MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dou, Y.
Right arrow Articles by Gorovsky, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dou, Y.
Right arrow Articles by Gorovsky, M. A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, May 2005, p. 3914-3922, Vol. 25, No. 10
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.10.3914-3922.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The H1 Phosphorylation State Regulates Expression of CDC2 and Other Genes in Response to Starvation in Tetrahymena thermophila

Yali Dou ,{dagger},{ddagger} Xiaoyuan Song,{ddagger} Yifan Liu,{dagger} and Martin A. Gorovsky*

Department of Biology, University of Rochester, Rochester, New York 14627

Received 18 November 2004/ Returned for modification 13 January 2005/ Accepted 16 February 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In Tetrahymena thermophila, highly phosphorylated histone H1 of growing cells becomes partially dephosphorylated when cells are starved in preparation for conjugation. To determine the effects of H1 phosphorylation on gene expression, PCR-based subtractive hybridization was used to clone cDNAs that were differentially expressed during starvation in two otherwise-isogenic strains differing only in their H1s. H1 in A5 mutant cells lacked phosphorylation, and H1 in E5 cells mimicked constitutive H1 phosphorylation. Sequences enriched in A5 cells included genes encoding proteases. Sequences enriched in E5 cells included genes encoding cdc2 kinase and a Ser/Thr kinase. These results indicate that H1 phosphorylation plays an important role in regulating the pattern of gene expression during the starvation response and that its role in transcription regulation can be either positive or negative. Treatment of starved cells with a phosphatase inhibitor caused CDC2 gene overexpression. Expression of the E5 version of H1 in starved cells containing endogenous, wild-type H1 caused the wild-type H1 to remain highly phosphorylated. These results argue that Cdc2p is the kinase that phosphorylates Tetrahymena H1, establish a positive feedback mechanism between H1 phosphorylation and CDC2 expression, and indicate that CDC2 gene expression is regulated by an H1 phosphatase.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The organization of nuclear DNA into nucleosomes by histones and the folding of nucleosomes into higher-order chromatin structures are generally believed to compact DNA and make it inaccessible to factors required for transcription (see references 30 and 34). There is now compelling evidence that chromatin structural modifications are actively involved in transcription regulation, and extensive physical and functional interactions among transcription factors, chromatin modifying activities, and nucleosomes are well documented (67). Linker histones (H1 and related proteins) have been strongly implicated in modulating chromatin structure and function at multiple levels (66). They are key components of the nucleosome, the most basic level of the hierarchy of chromatin structure in eukaryotes, where they provide extra protection to DNA wrapped around the core histone octamer, presumably by interacting with the DNA strand where it enters and exits the nucleosome core. Linker histones can affect nucleosome mobility (49) and spacing (6). They also stabilize the folding of nucleosome arrays and the association of folded arrays in vitro (10), probably by interacting with the core histone tails (11). However, in spite of intensive study, there is little agreement regarding the precise location of linker histones in nucleosomes (64) and little insight into the mechanisms by which they influence higher orders of chromatin structure.

Linker histones have been implicated in the regulation of transcription and were long thought to serve as global repressors (70). However, a number of studies in a variety of organisms have found that linker histones have highly specific effects on transcription in vivo. For example, gene disruption experiments in Tetrahymena thermophila showed that linker histone had little effect on the transcription of most genes analyzed but could regulate transcription of two genes either positively or negatively (58). A more extensive global analysis of linker histone disruption in Saccharomyces cerevisiae showed that most genes are indifferent to its presence. In yeast, H1 is responsible for the repression of only a few genes, while the expression of a sizable subset of genes actually decreases in its absence (32). In chicken tissue culture cells, deletion of all but one of the H1 genes caused changes in the pattern of proteins analyzed on two-dimensional gels without altering cell growth (61). Similar gene-specific effects of H1 depletion were also established during Xenopus laevis early embryonic development (59), and specific roles of some linker histone variants in germ line development have also been reported in Caenorhabditis elegans (35) and in tobacco (50). Recent studies in mammalian cells also argue that H1 subtypes can have specific effects on gene expression (1). The mechanisms underlying the effects of linker histones on gene expression are not known. Novel functions for H1 have also been recently described. In mice, a specific H1 isotype released from nuclei in X-ray-irradiated cells transmits an apoptotic signal to mitochondria (38). In yeast, H1 inhibits double-strand break repair by homologous recombination and represses homologous recombination-dependent maintenance of telomere length, and it is required for normal longevity in yeast (23) and in Ascobolus immersus (4).

Posttranslational phosphorylation by growth-associated kinases is a conserved feature of linker histones (reviewed in references 7 and 60). H1 is an in vitro substrate of the major cell cycle kinase whose catalytic subunit is Cdc2p (we will use the Schizosaccharomyces pombe nomenclature for this kinase, which also is known as growth-associated H1 kinase in older literature, p34, cdc2, or CDK1 and CDK2 in vertebrates, and cdc28p in S. cerevisiae). The sites phosphorylated on H1 in vivo resemble those phosphorylated by cdc2 kinase in vitro (42), and H1 hyperphosphorylation in mitosis was shown to be blocked at nonpermissive temperature in cultured mouse cells with temperature-sensitive mutations in a cdc2 gene (62). Thus, H1 is likely to be a substrate for this enzyme in vivo as well. Recent studies have also implicated CDK2 as another H1 kinase (5, 15).

The function of linker histone phosphorylation is poorly understood, even though it is well established that fluctuations in the levels and sites of phosphorylation change dramatically in development and during progression through the cell cycle. The correlation between H1 hyperphosphorylation and entry into mitosis in mammalian cells and in Physarum polycephalum originally led to the hypothesis that H1 phosphorylation triggers mitotic chromosome condensation (8). This view was supported by observations that addition of cdc2 kinase causes premature condensation of chromatin in different cell types (reviewed in references 37 and 66) and that inhibition of intracellular H1 kinase activity causes partial chromosome decondensation (63). However, this view was challenged by observations that H1 phosphorylation and mitosis were uncoupled in several systems, including the amitotic macronucleus of Tetrahymena, the terminally differentiated nuclei of avian erythrocytes, and sea urchin spermatids (reviewed in references 51 and 64). Furthermore, it was found that chromosome condensation induced by fostriecin did not require H1 hyperphosphorylation or cdc2 kinase activity (29). Chromosome condensation also can be observed in the absence of H1 linker histone in Xenopus mitotic extracts (48) and in Tetrahymena micronuclei (57).

Another proposed function for histone H1 phosphorylation is in the modulation of gene expression during different phases of the cell cycle and under different conditions of cell growth (51). Correlations between linker histone phosphorylation and changes in gene expression have been demonstrated in several systems. Transcription from the mouse mammary tumor virus promoter is positively correlated with the phosphorylation state of H1 (5, 39, 44), and high levels of H1 phosphorylation accompanied by changes in gene expression were observed when tissue culture cells were transformed with oncogenes such as ras and myc (12, 13) or when a tumor suppressor gene was deficient (33). In Tetrahymena, histone H1 is highly phosphorylated in the transcriptionally active macronucleus during vegetative growth, even though it divides amitotically, without condensing chromosomes (27). In addition, the level of H1 phosphorylation in Tetrahymena macronuclei changes dramatically in different developmental states and in response to different physiological conditions. In this organism, H1 is hyperphosphorylated during prezygotic stages of conjugation (54) and in response to heat shock (26). Conversely, it is largely dephosphorylated after prolonged starvation (2) and during macronuclear elimination at later stages of conjugation (54). Changes in H1 phosphorylation during these stages of conjugation cannot be related to cell cycle progression or DNA replication since, under these conditions, cell division is arrested and macronuclei do not undergo any significant DNA replication (18). Thus, it is more likely that these changes in the level of H1 phosphorylation are related to changes in gene expression.

Our previous studies identified the phosphorylation sites on Tetrahymena H1 (47) and, using two H1 mutant cell lines whose HHO1 genes (encoding wild-type H1) were replaced with HHO1 mutated to mimic either constitutively hyperphosphorylated H1 (E5) or constitutively unphosphorylated H1 (A5), showed that H1 phosphorylation could regulate the expression of two previously identified genes, ngoA and CYP1a (previously referred to as CYP1) (22). CYP1a, whose induced expression during starvation requires that H1 be dephosphorylated, encodes a cysteine protease and is a member of a large multigene family. ngoA is a gene of unknown function, does not appear to encode a protein, and has no known homologues (unpublished observations). In addition, ngoA responds to increased phosphorylation of H1 only by being expressed weakly in growing cells and is unresponsive to the H1 phosphorylation state in starved cells, where it is strongly expressed (22). These two genes were used as reporters in mutational analyses of how H1 phosphorylation regulated their expression. Phosphorylation of linker histone H1 was shown to function by creating a "charge patch" (21) which could be placed anywhere in the molecule without changing its effects on gene expression as long as the charges were clustered (20). Additional evidence indicating that H1 phosphorylation increased the rate of H1 dissociation from chromatin (19) provided a possible mechanism by which this modification regulates gene expression, and similar results have been obtained in mammalian cells (15).

The two genes, initially selected because they are inducible during starvation, are not highly informative in understanding the physiological role of H1 phosphorylation in Tetrahymena. We wished to identify additional genes whose expression is affected by H1 phosphorylation to understand the biological significance of changes in the H1 phosphorylation states and to be used as reporters for more detailed analyses. In this study we have compared the gene expression patterns in two starved cell lines, each containing one of the two previously used H1 mutations that either mimic unphosphorylated (A5) or hyperphosphorylated (E5) H1. Because starvation in Tetrahymena is accompanied by large-scale dephosphorylation of H1, we expected this comparison to identify genes whose regulation during starvation is dependent on a change in H1 phosphorylation. Suppression subtractive hybridization was used to directly identify such genes. This method combines subtractive hybridization with suppression PCR to generate a population of PCR fragments enriched for sequences from genes that are differentially expressed (31, 40, 65). cDNAs derived from mRNAs that were preferentially expressed in starved A5 cells were recovered after subtraction with cDNAs derived from starved E5 cells (forward subtraction). Conversely, cDNAs corresponding to mRNAs that were preferentially expressed in starved E5 cells were obtained after subtraction with cDNAs from starved A5 cells (reverse subtraction). These enriched sequences from both forward and reverse subtraction were then amplified and constructed into subtractive cDNA libraries. Partial characterization of these libraries provides evidence that H1 (de)phosphorylation is actively involved in the physiologically relevant shift of expression of a subset of genes during starvation. Surprisingly, one of the genes whose expression was induced in E5 mutant cells encoded a cdc2 kinase. Additional studies revealed a positive feedback loop between H1 phosphorylation and cdc2 kinase expression that is regulated by a phosphatase during the starvation response and provided evidence that H1 is an in vivo substrate for cdc2 kinase in Tetrahymena. A model is presented describing the role of H1 phosphorylation state in regulation of the growth state in Tetrahymena.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of total RNA and poly(A)+ RNA. Total RNA was isolated with TRIzol reagent (Invitrogen) from 12-hour-starved A5 and E5 cells, respectively. Two milligrams of total RNA was isolated from 200 ml of cells. Poly(A)+ RNAs were isolated from about 1.5 mg total RNA using an Oligotex mRNA purification kit (QIAGEN), yielding about of 30 µg poly(A)+ RNA.

cDNA subtraction was performed with the Clontech PCR-Select cDNA subtraction kit (Clontech Laboratories Inc.) as described by the manufacturer with the following changes. (i) To test the ligation efficiency of adapters 1 and 2R to A5 and E5 cDNA samples, primers HHT3' and HHT5' were used to amplify the HHT3 sequence. HHT3 encodes the message for histone H3 that is expressed in starved cells. The primer sequences were as follows: HHT3', 5'-GATGCAAGCTGCATTCCC-3', and HHT5', 5'-GGTGATTCCTTTGCTATA-3'. (ii) The conditions of the primary PCR after hybridization were changed to predwell at 94°C for 1 min and 35 cycles at 94°C for 15 seconds, 66°C for 30 seconds, and 72°C for 1.5 min. (iii) The secondary PCRs were performed with 2 µl of 1:10-diluted primary PCR products as templates in a 50-µl reaction mixture. Predwell was at 94°C for 1 minute followed by 25 cycles of PCRs at 94°C for 15 seconds, 68°C for 30 seconds, and 72°C for 1.5 min.

Construction of the subtractive cDNA library. Products from the secondary PCR were digested with RsaI restriction enzyme to generate blunt-end DNA fragments. The treated DNA fragments were then ligated into SmaI-digested pBluescript KS vector (Stratagene) and transformed in to Escherichia coli XL1-Blue competent cells. The inserts were cut out with HindIII and XbaI double digestion.

Cell and culture conditions. Wild-type T. thermophila strain CU428 mpr1-1/mpr1-1 (MPR1, mp-s, VII) was kindly provided by P. J. Bruns (Cornell University). Cells were grown in SPP medium (28) containing 1% Proteose Peptone. For starvation, cells were washed and resuspended in 10 mM Tris (pH 7.4) at 30°C without shaking for the indicated times.

Phosphatase inhibitor treatment. Concentrations of 0, 75, 150, and 300 nM okadaic acid (Sigma) were added to Tetrahymena wild-type cells during starvation. After a 24-hour treatment, samples were then split in half for either perchloric acid (PCA) extraction of H1 (47) or RNA isolation.

Northern blot analysis. RNA was isolated from growing or starved cells with TRIzol (Life Technologies). RNA was electrophoresed in 2.2 M formaldehyde-1.2% agarose gels, blotted, and hybridized (3). [{alpha}-32P]dATP-labeled, randomly primed probes were synthesized as follows: sequences cloned by subtractive hybridization were obtained from the cloned cDNA fragments released by digestion with HindIII and XbaI. The ngoA probe was a 1.1-kb PstI fragment from pC5.5 (46). The CDC2 probe was the cloned cDNA fragment from the CDC2 gene released by HindIII and XbaI or a PCR product amplified from Tetrahymena genomic DNA by primers CDC 1646 (AATAAATAATCTGACAGTAAAAATGG) and CDC 2225 (TTGAGGCTTCAAATCTCTATGAAG). The probe for rRNA was a 2-kb HindIII fragment from pBS26S encoding the Tetrahymena 26S rRNA (24). The HHO1 probe was obtained by PCR using the HHO1/neo construct (22) as template. The RPL21 probe was a PCR product amplified from Tetrahymena genomic DNA by primers L21 FW (AAGTTGGTTATCAACTGTTGCGTT) and L21 RV (CCCAGAAAGTTCCTGCTGCAT). Hybridizations were done at 42°C in 50% formamide, 5x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 1x sped (0.1% Ficoll, 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 6 mM sodium dodecyl sulfate [SDS], 2 mM sodium pyrophosphate, 2 mM EDTA), 1% SDS, and 100 µg/ml salmon sperm DNA. Northern blots were quantified using a phosphorimager (Molecular Dynamics).

Chromatin immunoprecipitation. Chromatin was immunoprecipitated as described by Dedon et al. (16) and Kuo and Allis (41). Fifty-milliliter aliquots of cultures (2 x105 cells/ml) of log-phase cells or cells starved in 10 mM Tris for 24 h were fixed with 1% formaldehyde at room temperature for 3 min. Cells were washed and then sonicated in 2% SDS buffer containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml leupeptin, and 0.7 µg/ml pepstatin A) to produce 500- to 1,000-bp fragments. The solubilized chromatin was diluted to 0.1% SDS in buffer containing 500 mM NaCl, and 1/10 was saved as the input sample. The remainder was mixed with 5 µl of anti-phosphorylated H1 antiserum (45) overnight at 4°C. Beads containing protein A (RepliGen) were added, and samples were incubated at 4°C for 2 to 3 h. Beads were washed, bound chromatin was eluted, and cross-links were reversed by incubation at 65°C overnight. The solubilized chromatin was ethanol precipitated, and DNA was isolated by treatment with RNase A, proteinase K, and phenol-chloroform extraction. Purified DNA was ethanol precipitated, dissolved in deionized distilled H2O, and used as template in quantitative multiplex PCR. Aliquots of 50 µl from PCR mixtures containing 3 mM Mg2+, 0.2 mM deoxynucleoside triphosphates, and 1.5 U Taq were treated at 94°C for 2 min and then subjected to 38 cycles at 94°C for 30 s, 50°C for 45 s, and 68°C for 39 s, followed by 68°C for 10 min. Template amounts were adjusted to produce exponential amplification to allow quantification.

Primers used to amplify the CDC2 539-bp fragment were CDK 1130 down (5'-ATCAAATATATTTATTAGTAACCAC-3') and CDK 5'f EcoRI (5'-AGTCCGGAATTCTTTTACTGTCAGATTATTTATTTGC-3'). Primers used to amplify the GTU1 280-bp fragment were GTU C13AL (5'-CTT GGCCGACTTAAAGTGTAATGATATCTCTAGGC-3') and GTU 521 (5'-AATGTGAGGAGTGAGTGAG).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
H1 dephosphorylation is required for expression of protease-encoding genes during starvation. The PCR-based subtractive cloning strategy yielded clones with cDNA insert sizes ranging from 100 bp to ~1 kbp from the forward subtraction (A5-E5). Eleven clones with different insert sizes were examined by Northern blot analysis using poly(A)+ mRNA isolated from A5 and E5 starved cells. All eleven were derived from genes that were expressed more highly in A5 cells than in E5 cells (Fig. 1A). Expression of these genes is likely to require the dephosphorylation of H1 that occurs during starvation.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Northern blot analyses of poly(A)+ RNAs isolated from 12-hour-starved A5 and E5 cells and probed with sequences cloned by subtractive hybridization. A. Blots were probed with 11 clones generated from the A5-E5 subtraction that were differentially expressed in these two strains. As a loading control, the same blots were then hybridized with a probe for the ngoA gene, whose starvation-induced expression is unaffected by the H1 phosphorylation state of H1 (22). See Table 1 for descriptions of the numbered clones. B. Blots probed with clones generated from the E5-A5 subtraction. Methods were the same as for panel A. See Table 2 for descriptions of the numbered clones.

 
Sequence analyses (Table 1) revealed that three of the clones belonged to the CYP1 gene family. One of these was homologous to the CYP1a gene encoding a cysteine protease (36) that had previously been characterized as a differentially expressed gene in the two H1 phosphorylation mutants (22). Cloning this sequence from the A5-E5 subtraction served as an internal control, indicating the validity of the method. Two other cDNA sequences, CYP1b and CYP1c, identified new members of the CYP1 gene family that are highly similar to CYP1a (71% and 73% identity, respectively). Another cDNA clone was >50% identical to cathepsin B-like cysteine proteases in human, mouse, and C. elegans (14, 43). No homologues were found for the other clones using a BLAST search, indicating they might encode novel genes.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Summary of cDNA clones generated from the A5 strain by subtractive hybridization

 
H1 dephosphorylation is important for down-regulation of a gene encoding cdc2 kinase. Using the reverse subtraction (E5-A5), cDNA derived from messages that are more abundant in E5 cells than in A5 cells was cloned. Seven clones with different insert sizes were sequenced (Table 2). All were shown by Northern blot analysis to be more highly expressed in starved E5 cells than starved A5 cells (Fig. 1B). Sequence analysis showed that clone 94 was a novel Tetrahymena surface protein, belonging to the j-immobilization antigen family (17). Clone 100 was similar to a transcription-activating factor in tobacco (25). Interestingly, two clones encoded highly conserved kinases. Clone 101 encodes a member of the protein serine/threonine kinase family (>36% identity and >58% similarity), and clone 97 is highly homologous (>70% identity and >80% similarity) to the cdc2 kinase catalytic subunit, the major cell cycle kinase. These genes are normally turned off in wild-type cells after 12 h of starvation (data not shown). Cloning these genes from the E5-A5 subtraction argues that H1 dephosphorylation is required for their down-regulation during starvation.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Summary of cDNA clones generated from the E5 strain by subtractive hybridization

 
Okadaic acid treatment increases expression of the CDC2 gene during starvation. The observation of increased expression of the CDC2 gene in starved Tetrahymena cells that had a mutation that mimicked constitutively phosphorylated H1 (E5) was surprising, since cdc2 is generally thought to be a constitutively expressed catalytic subunit whose kinase activity is regulated by cyclins. Mammalian cdc2 kinase has been shown to phosphorylate Tetrahymena H1 in vitro at sites that are similar to the ones phosphorylated in vivo (53). Thus, there could be a positive feedback loop between H1 phosphorylation and expression of the gene encoding the cdc2 kinase that phosphorylates it in vivo. To rule out the possibility that the result was an artifact owing to the use of a mutant (E5) form of H1 and to obtain additional evidence for this putative feedback loop, we analyzed the effects of a phosphatase inhibitor on CDC2 expression in starved cells. We reasoned that, if H1 were phosphorylated by cdc2 kinase and phosphorylation of H1 positively regulated CDC2 gene expression, then the phosphorylation state of H1 and the expression of CDC2 would both be increased by treatment of starved cells with a phosphatase inhibitor. We used okadaic acid (OA) (68) to inhibit the dephosphorylation of H1 when wild-type Tetrahymena cells were starved. OA treatment inhibited H1 dephosphorylation even after 24-hour starvation (Fig. 2A). Northern blot analyses of RNA isolated from the same cells showed that CDC2 expression also increased with increasing concentrations of OA (Fig. 2B). The effect of OA on the expression of CDC2 was not due to a general effect on transcription, since the expression of ngoA, a starvation-induced gene previously shown to be unaffected by the phosphorylation state of H1 in starved cells, was not affected by OA treatment (Fig. 2B).



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 2. Okadaic acid treatment of starved Tetrahymena cells results in H1 hyperphosphorylation and increased CDC2 gene expression. A. H1 was extracted with PCA from cells starved for 24 h in the presence of the indicated concentrations of okadaic acid (OA) and was analyzed on 12% SDS-polyacrylamide gel electrophoresis. H1 extracted from wild-type growing cells (G) without OA treatment was used as control. Phosphorylation has been shown to retard the mobility of Tetrahymena H1 in SDS gels (26). Arrows indicate more (top) and less (bottom) phosphorylated H1. B. Northern blot analysis of RNAs extracted from cells treated as in panel A and probed with the cloned cDNA fragment from the CDC2 gene. A probe for the ngoA gene, whose starvation-induced expression is known to be unaffected by phosphorylation state, was used to show that the effect of OA on CDC2 expression is gene specific. A probe for 26S rRNA was used as a loading control. The level of CDC2 expression at different drug concentrations relative to that of growing cells is shown at the bottom.

 
Overexpression of E5 H1 results in the hyperphosphorylation of endogenous wild-type H1. Both the subtractive hybridization results and the OA treatment results were consistent with the hypothesis that expression of the CDC2 gene is positively regulated by H1 phosphorylation. We wanted to determine whether the H1 phosphorylation-induced expression of CDC2 actually resulted in increased activity of cdc2 kinase on H1 in vivo. We reasoned that, if overexpression of the CDC2 gene resulted in increased activity and if H1 were itself phosphorylated by cdc2 kinase, then overexpression of the E5 mutation (mimicking phosphorylated H1) in a starved cell that contains endogenous H1 should result in the induced phosphorylation of the wild-type H1, which normally is dephosphorylated during starvation. To test this hypothesis, we created a strain in which a mutated HHO1 gene, encoding the E5 H1 mutation, can be expressed by an inducible promoter. A hemagglutinin (HA)-tagged E5 version of the HHO1 gene was placed under the control of the cadmium-inducible Tetrahymena metallothionein (MTT1) promoter (56) at the endogenous MTT1 locus (Fig. 3A). Successful creation of the inducible E5 strain (MTT:E5-HA) was demonstrated by Northern blot analyses showing that HHO1 mRNA was only detectable in 24-h-starved cells when cadmium was added (Fig. 3B).



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3. Overexpression of E5-H1 from a mutated HHO1 gene in the MTT1 locus induces hyperphosphorylation of endogenous H1 and expression of CDC2. A. Diagram of the genomic MTT1 locus before and after gene replacement to produce the MTT:E5-HA mutant strain. The MTT1 coding sequence was replaced by a mutated HHO1 gene sequence encoding an HA-tagged E5 H1 that mimics constitutively phosphorylated H1. A neo2 cassette was inserted into the 5'-flanking sequence as a selectable marker. B. Mutated H1s were overexpressed in MTT:E5-HA mutant cells. Cells were starved for 24 h and then were treated with or without Cd2+ (0.06 µg/ml) for 1 h. Total RNA was isolated and analyzed in Northern blot assays using HHO1 sequence as probe. HHO1 mRNA was detected only in the MTT:E5-HA strain in the presence of cadmium. C. Overexpression of E5 H1 resulted in hyperphosphorylation of endogenous wild-type H1. PCA-soluble proteins were extracted from wild-type growing cells, 24-h-starved wild-type cells, and 24-h-starved MTT:E5-HA cells with (+) or without (-) cadmium treatment. The samples were then separated on a 15% acid-urea gel. As expected, the HA-tagged mutated H1 migrates more slowly on the gel than the endogenous wild-type H1 and does not display any electrophoretic heterogeneity. The endogenous H1 is separated into distinct isoforms shown previously (26) to be the faster-migrating unphosphorylated H1 and its slower-migrating phosphorylated isoforms. D. Expression of the CDC2 gene is induced in cells expressing E5 HA. Wild-type and MTT:E5-HA cells were grown to 2 x105 cell/ml, washed once, and starved in 10 mM Tris (pH 7.5) for 24 h. Cells were then sampled (0 h) or treated with Cd2+ (0.06 µg/ml) for 1 h. Total RNA was isolated and analyzed on Northern blots probed sequentially with CDC2 or ribosomal protein RPL21 gene sequences. Messages were detected by phosphorimaging and quantified. The ratio of the CDC2 message to RPL21 message in the Cd2+-treated cells was determined relative to that in the cells without Cd2+ treatment. The increase in this ratio upon cadmium induction is indicated beneath the blot.

 
H1s isolated from wild-type cells and from MTT:E5-HA cells with or without cadmium were analyzed on acid urea gels, which separate different isoforms of H1 based on the number of phosphates they contain (Fig. 3C). These gels also clearly distinguish the E5 H1 from all of the isoforms of the endogenous wild-type H1. Overexpression of the mutant E5 H1 resulted in the phosphorylation of endogenous wild-type H1 to a level similar to that in wild-type growing cells. This effect is not due to nonspecific effects of cadmium, since the same amount of cadmium had no such effect on wild-type cells (Fig. 3C). Note that the small amount of E5 H1+HA protein in the MTT:E5-HA cells without cadmium probably reflected accumulation due to low levels of leaky expression from the MTT1 locus during growth of the cells prior to starvation (55). As expected given that CDC2 had been identified by the subtractive hybridization screen and confirmed (Fig. 1B, clone 97) as a gene whose expression was induced by the E5-H1, expression of the CDC2 gene was also increased in cells in which expression of E5-HA had been induced (Fig. 3D). The observations that phosphorylated H1 induces the expression of the CDC2 gene in starved Tetrahymena and that this increased expression causes increased phosphorylation of wild-type H1 argue strongly that the induction of CDC2 expression results in increased cdc2 kinase activity and that H1 is a substrate of cdc2 kinase in vivo.

The phosphorylation state of H1 upstream of CDC2 is different in growing and starved cells. The observations that CDC2 expression is positively regulated by H1 phosphorylation and that CDC2 expression and H1 phosphorylation levels both decrease during starvation suggest that the phosphorylation of H1 associated with the CDC2 promoter changes during starvation. To test this, we did chromatin immunoprecipitation analyses of a 539-bp region upstream of CDC2 (Fig. 4A) in growing and starved cells using an antibody reported to be specific for phosphorylated Tetrahymena H1 (45). The CDC2 5' region was immunoprecipitated by anti-phosphorylated H1 antibody when chromatin from growing cells was used, but it was not detected in chromatin from starved cells (Fig. 4B). These observations demonstrate that phosphorylated H1 is associated with the CDC2 promoter region in growing cells. Additional studies are required to determine whether the failure to detect phosphorylated H1 in this region in starved cells is due to dephosphorylation of H1, a loss of H1, or to interference from other proteins. Clearly, dephosphorylation of H1 is most consistent with our previous observations that CDC2 expression is regulated by H1 phosphorylation.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Phosphorylated H1 localizes upstream of the CDC2 coding region in log-phase cells but not in starved cells. Chromatin immunoprecipitation was done on log-phase or 24-h-starved wild-type cells using anti-phosphorylated H1 antibody. Input DNA and immunoprecipitated (bound) DNA were purified and used in multiplex PCR to amplify a 539-bp fragment immediately upstream of the CDC2 coding region (A) and a 280-bp fragment immediately upstream of the GTU1 coding region. The latter was used as a control, since GTU1 gene expression is not affected by H1 phosphorylation. (B) PCR products from the bound or input DNA analyzed on a 3% agarose gel and stained with ethidium bromide.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The major conclusions from these experiments are that (i) in Tetrahymena, linker histone phosphorylation regulates the expression of a number of specific genes either positively or negatively; (ii) the nature of the genes whose expression is altered indicates that H1 dephosphorylation is involved in a physiologically meaningful way in regulating the changing patterns of expression that accompany starvation; (iii) linker histone phosphorylation positively regulates the expression of a cdc2 kinase that phosphorylates H1 via a positive feedback mechanism; (iv) the phosphorylation state of H1 during starvation is controlled by histone phosphatase activity; and (v) this regulatory loop is likely to be important for growth arrest in response to starvation and for rapid resumption of growth after refeeding.

H1 phosphorylation can regulate specific gene expression either positively or negatively in Tetrahymena during starvation. Previous studies showed that H1 dephosphorylation was required for the starvation-induced activation of the CYP1a gene. Here we used two H1 phosphorylation mutants, A5 and E5, and PCR-based subtractive hybridization to identify additional genes whose expression depends on the phosphorylation state of H1. These strains are isogenic except for the mutations at the H1 phosphorylation sites. Forward subtraction (A5-E5) identified genes whose activation depends on H1 dephosphorylation. Reverse subtraction (E5-A5) identified genes whose down-regulation depends on H1 dephosphorylation. These findings support the view that H1 phosphorylation plays a major role in the regulation of a number of genes, both positively and negatively (22), during the starvation of Tetrahymena. Since many of the newly cloned genes are single copy (data not shown), they should be useful as reporter genes that enable structural analyses of chromatin in their promoter regions. A positive correlation between H1 phosphorylation and transcription has also been demonstrated for the mouse mammary tumor virus promoter in mammalian cells (5, 39, 44). However, the dependence of the expression of some genes on H1 dephosphorylation has not been described in any other system.

H1 dephosphorylation plays a major role in the physiological regulation of gene expression during starvation. We analyzed 11 cloned sequences from the A5 subtraction library and 7 from the E5 subtraction library. Consistent with the fact that starvation in Tetrahymena cells is accompanied by a large decrease in the protein content per cell (9), a number of the cDNAs specific to starved A5 cells encoded proteins with protease activities (Table 1). These genes were preferentially expressed in starved wild-type Tetrahymena cells when H1 was dephosphorylated compared to growing cells (data not shown). The finding that it is required for the activation of these genes strongly suggests that H1 dephosphorylation plays an important role in the physiological regulation of genes required by starving cells. In contrast, one of the genes obtained from the reverse (E5-A5) subtraction encoded a protein homologous to the catalytic subunit of the major cell cycle kinase (Table 2). Northern blot analyses confirmed that the CDC2 mRNA remained at a high level in the starved E5 strain but was reduced in the starved A5 strain (Fig. 1B). A positive role for H1 phosphorylation in the regulation of the CDC2 gene and cdc2 kinase activity was also supported by the results of okadaic acid treatment of wild-type cells and the phosphorylation of wild-type H1 when expression of E5 H1 was induced in starved cells. These observations suggest that H1 dephosphorylation is required for reducing the expression of this important growth-related gene during starvation of Tetrahymena cells. We also cloned other genes whose expression was maintained in E5 starved cells, arguing that H1 dephosphorylation is also likely to reduce the expression of other genes as well.

The results of these experiments describing the role of H1 dephosphorylation during starvation and refeeding are summarized in Fig. 5. When cells are shifted from growth to starvation, the phosphorylation state of H1 is reduced. This reduction must be largely due to enhanced phosphatase activity, since it can be prevented by treatment with okadaic acid. Dephosphorylation of H1, on the one hand, down-regulates the expression of CDC2, which also is likely to down-regulate the expression of many other cell cycle-dependent genes. On the other hand, dephosphorylation of H1 also up-regulates the expression of genes encoding proteases, which are likely needed to provide the essential amino acids required to synthesize new proteins for conjugation and/or for prolonged survival in the absence of growth. We conclude that H1 dephosphorylation is important for both positive and negative regulation of genes during starvation. It seems likely that changes in Tetrahymena H1 phosphorylation that have been observed in other physiological states (conjugation, heat shock) are also associated with physiological changes in gene expression.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 5. Diagrammatic summary of the role of H1 phosphorylation in regulation of gene expression in the transition between growing and starved Tetrahymena cells. A. When growing cells are starved, H1 is initially dephosphorylated in response to a starvation-induced increase in H1 protein phosphatase activity. Dephosphorylation of H1 has two effects. First, it inhibits the expression of the CDC2 gene, which encodes the major cell cycle kinase. Since linker histone H1 is one of the in vivo substrates of cdc2 kinase in Tetrahymena, the rate of H1 phosphorylation is reduced, leading to further reduction in phosphorylated H1 and CDC2 expression, accelerating the transition to nongrowth conditions. Reduced CDC2 expression ultimately leads to cell cycle arrest. The second effect of dephosphorylated H1 is induction of the expression of starvation-specific genes, including those encoding proteases and probably other genes required to maintain viability and/or prepare for conjugation in starved Tetrahymena cells. B. When starved cells are fed, we propose that a reduction in phosphatase activity reverses the pathways seen in panel A. Again, the feedback loop between the H1 phosphorylation state and CDC2 gene expression should accelerate the return to growth.

 
H1 phosphorylation and cdc2 kinase form a positive feedback loop that can facilitate the transition between different growth states. cdc2 kinase has long been considered to be the kinase that phosphorylates H1 in vivo (7, 52), but in vivo evidence supporting this contention is sparse. Recent studies have argued that the cdc2-related CDK2 kinase is responsible for gene-specific H1 phosphorylation in mammalian cells (5, 15). In Tetrahymena H1 the five sites that are phosphorylated in growing cells are tightly clustered within a span of 20 residues (47). Three out of the five sites are canonical, proline-directed (S/TP) cdc2 kinase consensus sites. The two noncanonical phosphorylation sites are flanked by canonical sites, and the pattern of phosphopeptides obtained from H1 isolated from growing Tetrahymena cells suggests a hierarchy of phosphorylation in which one of the canonical sites must be phosphorylated before the two noncanonical sites (47). Also, Tetrahymena H1 is an in vitro substrate for both mammalian cdc2 kinase and a Tetrahymena cdc2 kinase-like activity, and the phosphorylated peptides produced by both enzymes are highly similar to each other and to the tryptic peptides produced from in vivo-phosphorylated Tetrahymena H1 (52). These observations, together with our demonstration that the phosphorylation level of H1 likely regulates the expression of CDC2 and that overexpression of a mutant form of H1 that mimics phosphorylation causes both overexpression of CDC2 and phosphorylation of endogenous H1 in starved cells, argue strongly that, in vivo, cdc2 kinase is required for the phosphorylation of most, if not all, of the phosphorylated sites in Tetrahymena H1.

It is generally accepted that, in most growing cells, cdc2-related kinases are inactive catalytic subunits whose activities are regulated by periodic accumulation and destruction of their cyclin-activating subunits, by inhibitory proteins, and by posttranslational modifications. Thus, the existence of a positive feedback loop between H1 phosphorylation and CDC2 expression, and also the observation that this regulation results in the phosphorylation of H1, is surprising. This finding suggests a mechanism by which the phosphorylation state of H1 can rapidly regulate the amount of cdc2 kinase when cells change their growth state (e.g., from growth to starvation and vice versa). Interestingly, the critical regulator in this mechanism is likely to be an H1 phosphatase and not the cdc2 kinase itself. We envision that, during starvation, increased phosphatase activity could decrease the level of phosphorylated H1. Once this occurs, the increase in dephosphorylated H1 would result in decreased expression of CDC2 which would, in turn, further reduce the level of H1 phosphorylation. Such a feedback regulation would result in a rapid withdrawal from the cell cycle during starvation. Similarly, reductions in H1 phosphatase activity in response to nutrient replenishment in starved cells would result in a rapid restoration of CDC2 expression. This mechanism clearly differs from the conserved, cyclin-dependent phosphorylation cascade that regulates cdc2 kinase activity in growing eukaryotic cells. The possibility that growing Tetrahymena cells also have a novel mechanism for regulating cdc2 kinase activity seems unlikely, inasmuch as a related ciliate, Paramecium tetraurelia, contains at least two genes encoding cyclins involved in cell cycle regulation and PCR analyses suggest that similar genes are present in Tetrahymena (69), and a number of cyclin-related sequences can be found in the recently released sequence of the Tetrahymena macronuclear genome (http://tigrblast.tigr.org/er-BLAST/index.cgi?project=ttg).


    ACKNOWLEDGMENTS
 
This work was supported by grant GM21793 from the National Institutes of Health.

We thank C. David Allis (Rockefeller University) for the anti-phosphorylated H1 antiserum.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, University of Rochester, Rochester, NY 14627. Phone: (585) 275-6988. Fax: (585) 275-2070. E-mail: goro{at}mail.rochester.edu. Back

{dagger} Present address: The Rockefeller University, New York, NY 10021. Back

{ddagger} Y.D. and X.S. were equal contributors to this paper. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alami, R., Y. Fan, S. Pack, T. M. Sonbuchner, A. Besse, O. Lin, J. M. Greally, A. I. Skoultchi, and E. E. Bouhassira. 2003. Mammalian linker-histone subtypes differentially affect gene expression in vivo. Proc. Natl. Acad. Sci. USA 100:5920-5925.[Abstract/Free Full Text]

2. Allis, C. D., and M. A. Gorovsky. 1981. Histone phosphorylation in macro- and micronuclei of Tetrahymena thermophila. Biochemistry 20:3828-3833.[CrossRef][Medline]

3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1988. Current protocols in molecular biology. Wiley Interscience, New York, N.Y.

4. Barra, J. L., L. Rhounim, J. L. Rossignol, and G. Faugeron. 1999. Histone H1 is dispensable for methylation-associated gene silencing in Ascobolus immersus and essential for long life span. Mol. Cell. Biol. 20:61-69.

5. Bhattacharjee, R. N., G. C. Banks, K. W. Trotter, H. L. Lee, and T. K. Archer. 2001. Histone H1 phosphorylation by Cdk2 selectively modulates mouse mammary tumor virus transcription through chromatin remodeling. Mol. Cell. Biol. 21:5417-5425.[Abstract/Free Full Text]

6. Blank, T. A., and P. B. Becker. 1995. Electrostatic mechanism of nucleosome spacing. J. Mol. Biol. 252:305-313.[CrossRef][Medline]

7. Bradbury, E. M. 1992. Reversible histone modifications and the chromosome cell cycle. Bioessays 14:9-16.[CrossRef][Medline]

8. Bradbury, E. M., R. J. Inglis, H. R. Matthews, and T. A. Langan. 1974. Molecular basis of control of mitotic cell division in eukaryotes. Nature 249:553-556.[CrossRef][Medline]

9. Calzone, F. J. 1982. Ph.D. thesis. University of Rochester, Rochester, N.Y.

10. Carruthers, L. M., J. Bednar, C. L. Woodcock, and J. C. Hansen. 1998. Linker histones stabilize the intrinsic salt-dependent folding of nucleosomal arrays: mechanistic ramifications for higher-order chromatin folding. Biochemistry 37:14776-14787.[CrossRef][Medline]

11. Carruthers, L. M. and J. C. Hansen. 2000. The core histone N termini function independently of linker histones during chromatin condensation. J. Biol. Chem. 275:28246-28251.[Abstract/Free Full Text]

12. Chadee, D. N., C. D. Allis, J. A. Wright, and J. R. Davie. 1997. Histone H1b phosphorylation is dependent upon ongoing transcription and replication in normal and ras-transformed mouse fibroblasts. J. Biol. Chem. 272:8113-8116.[Abstract/Free Full Text]

13. Chadee, D. N., W. R. Taylor, R. A. Hurta, C. D. Allis, J. A. Wright, and J. R. Davie. 1995. Increased phosphorylation of histone H1 in mouse fibroblasts transformed with oncogenes or constitutively active mitogen-activated protein kinase kinase. J. Biol. Chem. 270:20098-20105.[Abstract/Free Full Text]

14. Chan, S. J., B. San Segundo, M. B. McCormick, and D. F. Steiner. 1986. Nucleotide and predicted amino acid sequences of cloned human and mouse preprocathepsin B cDNAs. Proc. Natl. Acad. Sci. USA 83:7721-7725.[Abstract/Free Full Text]

15. Contreras, A., T. K. Hale, D. L. Stenoien, J. M. Rosen, M. A. Mancini, and R. E. Herrera. 2003. The dynamic mobility of histone H1 is regulated by cyclin/CDK phosphorylation. Mol. Cell. Biol. 23:8626-8636.[Abstract/Free Full Text]

16. Dedon, P. C., J. A. Soults, C. D. Allis, and M. A. Gorovsky. 1991. A simplified formaldehyde fixation and immunoprecipitation technique for studying protein-DNA interactions. Anal. Biochem. 197:83-90.[CrossRef][Medline]

17. Doerder, F. P. 2000. Sequence and expression of the SerJ immobilization antigen gene of Tetrahymena thermophila regulated by dominant epistasis. Gene 257:319-326.[CrossRef][Medline]

18. Doerder, F. P., and L. E. DeBault. 1975. Cytofluorometric analysis of nuclear DNA during meiosis, fertilization and macronuclear development in the ciliate Tetrahymena pyriformis, Syngen 1. J. Cell Sci. 17:471-493.[Abstract]

19. Dou, Y., J. Bowen, Y. Liu, and M. A. Gorovsky. 2002. Phosphorylation and an ATP-dependent process increase the dynamic exchange of H1 in chromatin. J. Cell Biol. 158:1161-1170.[Abstract/Free Full Text]

20. Dou, Y., and M. A. Gorovsky. 2002. Regulation of transcription by H1 phosphorylation in Tetrahymena is position independent and requires clustered sites. Proc. Natl. Acad. Sci. USA 99:6142-6146.[Abstract/Free Full Text]

21. Dou, Y., and M. A. Gorovsky. 2000. Phosphorylation of linker histone H1 regulates gene expression in vivo by creating a charge patch. Mol. Cell 6:225-231.[CrossRef][Medline]

22. Dou, Y., C. A. Mizzen, M. Abrams, C. D. Allis, and M. A. Gorovsky. 1999. Phosphorylation of linker histone H1 regulates gene expression in vivo by mimicking H1 removal. Mol. Cell 4:641-647.[CrossRef][Medline]

23. Downs, J. A., E. Kosmidou, A. Morgan, and S. P. Jackson. 2003. Suppression of homologous recombination by the Saccharomyces cerevisiae linker histone. Mol. Cell 11:1685-1692.[CrossRef][Medline]

24. Engberg, J., and Nielsen, H. 1990. Complete sequence of the extrachromosomal rDNA molecule from the ciliate Tetrahymena thermophila strain B1868VII. Nucleic Acids Res. 18:6915-6919.[Abstract/Free Full Text]

25. Estruch, J. J., L. Crossland, and S. A. Goff. 1994. Plant activating sequences: positively charged peptides are functional as transcriptional activation domains. Nucleic Acids Res. 22:3983-3989.[Abstract/Free Full Text]

26. Glover, C. V. C., K. J. Vavra, S. D. Guttman, and M. A. Gorovsky. 1981. Heat shock and deciliation induce phosphorylation of histone H1 in Tetrahymena pyriformis. Cell 23:73-77.[CrossRef][Medline]

27. Gorovsky, M. A., J. B. Keevert, and G. L. Pleger. 1974. Histone F1 of Tetrahymena macronuclei. Unique electrophoretic properties and phosphorylation of F1 in an amitotic nucleus. J. Cell Biol. 61:134-145.[Abstract/Free Full Text]

28. Gorovsky, M. A., M.-C. Yao, J. B. Keevert, and G. L. Pleger. 1975. Isolation of micro- and macronuclei of Tetrahymena pyriformis. Methods Cell Biol. IX:311-327.

29. Guo, X. W., J. P. Th'ng, R. A. Swank, H. J. Anderson, C. Tudan, E. M. Bradbury, and M. Roberge. 1995. Chromosome condensation induced by fostriecin does not require p34cdc2 kinase activity and histone H1 hyperphosphorylation, but is associated with enhanced histone H2A and H3 phosphorylation. EMBO J. 14:976-985.[Medline]

30. Hansen, J. C. 2002. Conformational dynamics of the chromatin fiber in solution: determinants, mechanisms, and functions. Annu. Rev. Biophys. Biomol. Struct. 31:361-392.[CrossRef][Medline]

31. Hedrick, S. M., E. A. Nielsen, J. Kavaler, D. I. Cohen, and M. M. Davis. 1984. Sequence relationships between putative T-cell receptor polypeptides and immunoglobulins. Nature 308:153-158.[CrossRef][Medline]

32. Hellauer, K., E. Sirard, and B. Turcotte. 2001. Decreased expression of specific genes in yeast cells lacking histone H1. J. Biol. Chem. 276:13587-13592.[Abstract/Free Full Text]

33. Herrera, R. E., F. Chen, and R. A. Weinberg. 1996. Increased histone H1 phosphorylation and relaxed chromatin structure in Rb-deficient fibroblasts. Proc. Natl. Acad. Sci. USA 93:11510-11515.[Abstract/Free Full Text]

34. Horn, P. J., and C. L. Peterson. 2002. Molecular biology. Chromatin higher order folding—wrapping up transcription. Science 297:1824-1827.[Abstract/Free Full Text]

35. Jedrusik, M. A., and E. Schulze. 2001. A single histone H1 isoform (H1.1) is essential for chromatin silencing and germline development in Caenorhabditis elegans. Development 128:1069-1080.[Abstract]

36. Karrer, K. M., S. L. Peiffer, and M. E. DiTomas. 1993. Two distinct gene subfamilies within the family of cysteine protease genes. Proc. Natl. Acad. Sci. USA 90:3063-3067.[Abstract/Free Full Text]

37. Kishimoto, T. 1994. Cell reproduction: induction of M-phase events by cyclin-dependent cdc2 kinase. Int. J. Dev. Biol. 38:185-191.[Medline]

38. Konishi, A., S. Shimizu, J. Hirota, T. Takao, Y. Fan, Y. Matsuoka, L. Zhang, Y. Yoneda, Y. Fujii, A. I. Skoultchi, and Y. Tsujimoto. 2003. Involvement of histone H1.2 in apoptosis induced by DNA double-strand breaks. Cell 114:673-688.[CrossRef][Medline]

39. Koop, R., L. Di Croce, and M. Beato. 2003. Histone H1 enhances synergistic activation of the MMTV promoter in chromatin. EMBO J. 22:588-599.[CrossRef][Medline]

40. Kuang, W. W., D. A. Thompson, R. V. Hoch, and R. J. Weigel. 1998. Differential screening and suppression subtractive hybridization identified genes differentially expressed in an estrogen receptor-positive breast carcinoma cell line. Nucleic Acids Res. 26:1116-1123.[Abstract/Free Full Text]

41. Kuo, M. H., and C. D. Allis. 1999. In vivo cross-linking and immunoprecipitation for studying dynamic protein:DNA associations in a chromatin environment. Methods 19:425-433.[CrossRef][Medline]

42. Langan, T. A., J. Gautier, M. Lohka, R. Hollingsworth, S. Moreno, P. Nurse, J. Maller, and R. A. Sclafani. 1989. Mammalian growth-associated H1 histone kinase: a homolog of cdc2+/CDC28 protein kinases controlling mitotic entry in yeast and frog cells. Mol. Cell. Biol. 9:3860-3868.[Abstract/Free Full Text]

43. Larminie, C. G., and I. L. Johnstone. 1996. Isolation and characterization of four developmentally regulated cathepsin B-like cysteine protease genes from the nematode Caenorhabditis elegans. DNA Cell Biol. 15:75-82.[Medline]

44. Lee, H. L., and T. K. Archer. 1998. Prolonged glucocorticoid exposure dephosphorylates histone H1 and inactivates the MMTV promoter. EMBO J. 17:1454-1466.[CrossRef][Medline]

45. Lu, M. J., S. S. Mpoke, C. A. Dadd, and C. D. Allis. 1995. Phosphorylated and dephosphorylated linker histone H1 reside in distinct chromatin domains in Tetrahymena macronuclei. Mol. Biol. Cell 6:1077-1087.[Abstract]

46. Martindale, D. W., and P. J. Bruns. 1983. Cloning of abundant mRNA species present during conjugation of Tetrahymena thermophila: identification of mRNA species present exclusively during meiosis. Mol. Cell. Biol. 3:1857-1865.[Abstract/Free Full Text]

47. Mizzen, C. A., Y. Dou, Y. Liu, R. G. Cook, M. A. Gorovsky, and C. D. Allis. 1999. Identification and mutation of phosphorylation sites in a linker histone. Phosphorylation of macronuclear H1 is not essential for viability in Tetrahymena. J. Biol. Chem. 274:14533-14536.[Abstract/Free Full Text]

48. Ohsumi, K., C. Katagiri, and T. Kishimoto. 1993. Chromosome condensation in Xenopus mitotic extracts without histone H1. Science 262:2033-2035.[Abstract/Free Full Text]

49. Pennings, S., G. Meersseman, and E. M. Bradbury. 1994. Linker histones H1 and H5 prevent the mobility of positioned nucleosomes. Proc. Natl. Acad. Sci. USA 91:10275-10279.[Abstract/Free Full Text]

50. Prymakowska-Bosak, M., M. R. Przewloka, J. Iwkiewicz, S. Egierszdorff, M. Kuras, N. Chaubet, C. Gigot, S. Spiker, and A. Jerzmanowski. 1996. Histone H1 overexpressed to high level in tobacco affects certain developmental programs but has limited effect on basal cellular functions. Proc. Natl. Acad. Sci. USA 93:10250-10255.[Abstract/Free Full Text]

51. Roth, S. Y., and C. D. Allis. 1992. Chromatin condensation: does histone H1 dephosphorylation play a role? Trends Biochem. Sci. 17:93-98.[CrossRef][Medline]

52. Roth, S. Y., M. P. Collini, G. Draetta, D. Beach, and C. D. Allis. 1991. A cdc2-like kinase phosphorylates histone H1 in the amitotic macronucleus of Tetrahymena. EMBO J. 10:2069-2075.[Medline]

53. Roth, S. Y., I. G. Schulman, R. Richman, R. G. Cook, and C. D. Allis. 1988. Characterization of phosphorylation sites in histone H1 in the amitotic macronucleus of Tetrahymena during different physiological states. J. Cell Biol. 107:2473-2482.[Abstract/Free Full Text]

54. Schulman, I. G., R. G. Cook, R. Richman, and C. D. Allis. 1987. Tetrahymena contain two distinct and unusual high mobility group (HMG)-like proteins. J. Cell Biol. 104:1485-1494.[Abstract/Free Full Text]

55. Shang, Y., B. Li, and M. A. Gorovsky. 2002. Tetrahymena thermophila contains a conventional gamma-tubulin that is differentially required for the maintenance of different microtubule-organizing centers. J. Cell Biol. 158:1195-1206.[Free Full Text]

56. Shang, Y., X. Song, J. Bowen, J. Gao, J. Gaertig, and M. A. Gorovsky. 2002. A robust, inducible-repressible promoter greatly facilitates gene knockouts, conditional expression and overexpression of homologous and heterologous genes in Tetrahymena thermophila. Proc. Natl. Acad. Sci. USA 99:3734-3739.[Abstract/Free Full Text]

57. Shen, X., L. Yu, J. W. Weir, and M. A. Gorovsky. 1995. Linker histones are not essential and affect chromatin condensation in vivo. Cell 82:47-56.[CrossRef][Medline]

58. Shen, X. T., and M. A. Gorovsky. 1996. Linker histone H1 regulates specific gene expression but not global transcription in vivo. Cell 86:475-483.[CrossRef][Medline]

59. Steinbach, O. C., A. P. Wolffe, and R. A. W. Rupp. 1997. Somatic linker histones cause loss of mesodermal competence in Xenopus. Nature 389:395-399.[CrossRef][Medline]

60. Swank, R. A., J. P. H. Th'ng, X. W. Guo, J. Valdez, E. M. Bradbury, and L. R. Gurley. 1997. Four distinct cyclin-dependent kinases phosphorylate histone H1 at all of its growth-related phosphorylation sites. Biochemistry 36:13761-13768.[CrossRef][Medline]

61. Takami, Y., and T. Nakayama. 1997. A single copy of linker H1 genes is enough for proliferation of the DT40 chicken B cell line, and linker H1 variants participate in regulation of gene expression. Genes Cells 2:711-723.[Abstract]

62. Th'ng, J. P., P. S. Wright, J. Hamaguchi, M. G. Lee, C. J. Norbury, P. Nurse, and E. M. Bradbury. 1990. The FT210 cell line is a mouse G2 phase mutant with a temperature-sensitive CDC2 gene product. Cell 63:313-324.[CrossRef][Medline]

63. Th'ng, J. P. H., X.-W. Guo, R. A. Swank, H. A. Crissman, and E. M. Bradbury. 1994. Inhibition of histone phosphorylation by staurosporine leads to chromosome decondensation. J. Biol. Chem. 269:9568-9573.[Abstract/Free Full Text]

64. Travers, A. 1999. The location of the linker histone on the nucleosome. Trends Biochem. Sci. 24:4-7.[CrossRef][Medline]

65. Wang, Z., and D. D. Brown. 1991. A gene expression screen. Proc. Natl. Acad. Sci. USA 88:11505-11509.[Abstract/Free Full Text]

66. Wolffe, A. P., S. Khochbin, and S. Dimitrov. 1997. What do linker histones do in chromatin? Bioessays 19:249-255.[CrossRef][Medline]

67. Workman, J. L., and R. E. Kingston. 1998. Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu. Rev. Biochem. 67:545-579.[CrossRef][Medline]

68. Yamashita, K., H. Yasuda, J. Pines, K. Yasumoto, H. Nishitani, M. Ohtsubo, T. Hunter, T. Sugimura, and T. Nishimoto. 1990. Okadaic acid, a potent inhibitor of type 1 and type 2A protein phosphatases, activates cdc2/H1 kinase and transiently induces a premature mitosis-like state in BHK21 cells. EMBO J. 9:4331-4338.[Medline]

69. Zhang, H., S. M. Adl, and J. D. Berger. 1999. Two distinct classes of mitotic cyclin homologues, Cyc1 and Cyc2, are involved in cell cycle regulation in the ciliate Paramecium tetraurelia. J. Eukaryot. Microbiol. 6:585-596.

70. Zlatanova, J., and K. Van Holde. 1992. Histone H1 and transcription: still an enigma? J. Cell Sci. 103:889-895.[Free Full Text]


Molecular and Cellular Biology, May 2005, p. 3914-3922, Vol. 25, No. 10
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.10.3914-3922.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dou, Y.
Right arrow Articles by Gorovsky, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation