounted on poly-L-lysine-coated slides. Slides were fixed in 4% paraformaldehyde, washed in phosphate-buffered saline, and stored in 95% ethanol at 4°C until use. Prior to hybridization, slides were washed in 1x saline sodium citrate (SSC) (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) with 20 mM ß-mercaptoethanol, first at 20°C and then at 55°C, dehydrated in an ascending ethanol series, and dried. Brain sections were labeled with specific radiolabeled oligonucleotide probes hybridizing to unique sequences within both transgene mRNAs and endogenous tau and APP transcripts: 5' CTTGGGCTCCCGGGTGGGTGGGGTTGGTTGGGACGGGGTGCGGGAG 3' (human tau), 5' CTTGGGCTCCCGGGTGGGCGGTGTTGGTAGGGATGGGGTGCGCGAG 3' (mouse tau), 5' CAGCATCACCAAGGTGAATGACGATCACTGTCGCTATGACAACACC 3' (human APP-CT100), and 5' CAACATCACCACGGTGATGACAATCACGGTTGCTATGACAACGCC 3' (mouse APP).
Each probe was 3' end labeled with terminal transferase and 35S-labeled d-ATP and used at 350,000 cpm/µl. Sections were hybridized overnight at 55°C in a 50% formamide hybridization mixture. The slides were washed in 2x SSC-0.1% sodium dodecyl sulfate (SDS), RNase treated (RNase, 10 µg/ml), and dehydrated in an ascending ethanol series. Labeled sections and radioactive standards (14C-labeled microstandards; Amersham, Little Chalfont, United Kingdom) were exposed to x-ray film for 25 days.
Immunohistochemical and histological studies. Brain sections from transcardially perfused animals, cut in the sagittal plane at 30 µm, were stained with standard immunohistochemical techniques, following blocking of endogenous peroxidase activity (20% methanol, 1.5% hydrogen peroxide) and incubation in blocking solution (3% normal goat serum, 2 g of bovine serum albumin/liter, 0.1% Triton X-100) or MOM immunoglobulin blocking reagent (Vector Laboratories, Burlingame, Calif.). Free-floating sagittal sections were incubated overnight at 4°C with primary antibodies to APP (C-terminus specific; Chemicon), Aß (amino acids 1 to 17; Chemicon), tau (T14 clone; Zymed) or phospho S202/T205 tau (AT8 epitope; Innogenetics). Goat anti-rabbit biotinylated secondary antibody (ABC Vectastain kit; Vector Laboratories) and reagents and biotinylated secondary antibody from a Vector MOM immunodetection kit (Vector Laboratories) were used, depending on the nature of the primary antibody. Immunoreactivity was identified by a diaminobenzidine tetrachloride reaction (Vector Laboratories). Congo red staining was performed with slide-mounted sagittal sections (15 µm) according to the methods of Wolman and Bubis (54). Bielschowsky staining was performed with slide-mounted sagittal sections (each, 15 µm). Slides were incubated in 20% silver nitrate solution for 2 h, washed in reducer (50 ml of formaldehyde, 200 ml of absolute alcohol, 750 ml of distilled water) for 3 min, followed by 10% alcohol for 2 min. Slides were placed in silver B solution (20 ml of 20% silver nitrate, 20 ml of 95% alcohol, and ammonia added until the precipitate formed was redissolved) for 2 min and then washed in a constant flow of reducer for 4 min. After being washed in distilled water, slides were toned with 0.1% gold chloride for 2 min, washed in distilled water, and fixed in 5% sodium thiosulphate.
Aß1-40 and Aß1-42 ELISA. The levels of Aß1-40 and Aß1-42 in soluble and insoluble brain fractions in snap-frozen brain hemispheres were quantified by enzyme-linked immunosorbent assay (ELISA) as previously described (27). Brain samples were weighed and sonicated in phosphate-buffered saline containing 2% SDS with 50 mM protease inhibitor cocktail (Roche). Samples were centrifuged at 100,000 x g at 4°C for 1 h, and the supernatant (comprising the soluble fraction) was removed. Following the addition of 70% formic acid to the pellet, the samples were sonicated and centrifuged at 100,000 x g at 4°C for 1 h, and the supernatant (the insoluble fraction) was removed. Samples were assayed for human Aß1-40 and Aß1-42 with commercial ELISA kits (Biosource International, Camarillo, Calif.). Mouse monoclonal antibodies specific for the N terminus of human Aß (the capture antibody) were coated onto wells in a microtiter plate. Brain samples and Aß1-40 and Aß1-42 standards of known concentration were pipetted into the wells, followed by a rabbit anti-mouse antibody specific for the amino acid sequence (amino acids 1 to 40 or 1 to 42) of Aß (the detection antibody). The bound detection antibody was identified with an alkaline phosphatase-labeled donkey anti-rabbit antibody, producing a fluorescent signal. Comparison with the standard curve allowed the calculation of absolute values, in picomoles per gram of brain tissue.
Preparation of membrane protein. Samples of freshly dissected brain tissue (between 100 to 150 mg [wet weight]) were placed into 2-ml capacity Lysing Marix D tubes (Q-Biogene, Bedfordshire, United Kingdom) containing 1 ml of ice-cold homogenization buffer (20 mM Tris-HCl, 1 mM EGTA, 1% Triton [pH 7.4]). The homogenization buffer contained a cocktail of protease (10 µg of leupeptin/ml, 1 µg of soya bean trypsin inhibitor/ml, 0.2 mg of bacitracin/ml, 1 mM aminoethylbenzylsulphonyl fluoride [AEBSF], 1 mM benzamidine hydrochloride) and phosphatase inhibitors (1 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 10 mM ß-glycerophosphate, and 50 mM sodium fluoride). Lysates were prepared by vigorously shaking the tubes for three bursts of 20 s each with a ribolyser (Hybaid, Cambridge, United Kingdom). Homogenates were centrifuged at 4°C for 10 min at 100 x g to remove debris. Supernatants were recentrifuged for 60 min at 20,000 x g, and the pellets were resuspended in Tris-buffered saline at a final protein concentration of 4 mg/ml. The cytosolic fractions were also retained.
Quantitative Western blotting.
Sagittally dissected brain hemispheres, further dissected into forebrain (including olfactory bulbs, cerebral cortex, and hippocampus) and hindbrain (including pons, cerebellum, and brainstem) were homogenized in a cocktail of proteinase and phosphatase inhibitors containing 20 mM Tris-HCl (pH 7.4), 1 mM ethylene glycol-bis(2-aminoethyl)-N,N,N',N',-tetraacetic acid (EGTA), 1% Triton X-100, 1% pyrophosphate, 1% orthovanadate, 1% beta-glycophosphate, 5% NaF, and a protease inhibitor tablet (Roche, Lewes, United Kingdom). The isolated proteins were separated by standard SDS-polyacrylamide gel electrophoresis with 10% polyacrylamide gels unless otherwise stated. Following transfer onto nitrocellulose membrane, detection was made using a panel of primary antibodies to tau and APP: human tau (T14 clone; Zymed); human and mouse tau (BR133; kindly donated by M. Goedert); phospho-tau-S202/T205 (AT8 epitope) and phospho-tau-T231 (AT180 epitope) (Innogenetics); phospho-tau-S199, phospho-tau-S262, and phospho-tau-S422 (Biosource International); and human and mouse APP (C terminus) (Sigma). Blots were also probed with antibodies to the phosphorylated and/or total forms of ERK1/2, GSK-3
ß, p38, JNK, and p35. All antibodies were from Cell Signaling Technologies, with the exception of total ERK1/2 and p35 (Santa Cruz), GSK-3ß (Transduction Laboratories), and phospho-GSK-3
ß-Y216/279 (Sigma). Blots were probed with peroxidase-labeled secondary antibodies (Amersham) and visualized with ECL-Plus (Amersham). The Western blots shown are a representative of at least three separate experiments and were quantified by detecting emitted chemiluminescence with the GeneGnome detection system (Syngene Bio Imaging). All data were normalized to the amount of ß-actin staining and were expressed as means ± standard errors of the mean (SEM).
Behavioral testing. Mice were tested on a rotarod apparatus to assess motor coordination and balance (Rotarod 7650 accelerating model; Ugo Basile, Biological Research Apparatus, Varese, Italy) (5). The mice received two training sessions of four trials at 10 to 15 rpm, sufficient to reach a baseline level of performance. The following day, mice were tested at six speeds ranging from 10 to 44 rpm. During training and test sessions, the latency to fall at each speed was recorded up to a maximum of 60 s. Locomotor activity testing took place in clear Perspex boxes containing two transverse infrared beams, spaced equally along the length of the box. The number of beam breaks during consecutive 120-min sessions over 3 days was recorded by a computer as described previously (24).
Olfactory memory functioning was assessed using the social transmission of food preferences (STFP) task (44). Assessment took place over a 7-day period during which normal home cage food was restricted. Demonstrator animals (120 days old; 129sv*C57BL/6J) were housed in the same holding rooms as the test mice and were maintained on the same food-restricted regime. In keeping with the Home Office project license conditions, no animal was permitted to lose more than 20% of free-feeding body weight. Any mouse exceeding this criterion was removed from the experiment and returned to ad libitum feeding. Two habituation sessions were undertaken on consecutive days in which the mice were permitted to freely explore the test arena for 30 min and a single food dispenser filled with 2 g of powdered standard laboratory chow was placed in the arena. A test of basic olfaction was undertaken prior to the STFP test, during which two food dispensers were placed into the test arena. One dispenser contained powdered standard laboratory chow, and the other contained powdered chow mixed with ginger (2%) or coriander (1%). Equal amounts of each food type were put into the dispensers, and the mice were allowed 30 min of free exploration. During the social interaction phase, demonstrator mice were given access to powdered chow mixed with one of four aromas (1% cocoa, 1% coffee, 1% nutmeg, and 0.1% cumin) for 2 h (the cued food). Food consumption was monitored, and demonstrator mice were only used in the ensuing social interaction if they had consumed more than 0.4 g of cued food. For the social interaction, test mice were placed in the arena with two demonstrator mice (sedated with 15 mg sodium of pentobarbitone-Sagatal/kg of body weight intraperitoneally), and the mice were left to interact for 5 min. In the 24-h memory test, the test mice were presented with a choice between two food dispensers, one containing powdered food mixed with the same aroma used in the social interaction (the cued food) and the other mixed with a novel aroma (uncued food). Following the 30 min of exploration and food consumption, the mice were returned to ad libitum food in the home cage. From the social interaction session, the number, latency, and duration of contacts with the demonstrator's mouth region was calculated. In sessions where food was present, the amount of food consumed was calculated, and the plain food (olfaction test) and cued food preferences (memory tests) were calculated from the total food consumed.
Statistics. Quantitative data from the Aß ELISA were analyzed by four-way analysis of variance (ANOVA) with the following factors: genotype (wild type, APPV717I-CT100, and combined tauV337M x APPV717I-CT100), age (6 and 12 months), species (Aß1-40 and Aß1-42), and fraction (soluble and insoluble). Quantitative data from the GeneGnome detection system assessing the level of mouse APP were analyzed by one-way ANOVA with the genotype factor (wild type, tauV337M, APPV717I-CT100, and tauV337M x APPV717I-CT100). Data examining levels of human tauV337M transgene and the tau phosphorylation epitopes in the tauV337M and combined tauV337M x APPV717I-CT100 mice were analyzed separately by Student's t test. This discrete manner of analysis was required because of potential differences in the affinities of the individual antibodies used to recognize the various tau phosphorylation sites. Similarly, the quantitative data examining the extent of endogenous tau kinase phosphorylation occurring in all four lines of mice were analyzed in terms of each separate tau kinase epitope. These data were compared using one-way ANOVA with the genotype factor (wild type, tauV337M, APPV717I-CT100, and tauV337M x APPV717I-CT100). Note that the age factor (6 and 12 months) was not used as a comparison in the Western analysis because tissue from these age groups was assessed separately of necessity (see above). Rotarod and locomotor activity data, assessed for mice that were 12 months old, were analyzed by separate two-way ANOVA with the following factors: speed (10, 15, 17.1, 21.8, 24, 26.1, and 44 rpm) and genotype (wild type, tauV337M, APPV717I-CT100, and tauV337M x APPV717I-CT100), and session (days 1, 2, or 3) and genotype (wild type, tauV337M, APPV717I-CT100, and tauV337M x APPV717I-CT100), respectively. The data from the STFP test of olfaction were analyzed by two-way ANOVA with the genotype (wild type, tauV337M, APPV717I-CT100, and combined tauV337M x APPV717I-CT100) and age (6 and 12 months) factors. The data quantifying the time spent in close proximity to the demonstrator's mouth regions during the STFP social interaction session was analyzed by two-way ANOVA with the genotype and age factors. The preference for the cued food and total amount of food consumed were assessed separately in the test of olfactory memory by two-way ANOVA with genotype and age factors. All data were analyzed with the SAS statistical package (SAS Institute, Inc., Cary, N.C.).
| RESULTS |
|---|
|
|
|---|
|
|
Expression of the APPV717I-CT100 transgene led to the production of Aß and the deposition of diffuse, noncongophilic extracellular Aß plaques from 6 months of age in both the APPV717I-CT100 (Fig. 3A) and combined tauV337M x APPV717I-CT100 (Fig. 3B) mice. Immunohistochemistry using Aß-specific antibodies revealed a widespread distribution of accumulations in the brain parenchyme and cerebral blood vessels. Staining for Aß was most intense in the cortex and hippocampal regions but was also found in other brain regions, including the olfactory bulbs and hindbrain. The data from a quantitative ELISA assay are shown in Fig. 3C. Reflecting the specificity of the antibodies used in the ELISA to human Aß species, very low levels were identified in brain tissue taken from wild-type mice; as a result, the data obtained in APPV717I-CT100 and combined tauV337M x APPV717I-CT100 tissues were normalized to that of the wild type. Both human Aß1-40 and Aß1-42 species were identified within the brains of APPV717I-CT100 and combined tauV337M x APPV717I-CT100 mice from 6 months of age onward. No effect of genotype (F1,48 = 2.21 [n.s.]) on levels of either species of Aß was identified in the soluble and insoluble brain fractions, indicating no effect of the tauV337M transgene on levels of Aß. In addition, no main effect of age (F1,48 = 0.11 [n.s.]) or interaction between genotype and age was identified (F1,48 = 0.28 [n.s.]) in terms of levels of Aß. A comparison of the particular Aß species present in the brain samples revealed that significantly more Aß1-42 than Aß1-40 was present in both soluble and insoluble brain fractions from the APPV717I-CT100 and combined tauV337M x APPV717I-CT100 mice (effect of species; F1,48 = 23.06, P < 0.0001). In addition, there was an effect or fraction, representing the fact that significantly more Aß of both species was found in the insoluble fraction (F1,48 = 75.37; P < 0.0001); an interaction between species and fraction was also identified, relating to the high levels of Aß1-42 found to be present in the insoluble brain fraction (F1,48 = 51.19; P < 0.0001), which formed the major species of Aß found in the brains of the APPV717I-CT100 and combined tauV337M x APPV717I-CT100 mice.
|
|
ß, cdk5/p25, ERK1, ERK2, p38, and JNK, phosphorylate tau at these sites in cell-free systems, although with different efficiencies (2). Members of the MAPK family (ERK1, ERK2, p38, and JNK) show essentially equivalent substrate specificities towards tau and can phosphorylate S422 (40) as well as S202 and T205, the epitope of the AT8 monoclonal antibody, which can also be phosphorylated by GSK-3
ß (15). In contrast, S199 has been shown to be an effective site for phosphorylation by GSK-3
ß and cdk5 but does not appear to be a selective substrate for the MAPKs (25, 40). Phosphorylation of T231 can be brought about by both MAPKs and GSK-3
ß (40); phosphorylation of this site in tau, as well as S262 (which is not a suitable substrate for either enzyme family), is required for maximal inhibition of its binding to microtubules (41).
Analysis of equivalent amounts of protein from the wild-type and transgenic mice with a phosphorylation-independent antibody specific to human tau confirmed that the level of human tau protein translation in forebrain and hindbrain samples was similar in both the tauV337M and combined mice at 6 or 12 months of age (Fig. 5A and B). In contrast, the extent of human tau phosphorylation varied substantially and was dependent on genotype and age. At 6 months of age (Fig. 5A), phosphorylation at the S202/T205 (AT8) and T231 (AT180) epitopes was detected in both the tauV337M and combined tauV337M x APPV717I-CT100 mice. Phosphorylation of endogenous mouse tau was not observed in APPV717I-CT100 mice with these antibodies. Further examination of the blots showed that phosphorylation at both epitopes and in both fore- and hindbrain samples was markedly elevated in the combined tauV337M x APPV717I-CT100 transgenic mice in comparison to the single tauV337M mice. Subsequent quantification of the phosphorylation at the S202/T205 site using the GeneGnome detection system (Fig. 5C) confirmed a significant (approximately twofold) difference between the combined and single tauV337M transgenic mice. Quantification of the T231 epitope was not possible, due to low absolute levels of signal. A similar pattern of phosphorylation at the S202/T205 and T231 sites was seen with mice at 12 months of age in that the blot data (Fig. 5B) indicated augmented phosphorylation at these epitopes in the combined mouse compared to the tauV337M genotype. Again, the signal from the T231 epitope was not sufficient for accurate quantification by the GeneGnome detection system, but the S202/T205 data showed significant increases in the combined mouse compared to the tauV337M genotype (Fig. 5D). Phosphorylation at S422, an additional site phosphorylated by the MAPKs in AD and FTDP-17 brain (20), was barely detectable in mice examined at 6 months of age, but by 12 months of age marked immunoreactivity was present in tauV337M and combined tauV337M x APPV717I-CT100 mice (Fig. 5B). As with the S202/T205 and T231 sites, quantification of the blots showed that this change was more evident in the combined mice than in the tauV337M mice in both fore- and hindbrain samples (Fig. 5D). In marked contrast, phosphorylation at the GSK-3
ß- and cdk5-sensitive site, S199, was completely indifferent to either age or genotype. Instead, phosphorylation at this site was detected at 6 and 12 months of age and no difference in phosphorylation levels was identified between the combined tauV337M x APPV717I-CT100 and single tauV337M mice (Fig. 5A and B). Quantification of the chemiluminescence confirmed this finding. For 6-month-old forebrain, data were as follows: tauV337M, 24% ± 2.1%; tauV337Mx APPV717I-CT100, 23.9% ± 1.2%. For 6-month-old hindbrain, data were as follows: tauV337M, 22.9% ± 1.4%; tauV337Mx APPV717I-CT100, 23% ± 2.8%. For 12-month-old forebrain, data were as follows: tauV337M, 27% ± 5.5%; tauV337Mx APPV717I-CT100, 26% ± 1.9%. For 12-month-old hindbrain, data were as follows: tauV337M, 25% ± 0.5%; tauV337Mx APPV717I-CT100, 25% ± 1.4%. Furthermore, the immunoreactivity observed was common to both human and endogenous mouse tau. Phosphorylation at S262 (a site not phosphorylated by either the MAPKs or GSK-3
ß) (3, 14) was characterized by very low levels of immunoreactivity at both 6 and 12 months of age that was common to the endogenous mouse tau across all genotypes but was effectively absent in human tau in the combined tauV337M x APPV717I-CT100 and tauV337M mice. This negative finding was of note, as phosphorylation of tau at this non-proline-directed kinase epitope is a key pathological marker that has been shown to have the effect of strongly reducing the binding of tau to microtubules (3) and that forms a major component of paired helical filament tau extracted from AD brain (21). Failure to see changes at the S262 site may indicate a limitation of the models; alternatively, such changes may become manifest at later time points. Taken together, the data indicated highly selective effects of the human tauV337M mutation and an augmentation of tau phosphorylation at the same sites in the combined tauV337Mx APPV717I-CT100 mouse, the latter indicating an effect of the mutated carboxy-terminal fragment of human APP (APPV717I-CT100) on tau phosphorylation.
|
ß is controlled by their phosphorylation at specific sites (8, 10), phospho-specific antibodies were again used to assay the activity status of ERK1/2, p38, JNK, and GSK-3
ß in 6- and 12-month-old animals. The levels and phosphorylation status of the MAPKs are shown in Fig. 6. While the absolute levels of the kinases were equivalent across all mouse models, the pattern of kinase phosphorylation was dependent on genotype and age, as was found to be the case with tau phosphorylation. The tauV337M mutation alone had no effect on the phosphorylation status of any of the MAPKs, revealing dissociations between the impact of this manipulation on tau phosphorylation and cognate tau kinase function. In contrast, the combined tauV337M x APPV717I-CT100 mice did show activations of the MAPKs, but in an age-related manner. Thus, at 6 months of age (Fig. 6A), there were detectable increases in the phosphorylation and hence activity status of ERK1/2 and p38. At 12 months of age (Fig. 6B), ERK1/2 phosphorylation had returned to wild-type baseline levels, but JNK phosphorylation was now elevated and p38 phosphorylation levels remained high. The increased activation status of MAPKs in the combined tauV337M x APPV717I-CT100 mice appeared to be a discrete effect of APPV717I-CT100 transgene expression, as near-identical changes in MAPK phosphorylation were observed in the single APPV717I-CT100 transgenic mouse line. Thus, statistical quantification of the phosphorylation of ERK1/2 at 6 months (Fig. 6C) showed the approximately 50% increase in the APPV717I-CT100 and combined mice to be closely comparable. Similarly, at 12 months the levels of JNK phosphorylation were not significantly different between the APPV717I-CT100 and combined tauV337M x APPV717I-CT100 mice but were approximately 2.5-fold higher than levels for wild-type littermates (note that quantification of p38 chemiluminescence by the GeneGnome detection system was not possible due to low signals). There were, in addition, no obvious distinctions between the qualitative changes observed in the kinase activity status across the transgenic mice lines for samples taken from forebrain and hindbrain. Consistent with the previous findings indicating no change in tau phosphorylation at the S199 site, the activity status of GSK-3
ß and/or cdk5 was indifferent to either genotype or age (Fig. 7). GSK-3 consists of
and ß isoforms, which are critical downstream elements of the PI3K/Akt cell survival pathway (8). Their activities are inhibited by Akt-mediated phosphorylation at S21 of GSK-3
and S9 of GSK-3ß. It has also been reported that phosphorylation at Y279/216 of GSK-3
ß can enhance the activity status of these kinases once the inhibition by dephosphorylation at S21/9 is alleviated (19). However, as illustrated in Fig. 7, no change in the phosphorylation status of either site for GSK-3
ß could be detected across the transgenic models at 6 and 12 months of age. To monitor the activity of cdk5, the relative ratio of p35 to p25 in brain samples was determined (30). An increase in the activity of cdk5 (as would be indicated by the loss of p35 expression with a concomitant increase in p25 levels) was not observed for any of the mouse lines at either 6 or 12 months of age.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
To compare the nature and extent of tau phosphorylation in the transgenic lines, we utilized a quantitative Western blotting approach using phospho-specific antibodies, which enabled a parallel analysis of tau kinase activity status and the degree of tau phosphorylation at consensus sites. Our data provide evidence for the existence of distinct mechanisms mediating the abnormal phosphorylation of tau in FTDP-17 and AD. In the first situation, associated with the FTDP-17 tauV337M mutation, human tau phosphorylation occurred at MAPK consensus sites in the absence of concomitant change in kinase activity status. In the second situation, related to the presence of human APPV717I-CT100, augmented tau phosphorylation at these same sites was identified in combination with specific MAPK activations. The observation of tau phosphorylation in the FTDP-17 model without any accompanying change in tau kinase activities may be explained by a possible effect of the V337M mutation on the conformation of tau. Hence, putative structural modifications within the tau protein may have allowed greater access to an unaltered basal level of MAPK activity and facilitated a hierarchical phosphorylation cascade (26).
The mechanism(s) underlying the phosphorylation of tau in the FTDP-17 tauV337M mouse without concomitant changes in kinase activity can be contrasted with the influence of the APPV717I-CT100 fragment on the phosphorylation status of the MAPKs. Here, as evidenced by data from the combined tauV337Mx APPV717I-CT100 mice, the hyperphosphorylation of human tau at MAPK consensus sites was accompanied by activations of members of the MAPK family, specifically, elevations of ERK, p38, and JNK phosphorylation at 6 and 12 months of age. As this pattern of MAPK activations was mirrored precisely in the single APPV717I-CT100 mice, we conclude that the expression of APPV717I-CT100 or a subsequently produced fragment of the APP-CT100 transgene was responsible for the MAPK activation. The exact identity of the APP C-terminal fragment(s) stimulating MAPK activity remains unknown. Many C-terminal fragments of APP have been shown to be neurotoxic (28, 45), including Aß and APP-CT100, both of which are present in our mouse model. Gotz and colleagues showed increases in neurofibrillary tangles following injections of Aß fibrils into the brain of P301L mice (18). However, in our work, while the pattern of tau phosphorylation in the tauV337M x APPV717I-CT100 mice was age related, the levels of brain Aß remained relatively constant over age, suggesting in turn that Aß may not be the only APP C-terminal fragment capable of influencing tau phosphorylation.
The data also suggest that members of the MAPK family may have different contributions to play in tau phosphorylation over time. In our model, ERK activation status increased at early stages and subsequently declined in accord with data obtained using the Tg2576 Swedish mutant APP transgenic mouse (7). It was of particular note that phosphorylation at tau S422, a marker for tau neuropathology (20) was not detectable until 12 months of age and that this change coincided with an age-dependent increase in JNK activity. These data were especially interesting, not only because they recapitulate the involvement of this tau phosphorylation site in a mouse model but also because the tight temporal relationship suggests the possibility of a specific causal linkage between phosphorylation of tau at S422 and JNK activity occurring in vivo. The extent to which these data bear on the time course of similar molecular changes in AD remains an important question.
Somewhat surprisingly given the previous evidence obtained in cell-free systems and neuronal cell lines, the present studies did not corroborate a role for GSK-3
ß in the hyperphosphorylation of tau. We did detect the presence of tau phosphorylation at S199, which is a consensus site for GSK-3
ß, but this was at levels that were unchanged between transgenic and wild-type animals, suggesting that in this case phosphorylation at S199 was related to the normal physiological regulation of tau. In addition, a lack of change in the activity of GSK-3
ß was identified by assessing its phosphorylation at the regulatory sites S21/9 and Y279/216. Our negative findings are consistent with in vivo data involving the use of the GSK-3
ß inhibitor, lithium, which failed to prevent tau hyperphosphorylation in rabbits injected with aggregated Aß1-42 (12). Furthermore, it is of significance to the present study that work by colleagues at the Babraham Institute has provided equivalent data, indicating increases in activity of the MAPKs but not GSK3-
ß in studies of postmortem brain tissue from human AD subjects (47). Specifically, an increase in the activity of both p38 and JNKs was observed in both the transgenic mice and postmortem brain tissue. In addition, a similar pattern of tau phosphorylation was also identified. However, it would be premature to exclude a role for GSK-3
ß in the pathological phosphorylation of tau in vivo, since it is possible that it may act via mechanisms that have not been investigated in the present study. In particular, Yuan et al. (56) have demonstrated that Ser9-phosphorylated GSK-3ß can phosphorylate tau by forming a complex with the phosphoserine binding protein 14-3-3 in transfected cells. It is therefore possible that in our model, tau may also be phosphorylated by GSK-3ß via this mechanism. Moreover, GSK-3
ß may feature in AD progression by its involvement in other pathways. For example, a recent report has shown evidence that lithium reduces Aß production both in cultured cells and in the brains of mice that overproduce Aß peptides through the inhibition of GSK-3
(37). In addition, lithium has been shown to block the activation of a c-Jun stress response to trophic withdrawal via inhibition of GSK-3
ß (22). A further possibility that our work has not investigated is that the pattern of tau phosphorylation may have involved, in part, changes in the activity of protein phosphatases. In this regard, it is of note that the activities of both PP1 and PP2A have been shown to be decreased in AD brain (17) and that a number of the FTDP-17 mutations, including V337M, induce a decrease in the binding affinity of tau for PP2A in vivo (16).
The cognitive effects of the molecular changes identified were assessed using the ethobiological STFP olfactory memory paradigm, which has been previously utilized in mice overexpressing the neuropeptide galanin, shown to be up-regulated in AD (44, 55). The data indicated age-related effects of both the tauV337M and APPV717I-CT100 transgenes on memory functioning. Thus, tauV337M, APPV717I-CT100, and combined tauV337M x APPV717I-CT100 mice all demonstrated olfactory memory functioning not significantly different from that of wild-type littermates at 6 months of age, but at 12 months of age all three transgenic lines showed significant memory impairment. The impairment in memory functioning was found to occur in the absence of differences in basic olfactory functioning or overall food consumption and was, as noted previously, not confounded by changes in sensorimotor functions. In addition, during the STFP assay no differences were identified in the time spent by the test mice in contact with the conspecific, indicating that memory impairment was unlikely to be the result of prior effects on learning. The data failed to provide any evidence to suggest that memory impairment in the combined tauV337M x APPV717I-CT mice was greater than in mice expressing the single tauV337M and APPV717I-CT100 transgenes. In fact, revealing such an effect may be problematic using this task due to floor effects insofar as all transgenic groups were close to chance performance. However, cognitive dissociations between the transgenic models may emerge by using different behavioral tests. There are a number of reports of cognitive effects in transgenic mouse models for dementia, often involving the Morris water maze (e.g., references 23, 35, 50, and 53). The present data extend these findings into the nonspatial olfactory domain, which has not previously been investigated in FAD or FTDP-17 transgenic models.
It was of interest that, while molecular changes in both APP-CT100 and tau (in terms of Aß production and deposition and abnormal tau phosphorylation) were found to be present in mice at 6 months of age, no memory deficits were found in either the tauV337M, APPV717I-CT100, or tauV337Mx APPV717I-CT100 mice until 12 months of age. These findings would suggest that early changes in molecular amyloid and tau neuropathology in the brain were present in advance of cognitive deficits. It is also of note that, although evidence of neurofibrillary tangles was identified in tauV337M and tauV337M x APPV717I-CT100 at 12 months of age, these were confined to the brainstem and as such were unlikely to have had effects on cognitive functioning (at least in terms of the known brain circuitry mediating the STFP task). In addition, although diffuse Aß plaque formation was identified, there was no evidence of congophilic dense-cored plaques in the APPV717I-CT100 or tauV337M x APPV717I-CT100 mice. As such, it would appear that in the models described here, there was a dissociation between neurofibrillary tangle and/or congophilic plaque formation and cognitive decline, as has been found to be the case in several other dementia models (9, 29, 35). Hence, the precise mechanism(s) by which the changes observed at the molecular level may induce cognitive impairment, as indexed by the STFP, is undefined as yet and may involve abnormal changes in neuronal plasticity and/or actual cell death.
To conclude, we have obtained data that suggest distinct molecular routes to abnormal tau phosphorylation in models of FTDP-17 and AD and in addition provide evidence that tau irregularities in AD may be linked to the processing of APP C-terminal fragments via specific effects on MAPK function. Our findings highlight a major role for MAPK signaling pathways, key mediators of both neuronal plasticity (34) and cell death (52), in the hyperphosphorylation of tau. On this basis, interventions using selective MAPK inhibitors may in theory be capable of ameliorating the progression of neurofibrillary pathology in diseases such as AD.
| ACKNOWLEDGMENTS |
|---|
We gratefully acknowledge M. Goedert (Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom) for supplying the tauV337M mice and M. G. Spillantini for assistance with tau immunohistochemical staining (Brain Repair Centre, University of Cambridge, Cambridge, United Kingdom).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Anderton, B. H., J. Betts, W. P. Blackstock, J. P. Brion, S. Chapman, J. Connell, R. Dayanandan, J. M. Gallo, G. Gibb, D. P. Hanger, M. Hutton, E. Kardalinou, K. Leroy, S. Lovestone, T. Mack, C. H. Reynolds, and M. Van Slegtenhorst. 2001. Sites of phosphorylation in tau and factors affecting their regulation. Biochem. Soc. Symp. 67:73-80.
3. Biernat, J., N. Gustke, G. Drewes, E. M. Mandelkow, and E. Mandelkow. 1993. Phosphorylation of Ser262 strongly reduces binding of tau to microtubules: distinction between PHF-like immunoreactivity and microtubule binding. Neuron 11:153-163.[CrossRef][Medline]
4. Buée-Scherrer, V., and M. Goedert. 2002. Phosphorylation of microtubule-associated protein tau by stress-activated protein kinases in intact cells. FEBS Lett. 515:151-154.[CrossRef][Medline]
5. Carter, R. J., L. A. Lione, T. Humby, L. Mangiarini, A. Mahal, G. P. Bates, S. B. Dunnett, and A. J. Morton. 1999. Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation. J. Neurosci. 19:3248-3257.
6. De Jonghe, C., C. Esselens, S. Kumar-Singh, K. Craessaerts, S. Serneels, F. Checler, W. Annaert, C. Van Broeckhoven, and B. De Strooper. 2001. Pathogenic APP mutations near the gamma-secretase cleavage site differentially affect Aß secretion and APP C-terminal fragment stability. Hum. Mol. Genet. 10:1665-1671.
7. Dineley, K. T., M. Westerman, D. Bui, K. Bell, K. H. Ashe, and J. D. Sweatt. 2001. Beta-amyloid activates the mitogen-activated protein kinase cascade via hippocampal alpha7 nicotinic acetylcholine receptors: in vitro and in vivo mechanisms related to Alzheimer's disease. J. Neurosci. 21:4125-4133.
8. Doble, B. W., and J. R. Woodgett. 2003. GSK-3: tricks of the trade for a multi-tasking kinase. J. Cell Sci. 116:1175-1186.
9. Dodart, J. C., H. Meziane, C. Mathis, K. R. Bales, S. M. Paul, and A. Ungerer. 1999. Behavioral disturbances in transgenic mice overexpressing the V717F beta-amyloid precursor protein. Behav. Neurosci. 113:982-990.[CrossRef][Medline]
10. Ferrer, I., R. Blanco, M. Carmona, R. Ribera, E. Goutan, B. Puig, M. J. Rey, A. Cardozo, F. Vinals, and T. Ribalta. 2001. Phosphorylated map kinase (ERK1, ERK2) expression is associated with early tau deposition in neurons and glial cells, but not with increased nuclear DNA vulnerability and cell death, in Alzheimer's disease, Pick's disease, progressive supranuclear palsy, and corticobasal degeneration. Brain Pathol. 11:144-158.[Medline]
11. Flaherty, D. B., J. P. Soria, H. G. Tomasiewicz, and J. G. Wood. 2000. Phosphorylation of human tau protein by microtubule-associated kinases: GSK-3ß and cdk5 are key participants. J. Neurosci. Res. 62:463-472.[CrossRef][Medline]
12. Ghribi, O., M. M. Herman, and J. Savory. 2003. Lithium inhibits Aß-induced stress in endoplasmic reticulum of rabbit hippocampus but does not prevent oxidative damage and tau phosphorylation. J. Neurosci. Res. 71:853-862.[CrossRef][Medline]
13. Goate, A., M. C. Chartier-Harlin, M. Mullan, J. Brown, F. Crawford, L. Fidani, L. Giuffra, A. Haynes, N. Irving, L. James, et al. 1991. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature 349:704-706.[CrossRef][Medline]
14. Godemann, R., J. Biernat, E. Mandelkow, and E. M. Mandelkow. 1999. Phosphorylation of tau protein by recombinant GSK-3ß: pronounced phosphorylation at select Ser/Thr-Pro motifs but no phosphorylation at Ser262 in the repeat domain. FEBS Lett. 454:157-164.[CrossRef][Medline]
15. Goedert, M., R. Jakes, and E. Vanmechelen. 1995. Monoclonal antibody AT8 recognises tau protein phosphorylated at both serine 202 and threonine 205. Neurosci. Lett. 189:167-169.[CrossRef][Medline]
16. Goedert, M., S. Satumtira, R. Jakes, M. J. Smith, C. Kamibayashim C. L. White III, and E. Sontag. 2000. Reduced binding of protein phosphatase 2A to tau protein with frontotemporal dementia and parkinsonism linked to chromosome 17 mutations. J. Neurochem. 75:2155-2162.[CrossRef][Medline]
17. Gong, C. X., T. J. Singh, I. Grundke-Iqbal, and K. Iqbal. 1993. Phosphoprotein phosphatase activities in Alzheimer disease brain. J. Neurochem. 61:921-927.[CrossRef][Medline]
18. Gotz, J., F. Chen, J. van Dorpe, and R. M. Nitsch. 2001. Formation of neurofibrillary tangles in P301L tau transgenic mice induced by Aß 42 fibrils. Science 293:1491-1495.
19. Harwood, A. J. 2000. Signal transduction: life, the universe and development. Curr. Biol. 10:R116-R119.[CrossRef][Medline]
20. Hasegawa, M., R. Jakes, R. A. Crowther, V. M. Lee, Y. Ihara, and M. Goedert. 1996. Characterization of mAb AP422, a novel phosphorylation-dependent monoclonal antibody against tau protein. FEBS Lett. 384:25-30.[CrossRef][Medline]
21. Hasegawa, M., M. Morishima-Kawashima, K. Takio, M. Suzuki, K. Titani, and Y. Ihara. 1992. Protein sequence and mass spectrometric analyses of tau in the Alzheimer's disease brain. J. Biol. Chem. 267:17047-17054.
22. Hongisto, V., N. Smeds, S. Brecht, T. Herdegen, M. J. Courtney, and E. T. Coffey. 2003. Lithium blocks the c-Jun stress response and protects neurons via its action on glycogen synthase kinase 3. Mol. Cell. Biol. 23:6027-6036.