This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sage, B. T.
Right arrow Articles by Csink, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sage, B. T.
Right arrow Articles by Csink, A. K.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, January 2005, p. 377-388, Vol. 25, No. 1
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.1.377-388.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Sequence Elements in cis Influence Heterochromatic Silencing in trans

Brian T. Sage,1 John L. Jones,1 Amy L. Holmes,2 Michael D. Wu,1 and Amy K. Csink1*

Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, Pennsylvania,1 Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, Seattle, Washington2

Received 29 June 2004/ Returned for modification 1 August 2004/ Accepted 5 October 2004


arrow
ABSTRACT
 
The brownDominant (bwD) allele contains a large insertion of heterochromatin, which causes the locus to aberrantly associate with heterochromatin in interphase nuclei and silences the wild-type allele in heterozygotes. Transgenes placed near the bw+ locus, in trans to bwD, can also be silenced. The strength of silencing (called trans inactivation) varies with the regulatory sequences of the transgene and its distance away from the bwD insertion site in trans. In this study, we examine endogenous sequences in cis that influence susceptibility of a reporter gene to trans inactivation. Flanking deletions were induced in two parental lines containing P-element transgenes showing trans inactivation of the mini-white reporter. These new lines, which have mini-white under the influence of different endogenous sequence elements, now show varied ability to be silenced by bwD. Determination of the deleted regions and the levels of mini-white expression and trans inactivation has allowed us to explore the correlation between cis sequence elements and susceptibility to trans inactivation and to identify a 301-bp sequence that acts as an enhancer of trans inactivation. Intriguingly, this region encompasses the upstream regions of two divergently transcribed genes and contains a sequence motif that may bind BEAF, a protein involved in delimiting chromatin boundaries.


arrow
INTRODUCTION
 
Transcription of the eukaryotic genome is controlled at a number of levels. Not only must sequences near the coding region bind the basal transcription machinery and appropriate transcription factors, but also the surrounding chromatin must be arranged to promote access of these proteins to their binding sites. Recent evidence suggests yet another level of control: the positioning of a locus within the three-dimensional space of the interphase nucleus. In certain circumstances, it has been shown that loci that are being silenced move to a different region of the nucleus, where they associate with masses of highly condensed constitutive heterochromatin (for review, see reference 36). As the consequences of positioning in the nucleus have only recently begun to be explored, it is not surprising that the interplay among these levels of transcriptional regulation is poorly understood. This paper presents results that begin to address the interaction between cis-acting regulatory sequences, chromatin structure, and nuclear positioning.

One of the first systems that identified a role for nuclear positioning in gene silencing involves an unusual allele of an eye-color locus in Drosophila melanogaster. The brownDominant (bwD) allele contains an insertion of approximately 1.6 Mbp of heterochromatin into the brown (bw) coding sequence near the distal end of the right arm of the second chromosome (27). Eyes of bwD/bw+ flies almost totally lack red eye pigment, except in a few small distinct spots. Silencing of the bw+ gene on the homologous chromosome, called trans inactivation, has similarities to classic cis-acting position effect variegation (PEV), where a chromosomal break brings a euchromatic gene close to a block of constitutive heterochromatin along the same DNA molecule. It is generally thought that the aberrant positioning of heterochromatin near euchromatic genes in cis (PEV) allows the "spread" of heterochromatin-specific histone modifications and binding proteins along the DNA molecule (17). However, the bw+ allele in bwD heterozygotes cannot be silenced in this manner, as the source of heterochromatin and the silenced locus are not on the same molecule. Rather it seems that the two bw alleles align by somatic pairing and are repositioned close to pericentric heterochromatin due to interactions of heterochromatic binding proteins (10, 13, 30). Hence it is hypothesized that bw+ is silenced by positioning in a neighborhood of the nucleus inhibitory to its transcription.

Recent work has utilized trans inactivation as a model to understand the influence of the nuclear neighborhood on gene regulation (10, 18, 24). In conjunction with the bwD allele, transgenes can be used to study the effect that location within the interphase nucleus has on expression. When a transgene is placed near bw+ it can be silenced by bwD on the homologous chromosome. Studying transgenes on the homologous chromosome, instead of endogenous loci near the bw locus, allows one to focus on only those sequences present in trans. Several factors that determine if a reporter gene in a specific location is silenced by bwD have been found (9). First, the farther away a transgene is from the bwD insertion in trans, the less likely it is to be trans inactivated. Additionally, features of regulatory regions of the reporter gene can influence silencing. For example, different degrees of silencing were seen when two transgenes, with different promoters in different P-elements, were located at the same insertion site. Also, two transgenes within the same P-element had different abilities to be trans inactivated.

While the above results indicated that the level of trans inactivation varies depending on distance between the bwD insertion and the regulatory sequences contained in a transgene, other results from this previous study indicated that the sequence in cis surrounding the P-element might play a role in transgene silencing. When P{lacW} was inserted in apt (44.7 kbp distal from the bwD insertion in trans), it was unable to be trans inactivated. However, the same transgene inserted an additional 464 bp distal was trans inactivated. Similar results were seen for a P-element inserted approximately 80 kbp proximal to bw (9). This implied that the different cis sequences surrounding the two P-element insertions might be influencing transgene trans inactivation and that further investigation would help to define such sequences and possibly uncover additional sequences.

This study uses P-element flanking deletions to test the effect of cis sequences on the ability of reporter genes to be trans inactivated. Mapping of the deleted regions and determination of the levels of trans inactivation have allowed us to explore the relationship between cis sequence elements and susceptibility to trans inactivation. This work identifies specific endogenous sequences that influence susceptibility of a gene to trans inactivation and demonstrates that short DNA sequences can work in cis to have a large impact on the level of trans inactivation. Interestingly, we have found that a 301-bp sequence containing divergent promoters strongly enhances trans inactivation. This short sequence contains putative binding sites for the Boundary element-associated factor (BEAF) protein, which has been implicated in setting up independent chromatin domains (39). Additionally, we find that the influence of cis sequence on the level of mini-white expression and trans inactivation are not necessarily correlated with each other, indicating that susceptibility to silencing in trans is not merely dependent on the strength of mini-white expression. Finally, we have found that the deletion of a gene-poor region of euchromatin allows increased expression of a reporter gene, suggesting that this region has properties of classical heterochromatin. Overall, our results indicate that specific sequences lead to differential susceptibility to silencing by heterochromatin in trans and suggest an interplay between DNA sequence, chromatin structure, and nuclear positioning.


arrow
MATERIALS AND METHODS
 
Fly culture. All crosses were done at 25°C. Flies were reared on standard yeast-cornmeal-molasses medium. Drosophila stocks were obtained from Bloomington Stock Center or Berkeley Drosophila Genome Project. We generated the ahf6, csa7, csc2, csc1, ahd2, and csa3 lines.

P-element screens. To produce lines that would contain a P{lacW} insertion with various endogenous flanking sequences, but still in the region of the bw locus, P-elements inserted in the genes chrw and Dcp-1 were mobilized. The starting lines were of the genotypes P{lacW}Dcp-1k05606 and P{lacW}chrwk06908 (31). It was expected that this procedure would yield local hops of the P-element (34), but instead it yielded only flanking deletions. The csa and csc lines were generated by crossing v; P{lacW}Dcp-1k05606/Sp; Sb {Delta}2,3/+ males or v; P{lacW}chrwk06908/Sp; Sb {Delta}2,3/+ males, respectively, to v; CyO, bw/Sp vgU females. The v gene is necessary for the deposition of brown pigment in the eye, and the bw gene is necessary for the deposition of red eye pigment, so a v; bw fly has almost entirely white eyes. {Delta}2,3 served as the source of transposase. We screened for a disruption of bw on the chromosome containing P{lacW} by screening for Sp+ Cy bw Sb+ progeny. For csa, we screened 18,808 chromosomes and obtained 6 bw mutants. For csc, we screened 12,071 chromosomes and obtained 13 bw mutants. The ah lines were generated by crossing w; P{lacW}Dcp-1/+; Sb {Delta}2,3/+ to w; bwD/CyO. The progeny were screened for Sb+ Cy+ wmc+ and showed an altered level of trans inactivation compared to w; P{lacW}Dcp-1/bwD. Out of 871 chromosomes screened, 81 had an altered level of trans inactivation.

Determination of sequences flanking P-elements. Inverse PCR was performed as described at www.fruitfly.org/p_disrupt/inverse_pcr.html for each new line described in Table 1 using the recommended primers and restriction enzymes for the P{lacW} transposon. The PCR products were gel purified and sequenced. The sequences were mapped to the Drosophila genome using BLAST. The precise locations of the endpoints based on release 3.0.1d (November 2003) are shown in Table 1 (8).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characteristics of the fly lines examined in this study

Analysis of lines containing flanking deletions. The maintenance and uniqueness of the P-element insertion at 59E in the selected progeny were determined by multicolored polytene fluorescence in situ hybridization to polytene larval salivary gland chromosomes (25), using probes to the 59E region (10), the white gene, and lacZ.

After the lines were generated and the level of trans inactivation was determined, we performed several controls to ensure that each change in level of trans inactivation was due to the change in the flanking cis sequences. First, to ensure that the P-element was not tandemly duplicated, we PCR amplified genomic DNA from each line using primers that would give unique bands in the event of a tandem duplication. We utilized unique primers to the 5' and 3' ends of the P-element that prime out of the P-element. The primers used were Pry4 and Plac1 as described at www.fruitfly.org/p_disrupt/inverse_pcr.html. A PCR with this primer set would not produce a product unless there were adjacent P-elements. Performing PCRs with these primers, we would expect to obtain bands if the P-element was tandemly duplicated and would obtain different band sizes depending on the orientation of the adjacently duplicated P-elements.

Next, we determined if the P-element was intact with no major alterations. Southern blot analysis determined that there were no gross changes in the P-element structure in our lines. Southern analysis of P{lacW} utilized a probe for the ampicillin resistance sequence located in the 3' end of the P-element and a probe for lacZ sequence located in the 5' end of the P-element. A HindIII digest and a HindIII /NcoI double digest were performed. We also sequenced the white regulatory region of each derivative line to determine that the sequences within the transposon mostly likely to control the levels of mini-white expression and trans inactivation were not altered in any of the lines. PCR was performed utilizing primers that amplify 631 bp, including the white regulatory region within P{lacW}. The primers used were hsp70linkerF (TCCCCGGGAATTCTAGTATGTA) and w-exonbwd (TTGCAATCGCAGTTCCTATAGAT). The primers for amplifying the white regulatory region were selected so that only the mini-white gene within the P-element and not the endogenous white gene would be amplified. These PCRs were then sequenced and compared to the sequence of P{lacW} in parental P{lacW}chrwk06908 and P{lacW}Dcp-1k05606 lines. As determined by these tests, the P-elements in our lines of interest were intact with no discernible alterations.

Finally, we tested the lines of interest to determine if the cause of the changes in levels of trans inactivation were due to a second site modifier of PEV. Tests for modifiers of PEV in the ah lines were performed by examining modification of bwD trans inactivation of bw+. We crossed male w; P{lacW}/CyO to female yv; bwD flies and then examined non-CyO male progeny. In this test, the endogenous white gene was wild type and therefore the expression or trans inactivation of mini-white was irrelevant. We compared the trans inactivation of bw+ in the ah/bwD lines to the trans inactivation of bw+ in chrw/bwD and Dcp-1/bwD lines. We did not observe differences in bw+ trans inactivation in any of the flanking deletion lines compared to the chrw or Dcp-1 lines. The test for modifiers of PEV in the csa and csc lines could not be done in a similar manner as above, because the endogenous copy of bw was deleted by the flanking deletions. Therefore, we crossed w; P{lacW}/CyO to T(2;3)SbV/CyO flies and examined non-CyO flies for modification of the SbV phenotype. Twelve specific bristles (4 sternopleurals, 4 notopleurals, 2 supra-alars, and 2 presuturals) were examined on each fly for the Sb phenotype. At least 21 flies from each line were examined. We did not see any differences in the variegating phenotype in any of the flanking deletion lines crossed to T(2;3)SbV flies compared to the chrw or Dcp-1 lines crossed to T(2;3)SbV flies. Hence, we conclude that none of the lines used in this study contain dominant modifiers of PEV.

Analysis of cis sequence elements. Drosophila pseudoobscura Contig3342_Contig5418:516033-517249, which corresponds to D. melanogaster reference genome Jan 2003 position chr2R:18,591,178-18,591,858, was found with the VISTA Browser (http://pipeline.lbl.gov/pseudo). The corresponding Drosophila yakuba sequence (Contig126_6) was found with the BLAST interface at http://ludwig.ucdavis.edu/~dsim/blastboth.html.

Sequence conservation was determined with CLUSTALW (http://clustalw.genome.jp/). Parameters were set to the following: gap open penalty, 5; gap extension penalty, 1; weight transition, no; weight matrix, IUB (for DNA). Slight manual adjustments to this alignment were performed. Examination for boundary element sequences was performed with MacVector (version 7.1.1, Accelrys, Inc.). A web-based search for cis-regulatory sequences (http://rana.lbl.gov/cis-analyst/cgi/viewer.php) revealed the following putative sites within the 301-bp region: Mad, Stat92E, ftz, mp_motif2, tll_all_merged, tll_casey, and two bcd sites. Only the binding sites conserved between D. melanogaster and D. yakuba are indicated in Fig. 4.



View larger version (72K):
[in this window]
[in a new window]
 
FIG. 4. Sequence analysis of the 301-bp region. (A) The 5' ends of the flanking genes are depicted, with translation start sites depicted by broken arrows. Putative transcription start sites are at the end of the box under the gene name. The sequences deleted by flanking deletions csc1, csc2, and ahd2, as well as the insertion sites of lines EY03568 and EY01834, are also indicated. Additionally, predicted BEAF, Mad, and ftz binding sites are indicated. (B) The sequence conserved between D. melanogaster (m), D. yakuba (y), and D. pseudoobscura (p) is shaded. The 301-bp region is in bold. Sequences of interest are highlighted in the color designated in the key. (C) Location of the possible BEAF binding sites. All sites include one BEAF palindrome and at least one additional site within 250 bp. The BEAF site in the 301-bp region is boxed. The entire sequence shown in Fig. 1 and 5 was searched, but only the region where sites were found is shown.

Examination of mini-white trans inactivation by bwD. The wild-type Drosophila eye contains both red and brown pigments. White protein is necessary for the transport of both brown and red pigments, but Brown is necessary only for the transport of red pigment. To determine if bwD heterochromatin in trans could inactivate a mini-white gene inserted near the bw locus, we must be able to analyze white expression separately from brown trans inactivation. To do this, females of the general genotype w; P{lacW}/CyO were crossed to bwD; P{cos bw+} males and the male progeny were examined. This cross eliminates transcripts from the endogenous white gene so we can detect expression of the white transgene on chromosome 2. If we then eliminate endogenous bw activity (by bwD heterochromatin in trans or a deficiency that takes out the bw+ gene), we would now modify eye color, but we would not know if this modification was due to inactivation of bw or inactivation of the white transgene. Therefore, the presence of the bw transgene on the third chromosome (which is unaffected by bwD) (14) ensures that eye color is not influenced by a lack of the endogenous bw gene product. The variable expression of mini-white among lines with insertions in different locations does not allow phenotypic comparison between an insertion being tested for trans inactivation and an insertion at another site. Therefore, comparisons of mini-white expression were made between the flies carrying bwD and flies carrying bw+ for each insert (Fig. 1, 2, and 3; see Fig. 5; Table 2).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 1. Moving a P-element closer to the bwD insertion site trans inactivates a P-element reporter gene. (Left) Schematic representations of the genomic region around the brown locus showing the various deletion and insertion strains over the bwD insertion chromosome. Each box represents a gene (determined from published sequence accession no. AE003461.2). The dotted line represents a deletion. The figure is to scale with the exception of the bwD insert, which is very large, containing approximately 1.6 Mbp of the simple satellite sequence AAGAG. mini-white is denoted as mw in the figures. Distal and proximal refer to the absolute position along the chromosome: proximal toward the centromere and distal toward the telomere. (Right) Fly eye photographs. Within each photograph, the left eyes (bw+) show the corresponding fly line with the transgene heterozygous to wild-type brown. The right eyes (bwD) are from the corresponding fly line with the transgene heterozygous to the bwD allele and P{cos bw+} on the third chromosome. To the right of the fly eyes are the spot count, standard deviation (in parentheses), and number of eyes examined. The notation n.s. indicates no spots. An approximately 29-kbp distal flanking deletion from Dcp-1 generated the ahf6 line. The ahf6 deletion endpoint is at the same site as the k11531 insertion site. The k11531 insertion is not trans inactivated (n t-x), while the k15608 insertion is trans inactivated (t-x). trans inactivation of the k15608 insertion is difficult to see in photographs but is apparent when examined under the microscope.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. A distal flanking sequence influences mini-white expression without influencing trans inactivation. The notation is the same as in Fig. 1. An approximately 20-kbp proximal flanking deletion from Dcp-1 generated the csa7 line. The csa7 deletion endpoint is 3 bp from the chrw insertion site. To the right of the fly eyes are the spot count, standard deviation (in parentheses), and number of eyes examined.



View larger version (41K):
[in this window]
[in a new window]
 
FIG.3. A 301-bp region acts as a cis enhancer of trans inactivation. Proximal is to the left, and distal is to the right. (A) A distal flanking deletion from the chrw insertion reveals a 301-bp region acting as an enhancer element. (B) A proximal flanking deletion from the Dcp-1 insertion reveals a 301-bp region acting as an enhancer element. (C) Enhanced silencing of insertions of P{EPgy2}. To the right of the fly eyes are the spot count, standard deviation (in parentheses), and number of eyes examined.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5. An approximately 108-kbp proximal flanking deletion from Dcp-1 generated the csa3 line. The csa3 deletion endpoint is located 25 bp proximal of the s4830 insertion site. Of interest, the csa3 line is missing a gene-poor and possibly heterochromatin-like region, while the s4830 line contains the gene-poor region. The region immediately proximal (not shown) is gene rich. Spots were exceedingly rare and faint in s4830/bwD flies, making quantitation unreliable.


View this table:
[in this window]
[in a new window]
 
TABLE 2. mini-white expression levels based on eye color and trans-inactivation results

All flies were aged 10 to 14 days before photography or spot counting. For the spot counts in the w; P{lacW}/bwD; P{cos bw+}/+ flies, the number of spots in the entire eye was recorded.

The number of eyes counted for each genotype is given in Table 2. Flies that had more than 70 spots per eye were not able to be reliably counted, because multiple spots are too close together. For the general assessment of eye color and trans inactivation (eye color and background eye color in Table 2), flies of various genotypes were examined side-by-side by at least two individuals and assigned a value from 0 to 6. All flies of various genotypes in a given category were indistinguishable from each other. At least 20 male flies from each line were examined to assess the degree of phenotypic variation. In general, the total degree of variation among individuals in these lines is low and the photographs are representative of the phenotypes of all individuals.

Analysis of lacZ expression. Quantitative assays using chlorophenol red-ß-D-galactopyranoside (CPRG) (Roche Diagnostics Corporation) were done on flies as described by Ashburner (3), except that the incubation times were 1, 2, and 4 h. Either 60 first instar larvae, 30 second instar larvae, or 20 third instar larvae or adult flies were used for each assay. First instar larvae were obtained 24 to 48 h after egg deposition. Second instar larvae were obtained 48 to 72 h after egg deposition. Third instar larvae (crawling) were obtained 96 to 115 h after egg deposition. Adults were 1 to 7 days old.

w1118 males that contained the various transposons over a CyO,P{GFP} chromosome were crossed to w1118; bwD/BcElp females. Only green fluorescent protein-negative (GFP) progeny were analyzed by histochemical staining for ß-galactosidase activity. The Bc+ Elp+ progeny were utilized as the experimental progeny, while the Bc Elp progeny were utilized as the control. ß-Galactosidase staining of larval central nervous system, imaginal disks, and salivary gland tissues was performed as previously described (3). All larvae analyzed were wandering late third instar. Staining pattern was observed after 3- or 6-h and 22-h incubations. Each genotype was examined for staining pattern in at least three larvae.


arrow
RESULTS
 
To investigate the effects that cis sequences have on gene silencing, we mobilized the P{lacW} P-elements from two lines previously shown to contain these elements in locations that rendered the mini-white gene subject to silencing by heterochromatin in trans. The two lines used were of the genotypes P{lacW}chrwk06908 (4.7 kb away from the bwD insertion site in trans) and P{lacW}Dcp-1k05606 (15.4 kb away from the bwD insertion site in trans) (9). These lines were crossed to lines containing the P-element transposase, and progeny were selected that showed either a modification of bwD silencing or a loss of bw+ gene expression (see Materials and Methods).

DNA was extracted from each line, inverse PCR was performed, and the products were sequenced to determine the sequence flanking the P-element. This sequencing revealed that each line contained a unique deletion of the genomic sequence to one side of the P-element. Thus we obtained a collection of lines with P{lacW} flanked by a variety of cis sequences, which changed the genomic context of the reporter genes in the transposon. The exact insertion sites and deletion end points relative to the genomic sequence of chromosome 2R are presented in Table 1.

A number of checks were performed to ensure the suitability of the lines used in our study (data not shown). First, to determine that there is only a single copy of the P-element in the lines of interest, we examined each line using in situ hybridization to polytene chromosomes and PCR designed to detect tandem copies of the P-element. Next, we determined if the P-element was intact with no major alterations by genomic Southern analysis, sequencing of the mini-white regulatory region, partial sequencing of the P-element ends, and PCR to additional internal regions. Finally, we tested the lines to eliminate the possibility that the changes in levels of trans inactivation were caused by a second-site modifier of PEV. Many lines generated from the original P-element mobilizations did not pass all of the above tests and were not studied further. These tests support the assertion that change in flanking cis sequence is responsible for the change in the level of trans inactivation that we observed.

The trans-inactivation phenotype of bwD/bw+ heterozygotes consists of a few scattered wild-type omatidia, expressing bw from the wild-type homolog, in an otherwise null mutant background. The bwD/bw+ heterozygotes exclusively show this "salt and pepper" phenotype, whereas many other PEV alleles of various genes show a more sectored phenotype, with contiguous cells tending to have the same expression state. The salt and pepper phenotype is also seen for most of the cases in this and previous studies (9), where bwD inactivates the mini-white gene in P{lacW} on the homolog. The other omatidia of the eye that are not in spots (the background eye color) do not always show complete silencing. Instead the background eye color ranges from completely white to light orange. In some instances, spots are not seen: rather a general lightening of the eye color is apparent when the transgene is over bwD. In yet some other cases, there are a large number of spots on a lighter background such that a number of spots are next to each other, giving a more mottled appearance to the eye. Still, these eyes do not appear as sectored as many of the classic PEV alleles of various loci. It is not known what leads to these different phenotypes (for further discussion see reference 9).

A mini-white gene closer to bw is more strongly trans inactivated than one with identical distal flanking sequences farther away. An anomaly from our previous study (9) indicated that the cis sequences surrounding the P-element may play a role in transgene sensitivity to heterochromatin in trans. The line P{lacW}l(2)k11531k11531 (referred to as k11531) line contains the transposon inserted in apt (44.7 kbp away from the bwD insertion in trans) and was not trans inactivated by bwD. On the other hand, the P-element in the P{lacW}aptk15608 (referred to as k15608) line is inserted 464 bp farther away from the bwD insertion. The mini-white gene in this insertion site is trans inactivated (Fig. 1 and Table 2). This result suggests that the cis sequence surrounding the closer P-element insertion can confer resistance to trans inactivation.

Mobilizations of P{lacW} in our two starting lines generated seven lines with deletion endpoints near or within the apt gene. Four lines had an approximately 29-kbp distal flanking deletion from P{lacW}Dcp-1, and three lines had an approximately 57-kbp distal flanking deletion from P{lacW}chrw. All seven insertions had distal flanking deletion endpoints within a 112-bp region in the apt gene, had similar levels of mini-white expression, and were trans inactivated (data not shown). As all seven lines had the same phenotype, we will discuss only one in detail, P{lacW}ahf6 (referred to as ahf6) line. The k11531 insertion site is within this 112-bp region. Interestingly, ahf6 has a distal flanking deletion endpoint at exactly the same site as the k11531 insertion (Fig. 1 and Table 1). Therefore, the line that contains a flanking deletion to this site displays mini-white trans inactivation, but the P-element inserted at the same location is not silenced. This could be due to closer proximity of the ahf6 P-element to the bwD insertion site in trans. The other line from our previous study, the k15608 line, which was trans inactivated, contains a P-element insertion 394 bp distal to the most distal flanking deletion endpoint. All flanking deletion lines were more trans inactivated than the trans-inactivated k15608 insertion line. Since mini-white expression is lower in all the flanking deletion lines than in Dcp-1 and chrw parent lines, it is difficult to compare levels of silencing before and after the removal of the proximal sequences. However, comparison of these flanking lines to the k11531 line provides additional support for the effect of distance on the ability of a transgene to be trans inactivated. Additionally, this comparison demonstrates that either the cis sequence which was inhibiting the trans inactivation of the k11531 line has been removed by the flanking deletion or the effect of distance can override the effect of the cis sequences.

Effects of cis sequences on mini-white expression and trans inactivation are not always correlated. Since the expression level of mini-white varies greatly due to euchromatic chromosomal position effects, one possibility is that susceptibility to silencing in trans is merely dependent on the strength of mini-white expression. As expected, trans inactivation of a 20-kb flanking deletion, P{lacW}csa7, bw (referred to as csa7), is enhanced compared to Dcp-1, due to its closer location to the bwD insertion site in trans (Fig. 2). Interestingly, csa7's deletion endpoint is only 3 bp distal of the chrw insertion site. csa7 and chrw are essentially the same distance away from bw and have the same proximal flanking sequence; however, they vary in their distal flanking sequence. While these lines have different expression levels of mini-white (compare bw+ csa7 to bw+ chrw in Fig. 2 and Table 2), they have similar levels of trans inactivation as determined by number of spots in the eyes when over bwD. chrw/bwD flies averaged 23.4 spots, and csa7/bwD flies averaged 17.6 spots. Therefore, the effects of cis sequence on the level of mini-white expression and trans inactivation can be distinct. This conclusion is also supported by lines shown in Fig. 3. Both the csc1 and csc2 lines have the same level of mini-white expression but differ in the level of trans inactivation. The same is true for the chrw and ahd2 lines. Therefore, it is not simply the strength of expression that determines if a gene can be silenced.

A 301-bp region renders a transgene more susceptible to trans inactivation. We generated two lines that had approximately 17-kbp flanking deletions distal from the chrw insertion (Fig. 3A). These two lines had the same level of mini-white expression over a bw+ chromosome as the original chrw line. When over a bwD chromosome, flanking deletion P{lacW}csc1, bw (referred to as csc1) had the same level of trans inactivation of the mini-white transgene as the original chrw chromosome. Interestingly, the second flanking deletion, P{lacW}csc2, bw (referred to as csc2), shows strong enhancement of mini-white trans inactivation, even though it deletes 301 bp less than csc1 (Fig. 4A). Eyes from csc1/bwD flies averaged 21.5 spots, and those from chrw/bwD flies averaged 23.4 spots, but eyes from csc2/bwD flies averaged only 4.4 spots (Fig. 3A). This suggests that a small endogenous sequence can act in cis to enhance mini-white trans inactivation.

The ability of the 301-bp region to act in cis to enhance mini-white trans inactivation was further tested by using an additional deletion. P{lacW}ahd2 (referred to as ahd2) has an approximately 4-kbp proximal flanking deletion from the Dcp-1 insertion (Fig. 3B). Based on our earlier studies (9) and the data in the above section, a reasonable prediction would be for the flanking deletion line to display enhanced trans inactivation because the reporter is now closer to bw. However, this line has more pigment when heterozygous with bwD than does its parent. This result can be interpreted as indicating the presence of an enhancer in the deleted region, the loss of which results in less silencing by heterochromatin in trans. This interpretation is supported by the fact that the deletion endpoint is 15 bp proximal of csc2, so that the deleted region in this line encompasses the entire 301-bp region that is deleted in the csc1 line (Fig. 4A) and also leads to loss of enhancement in that line. In other words, deletion of the region that acts as an enhancer in csc2 flies suppressed mini-white trans inactivation in ahd2 flies.

As an additional test of this 301-bp sequence's ability to act as an enhancer of trans inactivation, we examined additional insertion lines from the Berkeley Drosophila Genome Project (BDGP) (4). These lines carry the P-element P{EPgy2}, which contains a mini-white reporter construct (Fig. 3C) and a yellow gene. While P{EPgy2} contains a mini-white reporter construct, the expression levels of mini-white within this P-element are diminished compared to the expression levels of mini-white in P{lacW} (compare Fig. 3A and C, top left eyes). The transposon in P{EPgy2}CG5360EY01258 (referred to as EY01258) is inserted 13 bp distal of the location of P{lacW} in the chrw insertion. The transposon in P{EPgy2}EY01834 (referred to as EY01834) is inserted at the identical site as the endpoint of the csc1 deletion (Fig. 4A). Finally, the transposon in P{EPgy2}EY03568 (referred to as EY03568) is inserted 7 bp distal of the csc2 deletion endpoint. While all three lines show the salt and pepper variegation typical of bwD trans inactivation, the lines have a different number of spots. EY03568/bwD flies averaged 6.39 spots, EY01258/bwD flies averaged 2.02 spots, and EY01834/bwD flies averaged 0.97 spot. Interestingly, the EY01834 line is near the 301-bp region and trans inactivation is enhanced compared to that in the EY01258 line. We saw enhancement despite the fact that EY01834 is more than 7 kbp farther away from the bwD insertion site in trans. This is another example in which trans inactivation is enhanced in a line near the 301-bp region compared to the line that is near chrw. Intriguingly, EY03568 carries an insert that is 7 bp within the previously defined 301-bp region and its trans inactivation is suppressed compared to that of EY01258 and EY01834 but is still strongly trans inactivated. The yellow reporter in these three lines was also tested for silencing by bwD in trans, but no significant trans inactivation of this reporter was detected (data not shown).

Detailed analysis of the region that enhances mini-white silencing by bwD. The 301-bp region that appears to enhance trans inactivation of mini-white falls in the upstream intergenic region between two divergently expressed genes, CG3957 and CG17280 (Fig. 4). CG3957 is inferred from an electronic annotation to code for a serine/threonine kinase receptor-associated protein and is ubiquitously expressed in stages 1 to 16 of embryogenesis (BDGP http://www.fruitfly.org). Expression at other stages of development is undetermined. CG17280 is inferred from an electronic annotation to code for a cytochrome c oxidase, subunit VIa (FlyBase http://flybase.bio.indiana.edu/). This gene's expression pattern is undetermined, but because the protein is part of an enzyme complex essential for respiration, it is likely to be a ubiquitously expressed, housekeeping gene.

To explore possible causes for the effect of this region on trans inactivation, we asked whether it contains predicted gene regulatory sequences. To help reveal conserved regulatory sequences in the 301-bp region, sequences from this region in D. melanogaster, D. yakuba, and D. pseudoobscura were aligned (Fig. 4B). The evolutionary distances of D. yakuba and D. pseudoobscura from D. melanogaster are 6 to 15 and 46 million years, respectively (23, 28, 29). Computational analysis of this region revealed single Mad and ftz binding sites that were conserved between D. melanogaster and D. yakuba (for details of the search, see Materials and Methods).

As boundary or insulator elements are known to influence heterochromatic silencing in cis (for review, see reference 21), we examined the 301-bp region for binding sites of three different proteins associated with boundary element function. We searched for the Su(Hw) consensus binding site, YRYTGCATAYYY (26), allowing 2 mismatching bp, and did not find any matches in the sequence from the s4830 insertion site to the end of the apt gene. SBP (encoded by dwg) specifically binds in vitro to a 24-nucleotide sequence element, GCTTCGCTGCGAATGACAAAACGG (16). We searched for this sequence in the same region described above, allowing 5 mismatching bp, but did not find any matches. BEAF binding requires at least three copies of the sequence CGATA, two of which often form a palindromic binding site (CGATATATCG). Additionally, BEAF binds to the palindromic sequence TATCGATA (12, 39). A number of putative BEAF binding sites, including the second palindromic sequence above, were found in the 301-bp region that acts as an enhancer of trans inactivation and are indicated in Fig. 4.

As BEAF has a rather simple binding sequence, it was important to determine if the 301-bp sequence was unusually rich in BEAF binding sites. The sequence from the s4830 insertion site through the apt gene contains 146 occurrences of the potential BEAF binding sequence CGATA. This is an average of one BEAF binding sequence occurring every 888 bp. However, in a span of 206 bp, within our 301-bp region, there are four occurrences of BEAF binding sequence, showing that the occurrence of these in the 301-bp region is quite high compared to that in the flanking sequence. Two of these BEAF binding sequences make up a palindrome. Typically BEAF binding requires a palindrome and a CGATA sequence within a couple of hundred base pairs (12). There were three additional potential BEAF binding sites with such an arrangement in the sequence from the s4830 insertion site to the end of the apt gene. These contain a palindromic BEAF binding site and at least one additional site within 250 bp of the palindromic sequence. Their location relative to various landmarks in this study is shown in Fig. 4C.

Removal of a large gene-poor region leads to greatly increased mini-white expression. Our screen also generated a deletion of 108 kb, P{lacW}csa3 (referred to as csa3), proximal to the Dcp-1 insertion (Fig. 5). The csa3 line displays suppressed trans inactivation of the mini-white transgene compared to the parental Dcp-1 line. The deletion endpoint of the csa3 line is located 25 bp proximal of the P{lacW}l(2)s4830s4830 (referred to as s4830) insertion site (Fig. 5). These two insertions have very similar proximal flanking sequence, but vary in their distal flanking sequence and have different levels of mini-white expression. The csa3 line lacks most of an extensive gene-poor section of the chromosome proximal of bw, which s4830 retains, showing that mini-white expression may be influenced in cis by this gene-poor region.

A reporter driven by endogenous local regulatory regions is not trans inactivated. To determine if endogenous enhancer sequences near bw were subject to trans inactivation, we examined the expression of the lacZ reporter in the P{lacW} transposons. The lacZ transgene in P{lacW} acts as an "enhancer trap" because it is driven by a very weak promoter that requires flanking, endogenous enhancer sequences for detectable expression (6). We examined the flanking deletion lines discussed above for lacZ expression using a pooled ß-galactosidase assay (CPRG assay) on animals at various stages of development. The lines differed quantitatively and qualitatively in ß-galactosidase activity. However, tests for trans inactivation by bwD revealed that ß-galactosidase activity was not decreased by bwD in trans (Table 3). Histochemical staining for ß-galactosidase activity in the central nervous system, imaginal disks, and salivary glands of third instar larvae was also performed. Lines expressing ß-galactosidase in those tissues were tested for trans inactivation. No evidence of trans inactivation of the lacZ gene was found. This agrees with earlier work that examined other P{lacW} lines in this region for silencing of lacZ by bwD and found resistance to trans inactivation (9).


View this table:
[in this window]
[in a new window]
 
TABLE 3. ß-Galactasidase activity in the fly lines in this study


arrow
DISCUSSION
 
The variability of silencing by trans inactivation and the sensitivity of the effect to various local factors demonstrated in our work may seem to contrast with the strong, consistent silencing of heterochromatin in cis. However, a number of lines of evidence have recently shown that silencing in cis may be similarly sensitive to a variety of factors. For instance, a simple increase in the amount of a transcription factor can overcome the repressive effects of heterochromatin on a gene (1, 2). Additionally, genes that are closer to a source of heterochromatin in cis or trans can be active while those further away are silenced (5, 9, 33), implying that specific genes may be more sensitive to heterochromatin in cis in a similar fashion as we have demonstrated in trans. Finally, binding of heterochromatin protein 1 (HP1) to euchromatic regions (19) and the complex interspersion of "heterochromatic" domains along the fourth chromosome of Drosophila (32) suggest that the state of the bulk of chromatin may lie on a continuum between highly condensed constitutive heterochromatin and fully expressed loci. Taken together, observations from both cis and trans silencing systems imply that subtle changes in both flanking sequence elements and nuclear location could impact gene expression and silencing.

Our work illustrates how a euchromatic region with slight heterochromatic tendencies may influence gene expression. The csa3 line is missing a large region just proximal of the bw locus (Fig. 5) that contains very few genes, three of which are olfactory receptor genes, which are expressed in only a few cells in the organism (37), while the s4830 line contains the gene-poor region. It may be that in addition to its paucity of genes, this region has other properties of heterochromatin, such as low acetylation, increased condensation, or association with heterochromatin in the nucleus. These properties could be responsible for the very weak mini-white expression in s4830 and allow its silencing, even though it is quite far from bwD in trans. This interpretation is supported by the fact that removal of the gene-poor region allows increased mini-white expression in csa3.

We also find that a very small region can have a strong effect on trans inactivation. Analysis of the csc2, csc1, ahd2, and EY01834 (Fig. 3) lines identifies a 301-bp region as a cis-acting enhancer of trans inactivation. The transposon in the EY03568 line is inserted within the 301-bp region and does not show enhanced trans inactivation, compared to the EY01258 line, as if it disrupts the trans-inactivation enhancer that we have mapped to this interval.

How might a specific region in cis enhance trans inactivation? A number of possibilities are suggested by the presence of potential binding sites for the BEAF protein. The BEAF protein binds to a sequence, called scs', which functions as a chromatin boundary. In assays where the sequence was placed on either side of a reporter gene transformed into Drosophila, it relieved the influence of flanking chromatin on transgenes inserted in various locations, leading to more stable expression of the transgene (20, 39). The binding of the BEAF protein to these specific binding sites in scs' has been shown to be essential for boundary function (11). The scs' sequence was originally isolated as one of a pair of sequences that was thought to delineate the region of open chromatin encompassing the hsp70 locus. Later it was realized that both scs' and its partner scs actually contain the rather compact (approximately 400 to 800) regulatory regions of divergently transcribed genes (22, 35). These features of the scs boundaries are strikingly similar to the region in our study, which enhances trans inactivation and contains the upstream regions of CG3957 and CG17280.

Current models for how boundary elements function (21) may help to explain our results. One model is that boundaries act as tethers to nuclear structures, such as the nuclear periphery or nucleolus (for example, see reference 38). If our 301-bp region anchors the bw region to a structure within a repressive locale in the nucleus, the relocation of the mini-white gene to a position closer to that anchor point may increase the likelihood that it will be silenced, as we see in csc2. Conversely, the loss of this sequence on one homolog may cause loss of anchoring and increased expression of the mini-white gene, as we see in csc1 and adh2.

A second model of boundary element functions postulates that these sequences interact to form the base of chromatin loops that either define regions of similar chromatin structure or bring distant regions of DNA closer to facilitate the interaction of sequences that would otherwise have a low chance of encountering each other. In either case, such looping may allow the enhancement of silencing by bwD. If the 301-bp region forms one side of a loop whose partner is close to the bw locus, the loop would effectively decrease the distance of the reporter to the bwD heterochromatic insertion in trans and facilitate silencing, simply by bringing it closer to the heterochromatin source. The one DNA binding protein whose interaction with BEAF-bound sequences has been demonstrated is SBP. It has been shown that BEAF and SBP interact with their respective binding sequences and each other to form the base of a chromatin loop (7). A possible binding site for SBP has not been found in the sequences analyzed in this study. However, it is quite possible that BEAF interacts with other proteins with various binding sequences that have not yet been described and may form a loop with the BEAF sites in the 301-bp region.

There are other possibilities for how this region may contribute to trans inactivation. Regions containing promoters tend to have a relatively open chromatin structure, and BEAF binding is associated with nuclease-hypersensitive sites (11). Perhaps such an open chromatin structure facilitates the interaction of silencing proteins from bwD with the DNA. Additionally, it is possible that this promoter region is a site for somatic pairing. Such pairing of homologous chromosomes seems to initiate at multiple sites along a chromosome, but nothing is known about what those sites are (15). If a site that promotes pairing is missing on the homolog containing the mini-white gene, that chromosome may be less tightly aligned with its partner and, hence, further away from heterochromatin.

A rather unexpected finding was the lack of trans inactivation of the lacZ reporter even in locations where mini-white displayed enhanced trans inactivation. This was also true for the yellow gene in the P{EPgy2} lines in or near the 301-bp region. lacZ is an enhancer trap, and the reporter's pattern of expression should be controlled by endogenous regulatory elements of genes near the bw locus and mimic the expression profile of the genes surrounding it. The lack of silencing suggests that the genes near the bw locus and the yellow gene are resistant to trans inactivation. One possibility is that the endogenous enhancers around the bw locus happen to be unusually resistant to trans inactivation. This possibility is supported by the fact that there are many recessive lethal genes in the region and yet bwD is not a lethal allele. If these genes were silenced by bwD, then we would expect lethality of both bwD homozygotes and heterozygotes due to silencing by heterochromatin both in cis and in trans. Indeed, this may be the reason that bw is one of the few loci that display dominant PEV. Perhaps it is not an unusual feature of the bw gene but rather an unusual feature of the collection of genes surrounding bw that allows for the easy detection of dominant silencing.


arrow
ACKNOWLEDGMENTS
 
This work was supported by an American Cancer Society grant (RSG-00-073-04-DDC) to A. Csink. J. Jones, and M. Wu were partially supported by the Howard Hughes Medical Institute Biological Sciences Undergraduate Education Program at Carnegie Mellon University. The work of A. Holmes was supported by a Howard Hughes Medical Institute Investigator award to Steven Henikoff.

We thank Steven Henikoff and Rajika Thakar for comments and insights on an earlier version of this paper.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biological Sciences, Carnegie Mellon University, 4400 Fifth Ave., Pittsburgh, PA 15213. Phone: (412) 268-1349. Fax: (412) 268-7129. E-mail: csink{at}andrew.cmu.edu. Back


arrow
REFERENCES
 
    1
  1. Ahmad, K., and S. Henikoff. 2001. Modulation of a transcription factor counteracts heterochromatic gene silencing in Drosophila. Cell 104:839-847.[CrossRef][Medline]
  2. 2
  3. Aparicio, O. M., and D. E. Gottschling. 1994. Overcoming telomeric silencing: a trans-activator competes to establish gene expression in a cell cycle-dependent way. Genes Dev. 8:1133-1146.[Abstract/Free Full Text]
  4. 3
  5. Ashburner, M. 1989. Drosophila: a laboratory handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  6. 4
  7. Bellen, H. J., R. W. Levis, G. Liao, Y. He, J. W. Carlson, G. Tsang, M. Evans-Holm, P. R. Hiesinger, K. L. Schulze, G. M. Rubin, R. A. Hoskins, and A. C. Spradling. 2004. The BDGP gene disruption project: single transposon insertions associated with 40% of Drosophila genes. Genetics 167:761-781.[Abstract/Free Full Text]
  8. 5
  9. Belyaeva, E. S., and I. F. Zhimulev. 1991. Cytogenetic and molecular aspects of position effect variegation in Drosophila. III. Continuous and discontinuous compaction of chromosomal material as a result of position effect variegation. Chromosoma 100:453-466.
  10. 6
  11. Bier, E., H. Vaessin, S. Shepherd, K. Lee, K. McCall, S. Barbel, L. Ackerman, R. Carretto, T. Uemura, E. Grell et al. 1989. Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector. Genes Dev. 3:1273-1287.[Abstract/Free Full Text]
  12. 7
  13. Blanton, J., M. Gaszner, and P. Schedl. 2003. Protein:protein interactions and the pairing of boundary elements in vivo. Genes Dev. 17:664-675.[Abstract/Free Full Text]
  14. 8
  15. Celniker, S. E., and G. M. Rubin. 2003. The Drosophila melanogaster genome. Annu. Rev. Genomics Hum. Genet. 4:89-117.[CrossRef][Medline]
  16. 9
  17. Csink, A. K., A. Bounoutas, M. L. Griffith, J. F. Sabl, and B. T. Sage. 2002. Differential gene silencing by trans-heterochromatin in Drosophila melanogaster. Genetics 160:257-269.[Abstract/Free Full Text]
  18. 10
  19. Csink, A. K., and S. Henikoff. 1996. Genetic modification of heterochromatic association and nuclear organization in Drosophila. Nature 381:529-531.[CrossRef][Medline]
  20. 11
  21. Cuvier, O., C. M. Hart, E. Kas, and U. K. Laemmli. 2002. Identification of a multicopy chromatin boundary element at the borders of silenced chromosomal domains. Chromosoma 110:519-531.[Medline]
  22. 12
  23. Cuvier, O., C. M. Hart, and U. K. Laemmli. 1998. Identification of a class of chromatin boundary elements. Mol. Cell. Biol. 18:7478-7486.[Abstract/Free Full Text]
  24. 13
  25. Dernburg, A. F., K. W. Broman, J. C. Fung, W. F. Marshall, J. Philips, D. A. Agard, and J. W. Sedat. 1996. Perturbation of nuclear architecture by long-distance chromosome interactions. Cell 85:745-759.[CrossRef][Medline]
  26. 14
  27. Dreesen, T. D., S. Henikoff, and K. Loughney. 1991. A pairing-sensitive element that mediates trans-inactivation is associated with the Drosophila brown gene. Genes Dev. 5:331-340.[Abstract/Free Full Text]
  28. 15
  29. Fung, J. C., W. F. Marshall, A. Dernburg, D. A. Agard, and J. W. Sedat. 1998. Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations. J. Cell Biol. 141:5-20.[Abstract/Free Full Text]
  30. 16
  31. Gaszner, M., J. Vazquez, and P. Schedl. 1999. The Zw5 protein, a component of the scs chromatin domain boundary, is able to block enhancer-promoter interaction. Genes Dev. 13:2098-2107.[Abstract/Free Full Text]
  32. 17
  33. Grewal, S. I., and D. Moazed. 2003. Heterochromatin and epigenetic control of gene expression. Science 301:798-802.[Abstract/Free Full Text]
  34. 18
  35. Henikoff, S., J. M. Jackson, and P. B. Talbert. 1995. Distance and pairing effects on the brownDominant heterochromatic element in Drosophila. Genetics 140:1007-1017.[Abstract]
  36. 19
  37. Hwang, K. K., J. C. Eissenberg, and H. J. Worman. 2001. Transcriptional repression of euchromatic genes by Drosophila heterochromatin protein 1 and histone modifiers. Proc. Natl. Acad. Sci. USA 98:11423-11427.[Abstract/Free Full Text]
  38. 20
  39. Kellum, R., and P. Schedl. 1992. A group of scs elements function as domain boundaries in an enhancer-blocking assay. Mol. Cell. Biol. 12:2424-2431.[Abstract/Free Full Text]
  40. 21
  41. Kuhn, E. J., and P. K. Geyer. 2003. Genomic insulators: connecting properties to mechanism. Curr. Opin. Cell Biol. 15:259-265.[CrossRef][Medline]
  42. 22
  43. Kuhn, E. J., C. M. Hart, and P. K. Geyer. 2004. Studies of the role of the Drosophila scs and scs' insulators in defining boundaries of a chromosome puff. Mol. Cell. Biol. 24:1470-1480.[Abstract/Free Full Text]
  44. 23
  45. Lachaise, D., M.-L. Cariou, J. R. David, F. Lemeunier, L. Tsacas, and M. Ashburner. 1988. Historical biogeography of the Drosophila melanogaster species subgroup. Evol. Biol. 22:159-225.
  46. 24
  47. Martin-Morris, L. E., A. K. Csink, D. R. Dorer, P. B. Talbert, and S. Henikoff. 1997. Heterochromatic trans-inactivation of Drosophila white transgenes. Genetics 147:671-677.[Abstract]
  48. 25
  49. Pardue, M. L. 1994. Looking at polytene chromosomes. Methods Cell Biol. 44:333-351.[Medline]
  50. 26
  51. Parnell, T. J., M. M. Viering, A. Skjesol, C. Helou, E. J. Kuhn, and P. K. Geyer. 2003. An endogenous suppressor of hairy-wing insulator separates regulatory domains in Drosophila. Proc. Natl. Acad. Sci. USA 100:13436-13441.[Abstract/Free Full Text]
  52. 27
  53. Platero, J., A. Csink, A. Quintanilla, and S. Henikoff. 1998. Changes in chromosomal localization of heterochromatin binding proteins during the cell cycle in Drosophila. J. Cell Biol. 140:1297-1306.[Abstract/Free Full Text]
  54. 28
  55. Powell, J. R. 1997. Progress and prospects in evolutionary biology: the Drosophila model. Oxford University Press, New York, N.Y.
  56. 29
  57. Russo, C. A., N. Takezaki, and M. Nei. 1995. Molecular phylogeny and divergence times of drosophilid species. Mol. Biol. Evol. 12:391-404.[Abstract]
  58. 30
  59. Sage, B. T., and A. K. Csink. 2003. Heterochromatic self-association, a determinant of nuclear organization, does not require sequence homology in Drosophila. Genetics 165:1183-1193.[Abstract/Free Full Text]
  60. 31
  61. Spradling, A. C., D. Stern, A. Beaton, E. J. Rhem, T. Laverty, N. Mozden, S. Misra, and G. M. Rubin. 1999. The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177.[Abstract/Free Full Text]
  62. 32
  63. Sun, F. L., M. H. Cuaycong, C. A. Craig, L. L. Wallrath, J. Locke, and S. C. Elgin. 2000. The fourth chromosome of Drosophila melanogaster: interspersed euchromatic and heterochromatic domains. Proc. Natl. Acad. Sci. USA 97:5340-5345.[Abstract/Free Full Text]
  64. 33
  65. Talbert, P. B., and S. Henikoff. 2000. A reexamination of spreading of position-effect variegation in the white-roughest region of Drosophila melanogaster. Genetics 154:259-272.[Abstract/Free Full Text]
  66. 34
  67. Tower, J., G. H. Karpen, N. Craig, and A. C. Spradling. 1993. Preferential transposition of Drosophila P elements to nearby chromosomal sites. Genetics 133:347-359.[Abstract]
  68. 35
  69. Udvardy, A., E. Maine, and P. Schedl. 1985. The 87A7 chromomere. Identification of novel chromatin structures flanking the heat shock locus that may define the boundaries of higher order domains. J. Mol. Biol. 185:341-358.
  70. 36
  71. van Driel, R., P. F. Fransz, and P. J. Verschure. 2003. The eukaryotic genome: a system regulated at different hierarchical levels. J. Cell Sci. 116:4067-4075.[Abstract/Free Full Text]
  72. 37
  73. Vosshall, L. B., A. M. Wong, and R. Axel. 2000. An olfactory sensory map in the fly brain. Cell 102:147-159.[CrossRef][Medline]
  74. 38
  75. Yusufzai, T. M., H. Tagami, Y. Nakatani, and G. Felsenfeld. 2004. CTCF tethers an insulator to subnuclear sites, suggesting shared insulator mechanisms across species. Mol. Cell 13:291-298.[CrossRef][Medline]
  76. 39
  77. Zhao, K., C. M. Hart, and U. K. Laemmli. 1995. Visualization of chromosomal domains with boundary element-associated factor BEAF-32. Cell 81:879-889.[CrossRef][Medline]


Molecular and Cellular Biology, January 2005, p. 377-388, Vol. 25, No. 1
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.1.377-388.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Nisha, P., Plank, J. L., Csink, A. K. (2008). Analysis of Chromatin Structure of Genes Silenced by Heterochromatin in Trans. Genetics 179: 359-373 [Abstract] [Full Text]  
  • Sage, B. T., Wu, M. D., Csink, A. K. (2008). Interplay of Developmentally Regulated Gene Expression and Heterochromatic Silencing in Trans in Drosophila. Genetics 178: 749-759 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sage, B. T.
Right arrow Articles by Csink, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sage, B. T.
Right arrow Articles by Csink, A. K.