![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
B Kinase Gamma-Dependent Phosphorylation
Minying Zhang,
Xuefeng Wu,
Erica Granger, and
Shao-Cong Sun*
Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, 500 University Dr., Hershey, Pennsylvania 17033
Received 31 October 2004/ Returned for modification 7 December 2004/ Accepted 15 February 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B kinase gamma (IKK
) and can be induced by IKK catalytic subunits. These findings suggest that CYLD serves as a novel target of IKK and that the site-specific phosphorylation of CYLD regulates its signaling function. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TRAFs function as signaling adaptors of the TNFR superfamily (2) as well as a number of other immune receptors, such as toll-like receptors, interleukin-1 receptor, and T-cell receptor (1, 7, 38). A common structural feature of TRAFs, with the exception of TRAF1, is their possession of a ring finger domain known to mediate protein ubiquitination (24). It has been shown that TRAF2 and TRAF6 function as ubiquitin ligases that catalyze both self-ubiquitination and the ubiquitination of specific target molecules involved in signal transduction (10, 13, 18, 34, 41). Strong evidence suggests that the ubiquitination of TRAF2 and TRAF6 functions as a molecular trigger for initiating downstream signaling events, including activation of c-Jun N-terminal kinase (JNK) (13, 34) and IB kinase (IKK) (38, 41).
IKK is known as a specific activator of the transcription factor NF-B (20, 36). The IKK complex is composed of two catalytic subunits, IKK
and IKKß, and a regulatory subunit termed IKK (19). Upon activation by various cellular stimuli, IKK phosphorylates the NF-B inhibitor IB, triggering the proteolysis of IB and nuclear translocation of active NF-B (19). The canonical substrates of JNK include c-Jun, JunD, and ATF2, components of the transcription factor AP-1 (9). Like IKK, JNK regulates diverse biological processes, ranging from immune responses, cell growth, and apoptosis to tumor formation (9, 17, 23, 25). A role for CYLD in IKK regulation is suggested by some recent studies, which reveal that CYLD inhibits the activation of an NF-B reporter gene (4, 6, 22, 39). Using RNA interference (RNAi)-mediated CYLD knockdown, we have shown that CYLD is also a key negative regulator of JNK downstream of specific immune receptors (29). In agreement with these findings, CYLD inhibits the ubiquitination of both TRAF2 and TRAF6 in transfected cells (6, 22, 39). However, despite these important observations, the molecular mechanism regulating the function of CYLD remains unknown. In this study, we demonstrate that CYLD plays a dominant role in suppressing the ubiquitination of endogenous TRAF2. CYLD knockdown results in constitutive ubiquitination of TRAF2. Interestingly, signal-induced TRAF2 ubiquitination is associated with site-specific phosphorylation of CYLD, a molecular event that appears to prevent CYLD from inhibiting the ubquitination of TRAF2. We further demonstrate that the CYLD phosphorylation is dependent on IKK.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
was generated by inserting the human IKK cDNA into pcDNA vector downstream of a myc epitope tag. pCLXSN-hCD40 was cloned by inserting the human CD40 cDNA into the pCLXSN retroviral vector. Expression vectors encoding HA-tagged IKK and IKKß (40), HA-tagged ubiquitin (42, 43), glutathione S-transferase (GST)-IB(1-54), and GST-c-Jun(1-79) (29) were described previously. GST-CYLD(403-513) was cloned by inserting a DNA fragment encoding amino acids 403 to 513 of human CYLD into the pGEX4T-1 vector (Amersham/Pharmacia Biotech). The point mutants of GST-CYLD(403-513) were generated by site-directed mutagenesis. All the DNA constructs were sequenced at the Core Facility of Hershey Medical Center.
Antibodies, cell lines, and other reagents.
The anti-CYLD antibody was generated by injection of rabbits with a GST fusion protein containing an N-terminal region of human CYLD (amino acids 136 to 301). The phospho-specific CYLD antibody (anti-P-CYLD S418) specifically recognizes CYLD containing phosphorylated serine 418. This antibody was generated by injection of rabbits with a keyhole limpet hemocyanin-conjugated peptide covering amino acids 413 to 428 of human CYLD, in which serine 418 was phosphorylated. Polyclonal antibodies for tubulin (TU-02), JNK1 (C-17), JNK2 (N18), TRAF2 (C-20), and IKK (FL-419) were purchased from Santa Cruz. Horseradish peroxidase (HRP)-conjugated HA antibody (3F10) and human recombinant TNF- were from Roche Applied Science. Phorbol myristate acetate (PMA), ionomycin, and lipopolysaccharide (LPS; derived from Escherichia coli 0127:B8) were from Sigma. Recombinant IKK and IKKß proteins were provided by Michael Karin.
Human embryonic kidney 293 cells, human cervical carcinoma HeLa cells, human B-cell line BJAB, and human leukemia T-cell line Jurkat were obtained from American Type Culture Collection. IKK-deficient Jurkat cell line, JM4.5.2, and its IKK-reconstituted derivative, JM4.5.2-IKK, were described previously (14, 30).
RNAi. siRNAs specific for human CYLD and luciferase were synthesized by Dharmacon Research, Inc. (Lafayette, CO). The sense strand sequences of the oligonucleotides are as follows: CYLD siRNA, AAGUACCGAAGGGAAGUAUAG; and luciferase siRNA, AACTTACGCTGAGTACTTCGA.
For siRNA delivery, 293 and HeLa cells were transfected in six-well plates with 140 pmol of siRNA, using Oligofectamine (Invitrogen). At 16 to 24 h following the first transfection, the cells were transfected again with the same amount of siRNA together with 300 ng carrier DNA, using Lipofectamine 2000. At about 30 h after the second transfection, the cells were used for different experiments.
For stable gene knockdown using the small hairpin RNA (shRNA) technique, a double-stranded oligonucloetide corresponding to the CYLD siRNA was cloned into the pSUPER-retro-puromycin vector (Oligoengine) downstream of the U6 promoter. The generated retroviral construct, named pSUPER-shCYLD, was used to produce recombinant viruses and infect the indicated cells. The infected cells were enriched by selection using puromycin. The bulk-infected cells were used in the experiments to avoid clonal variations.
IB, IP, and in vitro kinase assays.
Cell lysates were prepared by lysing the cells in a kinase lysis buffer supplemented with phosphatase inhibitors and immediately subjected to immunoblotting (IB) and in vitro kinase assays as described previously (40). To detect phosphorylated CYLD based on its band shift, the CYLD proteins were first concentrated by immunoprecipitation (IP) (using anti-CYLD) followed by fractionation using 6% sodium dodecyl sulfate (SDS) gels and IB. coimmunoprecipitation (coIP) was performed to determine the interaction of CYLD with TRAF2 and IKK.
In vivo ubiquitin conjugation assays. The indicated cells were transfected in six-well plates with pcDNA-HA-ubiquitin (0.5 µg). At 30 to 40 h following transfection, the cells were stimulated as indicated and lysed in radioimmunoprecipitation assay buffer (42) supplemented with inhibitors of ubiquitin hydrolases (20 mM N-ethylmaleimide and 5 µM ubiquitin aldehyde). The cell lysates were immediately subjected to IP using anti-TRAF2, and the ubiquitin-conjugated TRAF2 was analyzed by IB using HRP-conjugated anti-HA antibody.
Retroviral infection. Retroviral particles were produced using the pCLXSN vector system as previously described (8, 30). The infected cells were enriched by drug selection using either puromycin (for CYLD knockdown with pSUPER-retro-puro vector) or neomycin (for infection with pCLXSN vector). For reconstitution of the Jurkat-shCYLD cells with RNAi-resistant CYLD (CYLDR) or mutant M4 (M4R), the pCLXSN(GFP) vector was used and the infected cells were enriched by fluorescence cell sorting (Core Facility of Hershey Medical Center). The bulk-infected cells were used in the experiments to avoid clonal variations.
RPA. Total cellular RNA was isolated from the indicated cells using the TRI reagent (Molecular Research Center, Inc., Cincinnati, OH). The RNase protection assay (RPA) was performed using the BD RiboQuant reagents and a custom template set according to the manufacturer's instructions (BD Biosciences).
Luciferase reporter gene assay.
Luciferase assays were performed using Jurkat T cells expressing wild-type CYLD (Jurkat-shCYLD-CYLD WTR) or a phosphorylation-defective CYLD mutant (Jurkat-shCYLD-CYLD M4R). To create these cells, Jurkat T cells were first infected with pSUPER-shCYLD to stably knock down endogenous CYLD. The generated Jurkat-shCYLD cells were then reconstituted, by retroviral infection, with an RNAi-resistant form of either the wild type (WTR) or phosphorylation-deficient mutant (M4R) of CYLD. For luciferase assays, the cells (5 x 105) were seeded in 12-well plates and transfected using Fugene 6 transfection reagent (Roche Applied Science) with B-TATA-luc reporter (250 ng) together with 250 ng of either an empty pCLXSN vector or the same vector containing human CD40 cDNA (pCLXSN-CD40). After 40 h, the cells were lysed in a cell lysis buffer (passive buffer) and subjected to dual-luciferase assays (Promega; dual-luciferase reporter assay system).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
stimulation, which is involved in JNK activation (13, 34). Since CYLD functions as a negative regulator of JNK in the TNF- signaling pathway (29), we analyzed the role of CYLD in regulating the uibquitination of TRAF2 under endogenous conditions. For these studies, endogenous CYLD was knocked down in 293 cells by RNAi followed by examining the ubiquitination of endogenous TRAF2 under untreated or TNF--stimulated conditions. As expected, the expression level of CYLD was greatly reduced in cells transfected with a CYLD-specific siRNA (siCYLD; Fig. 1A, panel 2, lanes 4 to 6) but was not affected in cells transfected with a control siRNA for luciferase (siLuc; lanes 1 to 3). In the control cells, only a trace amount of ubiquitinated TRAF2 was detected under untreated conditions (Fig. 1A, panel 1, lane 1) but the TRAF2 ubiquitination was markedly induced by TNF- (lanes 2 and 3). Remarkably, when CYLD was knocked down by its specific siRNA, TRAF2 became costitutively ubiquitinated (lane 4). Stimulation of these cells with TNF- failed to further enhance TRAF2 ubiquitination (lanes 5 and 6). Parallel studies using HeLa cells obtained similar results (Fig. 1B). These findings suggest that CYLD plays a critical role in suppressing the in vivo ubiquitination of TRAF2 and raise the possibility that signal-mediated induction of TRAF2 ubiquitination may involve functional modification of CYLD.
|
(Fig. 2A). Interestingly, the slower-migrating form of CYLD could be converted to its basal form by in vitro incubation with a nonspecific phosphatase (Fig. 2A, lane 13), thus revealing phosphorylation as the nature of CYLD modification. The CYLD phosphorylation was also readily detected in TNF--stimulated 293 (Fig. 2C) and HeLa cells (Fig. 2D) as well as in LPS-stimulated BJAB B cells (Fig. 2E). Notably, the kinetics of CYLD phosphorylation was correlated with the phosphorylation of IB, both appearing as early as 5 min in cells stimulated with mitogens and TNF- (Fig. 2A, C, and D, lane 2; P-CYLD and P-IB). Consistently, the activation of IKK was also tightly associated with CYLD phosphorylation (compare Fig. 1A and B). The slightly delayed kinetics of IB degradation, compared to that of IKK activation and phosphorylation of CYLD, is consistent with the involvement of postphosphorylation steps (e.g., ubiquitination and proteasome targeting) in this proteolytic event. Together with the previous finding that CYLD physically interacts with the IKK regulatory subunit, IKK (22, 39), these results raise the intriguing possibility that IKK may be involved in the inducible phosphorylation of CYLD.
|
and can be induced by IKK catalytic subunits.
To determine the importance of IKK in CYLD phosphorylation, we analyzed this signaling event using an IKK-deficient Jurkat T-cell line, JM4.5.2, which was created in our laboratory (14) and has since been used in numerous studies by others. Due to the lack of IKK, the IKK complex cannot be activated by various known IKK stimuli, such as mitogens and cytokines, and this defect can be rescued by expression of the exogenous IKK (30, 31). As expected, mitogens failed to induce the degradation of IB (target of IKK) in JM4.5.2 cells (Fig. 3A, lower panel, lane 4), but this signaling defect was rescued when the mutant cells were reconstituted with exogenous IKK (lane 6). Remarkably, the inducible phosphorylation of CYLD was also dependent on IKK, which was blocked in the IKK-deficient cells and rescued upon IKK reconstitution (Fig. 3A, upper panel). In concert with this finding, CYLD was phosphorylated in 293 cells by transfected IKK catalytic subunits, IKKß (Fig. 3B, lane 2) or IKK (lane 4). Notably, optimal phosphorylation of CYLD by both IKK and IKKß required their cotransfection with IKK (lane 6) (data not shown). Since IKK physically interacts with CYLD (22, 39), it is likely that IKK is required for recruiting CYLD to the IKK catalytic subunits.
|
-binding activity, since all the truncation mutants were competent in IKK binding (Fig. 3D). Thus, the phosphorylation site of CYLD is likely located between amino acids 420 and 446.
To determine whether IKK directly phosphorylates CYLD, we generated a GST-CYLD fusion protein containing a region of CYLD (amino acids 403 to 513) that covers its phosphorylation site. We then performed in vitro kinase assays using the GST-CYLD substrate and IKK holoenzyme isolated from Jurkat cells or recombinant IKKs. The GST-CYLD was not significantly phosphorylated by inactive IKK isolated from untreated cells but was potently phosphorylated by the active IKK isolated from mitogen- and TNF--stimulated cells (Fig. 3E, upper panel). The relative level of GST-CYLD phosphorylation was similar to that of the phosphorylation of GST-IB (lower panel). The CYLD phosphorylation was specific, since the IKK complex did not phosphorylate the GST protein (Fig. 3F). Further, the GST-CYLD was also phosphorylated by recombinant IKKß (Fig. 3G, lanes 6 to 10) and IKK (data not shown) (see Fig. 4C). Parallel dose-dependent kinase assays using GST-CYLD (Fig. 3G, lanes 6 to 10) and GST-IB (lanes 1 to 5) revealed that IKK phosphorylates these two substrates with comparable efficiencies.
|
B and IBß (Fig. 4A, underlined, and Fig. 4B). Since IKK is known to be a serine kinase (11), one or more of these serines are likely involved in CYLD phosphorylation. To test this hypothesis, serine-to-alanine (S/A) substitutions were introduced into the GST-CYLD construct to generate mutants harboring various S/A substitutions (Fig. 4A, M1 to M4). In vitro kinase assays revealed that mutation of one pair of the serines (see Fig. 4A, M1) partially affected the CYLD phosphorylation by IKK (Fig. 4C, lane 2). Combined mutation of the two pairs of serines (M2) significantly diminished the CYLD phosphorylation (Fig. 4C, lane 3), and the phosphorylation of CYLD was completely abolished by the combined mutations of the entire serine cluster (M4, lane 5). Similar results were obtained with the IKK holoenzyme (Fig. 4C, panel 1), recombinant IKKß (panel 2), and recombinant IKK (panel 3).
To determine whether the result of the in vitro kinase assays is consistent with the in vivo phosphorylation of CYLD, the various mutations illustrated in Fig. 4A were introduced directly into full-length CYLD and the resulting CYLD mutants were examined for their in vivo phosphorylation by transfected IKKß and IKK. Similar to the in vitro phosphorylation results, the in vivo phopshorylation of CYLD was progressively attenuated along with mutation of more serines and was completely abolished by the M4 mutation (Fig. 4D). The phosphorylation defect of M4 was not due to its loss of IKK-binding activity, as demonstrated by coIP assays (data not shown).
We next determined whether the serine cluster was responsible for CYLD phosphorylation induced by cellular stimuli. For these studies, we stably knocked down the endogenous CYLD in Jurkat and HeLa cells using a pSUPER retroviral vector encoding CYLD-specific shRNA (shCYLD). The generated CYLD-deficient cells (named Jurkat-shCYLD and HeLa-shCYLD) were then reconstituted with the RNAi-resistant form of wild-type CYLD (WTR) or its phosphorylation-deficient M4 mutant (M4R). As expected, CYLD expression was extremely low in cells infected with pSUPER-shCYLD (Fig. 4E, lanes 2 and 6) but could be readily detected in the control cells infected with the empty pSUPER vector (lanes 1 and 5). Further, the CYLD deficiency in the Jurkat-shCYLD and HeLa-shCYLD cells was efficiently rescued by retroviral infection with the RNAi-resistant wild-type CYLD (WTR; lanes 3 and 7) and M4 mutant (M4R; lanes 4 and 8). In vivo phosphorylation analysis revealed that like endogenous CYLD, the exogenous wild-type CYLD was phosphorylated upon cellular stimulation by mitogens (Fig. 4F, lanes 1 to 3) and TNF- (lanes 7 to 9). In contrast, the CYLD M4 mutant was not phosphorylated in response to either inducer (lanes 4 to 6 and 10 to 12). Thus, the IKK phosphorylation sites within CYLD are responsible for its in vivo phosphorylation stimulated by immune stimuli.
To further confirm that the serine cluster of CYLD is phosphorylated in vivo, we generated an antibody that detects CYLD phosphorylation at one of the clustered serines (serine 418). As expected, this phospho-specific CYLD antibody (named anti-P-CYLD S418) did not react with the basal form of CYLD in untreated cells (Fig. 5A, lane 3). More importantly, the phosphorylated CYLD was efficiently detected by this antibody in stimulated cells (lane 4). Thus, serine 418 is phosphorylated in vivo. IB assays using a CYLD mutant harboring a serine-to-alanine mutation at serine 418 (S418A) showed that mutation of this phosphorylation site did not abolish the inducible phosphorylation of CYLD (Fig. 5B). This result further supports our idea that multiple serines within the serine cluster likely contribute to CYLD phosphorylation.
|
, the endogenous TRAF2 was ubiquitinated in the CYLD WTR-reconstituted cells (Fig. 6A, upper panel, lanes 2 and 3). The inducible TRAF2 ubiquitination was not due to alteration in the level of overall protein ubiquitination in the cells (lower panel, lanes 1 to 3). Remarkably, the inducible ubiquitination of TRAF2 was largely defective in cells reconstituted with the phosphorylation-defective CYLD mutant (Fig. 6A, upper panel, lanes 5 and 6). Thus, the CYLD phosphorylation is required for TNF--stimulated TRAF2 ubiquitination. This finding, together with the results presented in Fig. 1, indicates that the CYLD phosphorylation may serve as a mechanism to inactivate its TRAF2 deubiquitination activity. To further examine this possibility, we generated a phospho-mimetic form of the CYLD M4 mutant by substituting the phosphorylation sites (serines) with glutamic acids (named M4 S/E). The constitutive TRAF2-deubiquitinating activity of CYLD and its mutants were analyzed by transient transfection in 293 cells. As previously reported, overexpressed TRAF2 underwent self-ubiquitination (Fig. 6B, lane 1), which was inhibited by coexpression with wild-type CYLD (lane 2). Consistent with its ability to block the inducible TRAF2 ubiquitination, the M4 mutant of CYLD retained the TRAF2-deubiquitinating activity (lane 3). Interestingly, however, the phospho-mimetic CYLD (M4 S/E) completely lost its ability to inhibit TRAF2 ubiquitination (Fig. 6B, lane 4). Parallel coIP assays revealed that both M4 and M4 S/E remained competent in association with TRAF2 (Fig. 6C). It is thus likely that the phosphorylation of CYLD does not prevent its binding to TRAF2 but may inactivate its DUB function by other mechanisms.
|
signaling pathway (29). Based on the results described above, we reasoned that CYLD phosphorylation might also be required for optimal activation of JNK. This hypothesis was examined using the CYLD-knockdown cells reconstituted with wild-type or mutant forms of exogenous CYLD. In response to TNF- stimulation, JNK was activated in HeLa-shCYLD cells reconstituted with wild-type CYLD (Fig. 6D, lanes 1 to 3) and the level of JNK activation was comparable to the parental HeLa cells (data not shown). Interestingly, JNK activation was significantly attenuated in the cells reconstituted with CYLD M4 (lanes 4 to 6). Similar results were obtained with the Jurkat-shCYLD cells, which revealed a significant defect in JNK activation in the M4R-reconstituted cells (Fig. 6D, lanes 10 to 12) as compared with the WTR-reconstituted cells (lanes 7 to 9). These data suggest that CYLD phosphorylation is required for disrupting its negative regulatory function in JNK activation.
Functional consequence of CYLD phosphorylation in regulating gene expression.
We next analyzed the functional consequence of CYLD phosphorylation in gene induction. Reporter gene assays were performed to assess the role of CYLD phosporylation in regulating NF-B-specific gene expression. We used CD40 as an inducer, because CYLD plays an important role in regulating CD40-mediated NF-B signaling (29). As expected, CD40 strongly induced the B-dependent reporter gene expression in Jurkat cells expressing the wild-type CYLD (Fig. 7A, column 2). In contrast, the CD40-induced B response was drastically reduced in cells expressing the phosphorylation-defective CYLD mutant M4 (column 4).
|
. Although CYLD has no significant role in TNF--mediated NF-B activation, it negatively regulates the TNF--stimulated JNK signaling pathway. RPA was performed to examine the expression of several genes known to be induced by TNF- (29). Whereas most of these genes were similarly induced in cells expressing the wild-type or M4 mutant CYLD, the induction of one gene (that coding for RANTES) was markedly attenuated in the M4-expressing cells (Fig. 7B, top panel, lane 4). This result was not due to the variation in RNA amounts, since it was observed only with RANTES. Further, expression of two housekeeping genes (coding for L32 and GAPDH) suggests that the level of M4 cell RNA was even slightly higher than that of the wild-type cell RNA. This result is consistent with the involvement of JNK in RANTES gene induction (32). Since RANTES is a critical chemokine that mediates septic shock (27), this finding suggests a possible role for CYLD in regulating inflammatory responses. |
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a key component of the canonical IKK, is required for the inducible phosphorylation of CYLD.
The constitutive TRAF2 ubiquitination in CYLD-knockdown cells explains the basal activation of JNK and IKK associated with CYLD knockdown (29). However, since the kinase activity (29), but not the TRAF2 ubiquitination (Fig. 1), is further induced by TNF-, it suggests that TRAF2 ubiquitination is not sufficient for triggering optimal activation of JNK or IKK. The finding that CYLD knockdown results in constitutive TRAF2 ubiquitination not only suggests a dominant function of the DUB CYLD but also implies that the ubiquitin ligase TRAF2 may undergo spontaneous ubiquitination. This hypothesis is consistent with the finding that TRAF2 undergo self-ubiquitination in transfected cells, which is inhibited by contransfection with CYLD (22, 28, 39) (Fig. 6B). Of course, since these results were obtained with transformed cell lines, it remains to be determined whether CYLD-deficient primary cells also exhibit basal TRAF2 ubiquitination activity. Nevertheless, it is conceivable that under normal conditions, the ubiquitinated TRAF2 may be rapidly deubiquitinated by CYLD. Based on this hypothesis, one can predict that induction of TRAF2 ubiquitination by cellular stimuli is achieved by either enhancing the ubiquitin ligase activity of TRAF2 or inhibiting the DUB function of CYLD. Whereas the former possibility remains to be investigated, we have obtained strong evidence that supports the latter possibility. We show that signal-induced TRAF2 ubiquitination is associated with phosphorylation of CYLD. When the endogenous CYLD is replaced with a phosphorylation-defective CYLD mutant, the inducible ubiquitination of TRAF2 is severely attenuated (Fig. 6A). A logical explanation of this finding is that phosphorylation serves as a mechanism that temporarily inactivates the DUB activity of CYLD, thus allowing the accumulation of ubiquitin-conjugated TRAF2. In further support of this hypothesis, a phospho-mimetic form of CYLD completely lost its TRAF2-deubiquitinating function (Fig. 6B).
The functional consequence of CYLD phosphorylation remains an interesting topic of investigation, since the in vivo physiological function of CYLD has not been well defined. Nevertheless, we have shown that interruption of CYLD phosphorylation markedly inhibits CD40-mediated induction of a B-specific reporter gene (Fig. 7A). Further, in the TNF- signaling pathway, the CYLD phosphorylation appears to be important for the expression of a chemokine gene, coding for RANTES (Fig. 7B). Future studies will employ the gene array technique to identify more genes under the regulation of CYLD. A prior study suggests that CYLD participates in TNF--induced apoptosis (6). We thus examined whether the phosphorylation of CYLD diminishes its proapoptotic function. To our surprise, we did not observe any significant effect of CYLD knockdown or CYLD phosphorylation on TNF--induced apoptosis in our system (see Fig. S1 in the supplemental material). Although the precise reason for this discrepancy is not clear, we have noticed that the previous study used a different protocol for apoptosis induction, which involves prestimulation of cells with PMA (6). Since CYLD knockdown has no obvious effect on TNF--stimulated NF-B activation (29), we believe that CYLD may regulate cell survival downstream of specific receptors. The IKK-mediated CYLD phosphorylation likely provides a cross talk between the canonical NF-B inducing signals and the CYLD-specific receptors. This idea is consistent with the fact that patients with CYLD genetic deficiency only develop a specific type of benign tumor, cylindromatosis (4), instead of having global abnormalities in cell growth/survival. Clearly, a better understanding of the functional consequence of CYLD phosphorylation requires more knowledge regarding the physiological function of CYLD, which in turn will rely on studies using an in vivo model system (e.g., CYLD knockout mice).
IKK is known as a kinase that specifically phosphorylates IB and related inhibitors, thereby mediating the nuclear translocation of NF-B. One intriguing question is whether IKK has other substrates or mediates additional signaling functions. Novel functions have indeed been identified for the noncanonical IKK component IKK. One such function of IKK is regulation of epidermal differentiation and skeletal morphology, a process that does not require the catalytic activity of IKK (35). Another interesting function of IKK, which requires its kinase activity, occurs in the nucleus and involves phosphorylation of the histone H3 (3, 44, 45). This novel function of IKK is required for transcriptional activation of NF-B target genes. Our present study suggests that IKK also regulates the function of DUB CYLD. We have found that CYLD undergoes rapid and transient phosphorylation in cells stimulated with various known IKK inducers (Fig. 2). The CYLD phoshorylation is dependent on IKK, since it is blocked in IKK-deficient Jurkat T cells (Fig. 3A). Transfection and in vitro kinase assays reveal that both IKK and IKKß are able to phosphorylate CYLD (Fig. 3 and 4), although it remains unclear whether one or both of these IKK catalytic subunits are essential for CYLD phosphorylation. We attempted to address this question using mouse embryonic fibroblasts deficient in different IKK subunits. Unfortunately, the phosphorylation of CYLD could not be detected even in wild-type mouse embryonic fibroblasts (data not shown). Currently, we do not know whether this result is due to the variations in species (the anti-CYLD antibody is for human protein) or cell types. Nevertheless, at least in vitro, CYLD does not show preference to IKK or IKKß, a property that is different from IB and the IB-like molecule p100, which are preferentially phosphorylated by IKKß and IKK, respectively (33). Another interesting feature of CYLD phosphorylation is the critical requirement of IKK. Although IKK and IKKß efficiently phosphorylate CYLD in vitro (Fig. 3G and 4C), induction of CYLD phosphorylation in vivo by these IKK catalytic subunits requires the assistance by IKK (Fig. 3B). One likely interpretation of this result is that IKK functions as both the regulatory subunit of IKK and an adaptor for recruiting CYLD to the IKK catalytic subunits. However, the possibility of the involvement of novel mechanisms in IKK function cannot be excluded. For example, IKK may regulate another kinase that cooperates with the classical IKK in CYLD phosphorylation. Notwithstanding, our findings clearly establish IKK as an essential factor in signal-induced CYLD phosphorylation. Phosphorylation of CYLD represents a novel aspect of IKK function, since it regulates the deubiquitination function of CYLD rather than triggering the degradation of this novel substrate.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by research grants from the National Institutes of Health to S.-C.S (CA094922 and AI45045) and M.Z (AI45045) and the Four Diamond Fund at Penn State Children's Hospital to M.Z.W.R. was supported by a predoctoral/postdoctoral training grant (5 T32CA60395-09) from the National Institutes of Health.
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/.
These authors contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Aggarwal, B. B. 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nat. Rev. Immunol. 3:745-756.[CrossRef][Medline]
3. Anest, V., J. L. Hanson, P. C. Cogswell, K. A. Steinbrecher, B. D. Strahl, and A. S. Baldwin. 2003. Nucleosomal function for IkappaB kinase-alpha in NF-kappaB-dependent gene expression. Nature 423:659-663.[CrossRef][Medline]
4. Bignell, G. R., W. Warren, S. Seal, M. Takahashi, E. Rapley, R. Barfoot, H. Green, C. Brown, P. J. Biggs, S. R. Lakhani, C. Jones, J. Hansen, E. Blair, B. Hofmann, R. Siebert, G. Turner, D. G. Evans, C. Schrander-Stumpel, F. A. Beemer, A. van Den Ouweland, D. Halley, B. Delpech, M. G. Cleveland, I. Leigh, J. Leisti, and S. Rasmussen. 2000. Identification of the familial cylindromatosis tumour-suppressor gene. Nat. Genet. 25:160-165.[CrossRef][Medline]
5. Brooke, H. G. 1892. Epithelioma adenoides cysticum. Br. J. Dermatol. 4:269-287.
6. Brummelkamp, T. R., S. M. Nijman, A. M. Dirac, and R. Bernards. 2003. Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF-kappaB. Nature 424:797-801.[CrossRef][Medline]
7. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, and D. V. Goeddel. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383:443-446.[CrossRef][Medline]
8. Cvijic, M. E., G. Xiao, and S. C. Sun. 2003. Study of T-cell signaling by somatic cell mutagenesis and complementation cloning. J. Immunol. Methods 278:293-304.[CrossRef][Medline]
9. Davis, R. J. 2000. Signal transduction by the JNK group of MAP kinases. Cell 103:239-252.[CrossRef][Medline]
10. Deng, L., C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, C. Pickart, and Z. J. Chen. 2000. Activation of the IkB kinase complex by TRAF6 requires a dimeric ubiqutitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103:351-361.[CrossRef][Medline]
11. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. 1997. A cytokine-responsive IB kinase that activates the transcription factor NF-B. Nature 388:548-554.[CrossRef][Medline]
12. Fischer, J. A. 2003. Deubiquitinating enzymes: their roles in development, differentiation, and disease. Int. Rev. Cytol. 229:43-72.[Medline]
13. Habelhah, H., S. Takahashi, S. G. Cho, T. Kadoya, T. Watanabe, and Z. Ronai. 2003. Ubiquitination and translocation of TRAF2 is required for activation of JNK but not of p38 or NF-kappaB. EMBO J. 23:322-332.[CrossRef]
14. Harhaj, E. W., L. Good, G.-T. Xiao, M. Uhlik, M. E. Cvijic, I. Rivera, and S.-C. Sun. 2000. Somatic mutagenesis studies of NF-kappa B signaling in human T cells: evidence for an essential role of IKK gamma in NF-kappa B activation by T-cell costimulatory signals and HTLV-I Tax protein. Oncogene 19:1386-1391.[CrossRef][Medline]
15. Harhaj, E. W., and S.-C. Sun. 1999. Regulation of RelA subcellular localization by a putative nuclear export signal and p50. Mol. Cell. Biol. 19:7088-7095.
16. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu. Rev. Biochem. 67:425-479.[CrossRef][Medline]
17. Ip, Y. T., and R. J. Davis. 1998. Signal transduction by the c-Jun N-terminal kinase (JNK)—from inflammation to development. Curr. Opin. Cell Biol. 10:205-219.[CrossRef][Medline]
18. Jensen, L. E., and A. S. Whitehead. 2003. Ubiquitin activated tumor necrosis factor receptor associated factor-6 (TRAF6) is recycled via deubiquitination. FEBS Lett. 553:190-194.[CrossRef][Medline]
19. Karin, M., and Y. Ben-Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-B activity. Annu. Rev. Immunol. 18:621-663.[CrossRef][Medline]
20. Karin, M., and M. Delhase. 2000. The I kappa B kinase (IKK) and NF-kappa B: key elements of proinflammatory signalling. Semin. Immunol. 12:85-98.[CrossRef][Medline]
21. Kim, J. H., K. C. Park, S. S. Chung, O. Bang, and C. H. Chung. 2003. Deubiquitinating enzymes as cellular regulators. J. Biochem. 134:9-18.
22. Kovalenko, A., C. Chable-Bessia, G. Cantarella, A. Israel, D. Wallach, and G. Courtois. 2003. The tumour suppressor CYLD negatively regulates NF-kappaB signalling by deubiquitination. Nature 424:801-805.[CrossRef][Medline]
23. Lin, A., and B. Dibling. 2002. The true face of JNK activation in apoptosis. Aging Cell 1:112-116.[CrossRef][Medline]
24. Lorick, K. L., J. P. Jensen, S. Fang, A. M. Ong, S. Hatakeyama, and A. M. Weissman. 1999. RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl. Acad. Sci. USA 96:11364-11369.
25. Manning, A. M., and R. J. Davis. 2003. Targeting JNK for therapeutic benefit: from junk to gold? Nat. Rev. Drug Discov. 2:554-565.[CrossRef][Medline]
26. Naviaux, R. K., E. Costanzi, M. Haas, and I. M. Verma. 1996. The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J. Virol. 70:5701-5705.
27. Ness, T. L., K. J. Carpenter, J. L. Ewing, C. J. Gerard, C. M. Hogaboam, and S. L. Kunkel. 2004. CCR1 and CC chemokine ligand 5 interactions exacerbate innate immune responses during sepsis. J. Immunol. 173:6938-6948.
28. Regamey, A., D. Hohl, J. W. Liu, T. Roger, P. Kogerman, R. Toftgard, and M. Huber. 2003. The tumor suppressor CYLD interacts with TRIP and regulates negatively nuclear factor kappaB activation by tumor necrosis factor. J. Exp. Med. 198:1959-1964.
29. Reiley, W., M. Zhang, and S.-C. Sun. 2004. Tumor suppressor negatively regulates JNK signaling pathway downstream of TNFR members. J. Biol. Chem. 279:55161-55167.
30. Rivera-Walsh, I., M. E. Cvijic, G. Xiao, and S. C. Sun. 2000. The NF-kappa B signaling pathway is not required for Fas ligand gene induction but mediates protection from activation-induced cell death. J. Biol. Chem. 275:25222-25230.
31. Rivera-Walsh, I., M. Waterfield, G. Xiao, A. Fong, and S.-C. Sun. 2001. NF-B signaling pathway governs TRAIL gene expression and HTLV-I Tax-induced T-cell death. J. Biol. Chem. 276:40385-40388. (First published 11 September 2001; doi:10.1074/jbc.C100501200.)
32. Schwabe, R. F., R. Bataller, and D. A. Brenner. 2003. Human hepatic stellate cells express CCR5 and RANTES to induce proliferation and migration. Am. J. Physiol. Gastrointest. Liver Physiol. 285:G948-G958.
33. Senftleben, U., Y. Cao, G. Xiao, G. Kraehn, F. Greten, Y. Chen, Y. Hu, A. Fong, S.-C. Sun, and M. Karin. 2001. Activation of IKK of a second, evolutionary conserved, NF-B signaling pathway. Science 293:1495-1499.
34. Shi, C. S., and J. H. Kehrl. 2003. TNF-induced GCKR and SAPK activation depends upon the E2/E3 complex Ubc13-Uev1A/TRAF2. J. Biol. Chem. 278:15429-15434.
35. Sil, A. K., S. Maeda, Y. Sano, D. R. Roop, and M. Karin. 2004. IkappaB kinase-alpha acts in the epidermis to control skeletal and craniofacial morphogenesis. Nature 428:660-664.[CrossRef][Medline]
36. Silverman, N., and T. Maniatis. 2001. NF-B signaling pathways in mammalian and insect innate immunity. Genes Dev. 15:2321-2342.
37. Spiegler, E. 1899. Ueber endotheliome der haut. Arch. Dermatol. Syphilol. 50:163-176.[CrossRef]
38. Sun, L., L. Deng, C.-K. Ea, Z.-P. Xia, and Z. J. Chen. 2004. The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol. Cell 14:289-301.[CrossRef][Medline]
39. Trompouki, E., E. Hatzivassiliou, T. Tsichritzis, H. Farmer, A. Ashworth, and G. Mosialos. 2003. CYLD is a deubiquitinating enzyme that negatively regulates NF-kappaB activation by TNFR family members. Nature 424:793-796.[CrossRef][Medline]
40. Uhlik, M., L. Good, G. Xiao, E. W. Harhaj, E. Zandi, M. Karin, and S.-C. Sun. 1998. NF-kappaB-inducing kinase and IkappaB kinase participate in human T-cell leukemia virus I Tax-mediated NF-kappaB activation. J. Biol. Chem. 273:21132-21136.
41. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J.-I. Inoue, and Z. J. Chen. 2001. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412:346-351.[CrossRef][Medline]
42. Xiao, G., M. E. Cvijic, A. Fong, E. W. Harhaj, M. T. Uhlik, M. Waterfield, and S. C. Sun. 2001. Retroviral oncoprotein Tax induces processing of NF-kappaB2/p100 in T cells: evidence for the involvement of IKKalpha. EMBO J. 20:6805-6815.[CrossRef][Medline]
43. Xiao, G., E. W. Harhaj, and S. C. Sun. 2001. NF-kappaB-inducing kinase regulates the processing of NF-kappaB2 p100. Mol. Cell 7:401-409.[CrossRef][Medline]
44. Yamamoto, Y., and R. B. Gaynor. 2004. IkappaB kinases: key regulators of the NF-kappaB pathway. Trends Biochem. Sci. 29:72-79.[CrossRef][Medline]
45. Yamamoto, Y., U. N. Verma, S. Prajapati, Y. T. Kwak, and R. B. Gaynor. 2003. Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423:655-659.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
