This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stella, M. C.
Right arrow Articles by Comoglio, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stella, M. C.
Right arrow Articles by Comoglio, P. M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, May 2005, p. 3982-3996, Vol. 25, No. 10
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.10.3982-3996.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Negative Feedback Regulation of Met-Dependent Invasive Growth by Notch

M. Cristina Stella,* Livio Trusolino, Selma Pennacchietti, and Paolo M. Comoglio

Division of Molecular Oncology, Institute for Cancer Research and Treatment (IRCC), University of Turin School of Medicine, Str. Prov. 142, Km. 3,95, 10060 Candiolo, Torino, Italy

Received 15 July 2004/ Returned for modification 8 October 2004/ Accepted 11 February 2005


arrow
ABSTRACT
 
The hepatocyte growth factor (HGF) receptor encoded by the Met oncogene controls a genetic program—known as "invasive growth"—responsible for several developmental processes and involved in cancer invasion and metastasis. This program functions through several regulatory gene products, as yet largely unknown, both upstream and downstream of Met. Here we show that activation of the Notch receptor results in transcriptional down-regulation of Met, suppression of HGF-dependent Ras signaling, and impairment of HGF-dependent cellular responses. In turn, Met activation leads to transcriptional induction of the Notch ligand Delta and the Notch effector HES-1, indicating that Met is able to self-tune its own protein levels and the ensuing biochemical and biological outputs through stimulation of the Notch pathway. By using branching morphogenesis of the tracheal system in Drosophila as a readout of invasive growth, we also show that exogenous expression of a constitutively active form of human Met induces enhanced sprouting of the tracheal tree, a phenotype that is further increased in embryos lacking Notch function. These results unravel an in-built mechanism of negative feedback regulation in which Met activation leads to transcriptional induction of Notch function, which in turn limits HGF activity through repression of the Met oncogene.


arrow
INTRODUCTION
 
The ability of cells to arrange into three-dimensional structures for shaping complex architectural patterns involves intricate genetic programs that are far from being elucidated. One of these programs is branching morphogenesis, the creation of a hierarchical organization of tubular networks starting from a relatively uniform group of cells. Successful implementation of such a process can be accomplished only through the coordinated and sequential execution of several events: first, cells dismantle lateral contacts and bud off from their primitive residency; then, they organize cord-like expansions that penetrate into the surrounding tissues and become resistant to the proapoptotic cues that are normally exerted on cells dislodged from their natural habitat; finally, cells differentiate and polarize to turn cords into hollow cylinders and proliferate to expand and ramify the nascent tubular plexus. From a conceptual point of view, branching morphogenesis represents the physiological paradigm of invasive growth, a multistep phenomenon that incorporates stimulation of cell multiplication, induction of a motile phenotype, and promotion of cell survival. Not surprisingly, the pathological counterpart of invasive growth is cancer progression and metastasis, which occur when neoplastic cells abandon the primary tumor mass and infiltrate the adjacent compartments and the vasculature as a prelude for colonization of distant organs (58).

Spatial and chronological orchestration of the various steps of invasive growth is optimally accomplished by a family of growth factors known as scatter factors, whose prototypic member is hepatocyte growth factor (HGF), together with their tyrosine kinase receptors, in particular, the HGF receptor encoded by the Met protooncogene. HGF induces various morphogenetic responses in epithelial cells deriving from different tissues when these are grown in three-dimensional gels, including formation of branching tubules in kidney, breast, and prostate epithelial cells (for a review, see reference 43), and it is a potent angiogenic factor that promotes remodeling of capillary networks (5). In vivo, HGF stimulates tubulogenesis in the liver and kidneys during organ regeneration and promotes differentiation of the ductal tree in the mammary glands during early pregnancy (24, 29, 36, 52, 65).

Although the role of HGF in the promotion of invasive growth is well documented and the intracellular signals triggered by Met activation and leading to execution of HGF-dependent responses have been extensively investigated (4, 18, 41, 42, 44, 45), fundamental questions remain unanswered. First, which are the nuclear factors that regulate Met transcription? This issue is particularly intriguing in light of the frequently observed neo- or overexpression of Met in human solid tumors (10) and of the recent finding that Met is transcriptionally induced by hypoxic stimuli (39). Second, which are, in turn, the transcriptional targets of Met? In spite of the huge amount of data gathered on the various signaling cascades that are primed upon Met stimulation, very little is known about how these signals affect the nuclear transcription machinery to induce or repress specific gene products. Answers to such questions, together with the functional annotation of the molecules identified, are particularly important to categorize negative regulators of HGF-dependent invasive growth, which can be exploited to hamper cancer progression and metastasis.

In this paper, we took advantage of an in silico analysis of the Met promoter region to identify the transmembrane receptor Notch (and, specifically, its downstream effector HES-1) as a transcriptional repressor of Met, and thus as a physiological inhibitor of Met-dependent invasive growth, both in vitro and in vivo. Intriguingly, in an opposite but complementary fashion, Met activation results in stimulation of the Notch pathway through transcriptional induction of the Notch ligands Delta1 and Delta4, together with HES-1. Taken together, these results unravel an in-built mechanism of negative feedback regulation in which Met activation leads to transcriptional induction of Notch function, which in turn limits HGF activity through repression of Met-triggered signals. Such a regulatory circuit can be exploited to prevent HGF-driven cancer progression and metastasis.


arrow
MATERIALS AND METHODS
 
Molecular biology. Standard molecular biology procedures, if not differently indicated, were done according to reference 46. PCRs were performed using Pfu DNA polymerase (Promega). DNAs were sequenced with a BigDye Terminator cycle sequencing kit (PE Applied Biosystems) and analyzed using 310 Genetic Analyzer ABI Prism (Perkin Elmer). pB4021 and pP{W8}-SE-hsp70-torso4021 cDNAs, described in references 53 and 11, respectively, were a gift of F. Sprenger. torso4021 was amplified using pB4021 as template and the oligonucleotides 5' GGAGCACAGCATTAATATGCAGCATATTGG 3' and 5' TCTTTGATCTATTCAAAGGAGGTACGG 3' as primers. Met cDNA was amplified with the primers 5' CCAATATGCTGCATATTAATGCTGTGCTCCCTGACGTTCTGCAAAAAGAGAAAGCAAA 3' and 5' CTGATCTTCTGGAAAAGTAGCTCGG 3'. The underlined residues represent conservative mutations in the transmembrane domain of torso4021 that leads to generation of the restriction site specific for the nuclease AseI. Both torso4021- and Met-amplified fragments were treated with AseI and joined together (torso4021-MetTM). Then, torso4021-MetTM was treated with XhoI and XmnI. pB4021 was treated with XhoI and ClaI, Met cDNA with XmnI and ClaI. pB4021XhoI-ClaI, MetXmnI-ClaI, and torso4021-Met-TMXhoI-XmnI were joined together. This intermediate construct was validated by sequencing, and then it was treated with XhoI and BamHI and the resulting torso-Met fragment was inserted in pP{W8}-SE-hsp70-torso4021, previously digested with the two restriction enzymes XhoI and BamHI. N4-TM was generated starting from the following Human Genome Mapping Project I.M.A.G.E. clones 5370162 (a), 317393 (b), 5391233 (c), 1224677 (d), and 5372052 (e). Specific cDNA fragments were generated by PCRs using the following primers: a, 5' ACGCGAATTCATGGCAGCAGTGGGAGCTCTGGAGCCC 3' and 5' CACTCCCCCACAGAAGACGGC 3'; b, 5' TTGGCCGCTCAACAGCGCGTG 3' and 5' GTCTTCTGCTGCCAATAGGAG 3'; c, 5' GCCAACCCCAATCAGCCAGACCG 3' and 5' TATTATCGAGCTCCAGCAACAGCTGC 3'; d, 5' TTTTCCTGGCAACGCGTGAAGGAG 3' and 5' TATTTATCATCCGTGATGCCCTAG 3'; e, 5' CTAGGGCATCACAGGATGAC 3' and 5' TAATCGCTCGAGTTACTTTCCAAGTCGGTTCATCTCTATGTCTGTATAGTTCAGATTTCTTACAACCGAGTTTAA 3'. The different PCR fragments were treated with the following nucleases: (a) EcoRI and Tsp45I, (b) Tsp45I and MslI, (c) MslI and BssHII, (d) AflIII and BfaI, and (e) BfaI and XhoI. The fragments were joined together in pBluescript SKII (Stratagene). The resulting N4-TM cDNA was validated by sequencing. It was indistinguishable from the previously published sequence (GenBank accession no. NM-010929, residues 4347 to 6008), except for one conservative mutation (C 5429 T) that we inserted in order to generate a restriction site specific for AflIII for joining clones c and d. N4-TM was transferred into the vector pBabe (35) treated with EcoRI and XhoI. For amplifying Delta mRNA in Drosophila embryos, we used the following oligonucleotides: 5' CTGACCGACGCCCAGCGCTTC 3' and 5' ATCGTCGCGGGGCCGGCAGAA 3'. The primers for GPDH mRNA were 5' CCGCTTGCGAGCTTATCGCACCAC 3' and 5' ATTAATCAATTGTAATTGTACTGC 3'. The amplifications of HES-1, J1-2, Dl1-4, and actin in MDA-MB-435-ß4 were done using the primers and the experimental conditions previously described in reference 38. The PCR signals were visualized using a Fluorimager apparatus (Molecular Dynamics) and quantified by densitometry with the software ImageQant (Molecular Dynamics). HES-1 cDNA was obtained by direct amplification of MDA-MB-435-ß4 nucleic acids. Cells were treated with HGF in the presence of the proteasome inhibitor MG132 (Sigma; 50 µM) for 3 h, and then mRNAs were collected and retrotranscribed. The resulting cDNAs were amplified using the following primers: 5' TT AAT ATT CGC AGA TCT ATG CCA GCT GAT ATA ATG GAG AAA AAT TCC 3' and 5' TAT TAA CAA TTG TCA GTT CCG CCA CGG CCT CC 3'. The PCR-amplified fragment was validated by sequencing and then cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen) by blunt-end ligation (pcDNA-HES-1).

Cell maintenance and retroviral infection. MDA-MB-435-ß4 cells were grown in Dulbecco's modified Eagle medium (DMEM; Sigma) supplemented with 10% fetal calf serum (FCS; Sigma) and 1 mg/ml G418 (Gibco); MDCK cells were grown in DMEM (Sigma) supplemented with 10% FCS (HyClone). Viral hybrid vectors were produced by transient transfection of 293T cells with an empty pBabe vector or with an N4-TM-pBabe construct, both containing a puromycin resistance cassette, a gag pol packaging construct derived from Moloney murine leukemia virus, and a third plasmid expressing the vesicular stomatitis virus (VSV) envelope. Pools of stably transfected cells were obtained by retroviral infections. After infection, puromycin-resistant cells were isolated by growth in selective medium (DMEM, 10% FCS, 1 mg/ml G418 [Gibco], and 1 mg/ml puromycin [Sigma] for MDA-MB-435-ß4 cells, and DMEM, 10% FCS, and 5 mg/ml puromycin [Sigma] for MDCK cells). Overexpressing HES-1 cells were obtained by transfection of MDA-MB-435-ß4 cells with the construct pcDNA-HES-1 using Lipofectamine (Invitrogen) together with Plus reagent (Invitrogen), according to the instructions of the manufacturer; transfection with an empty pcDNA3.1 vector was used to produce mock cells. The same transfection method was utilized for getting pBabe or N4-TM MDA-MB-435-ß4 cells to express either control or HES-1 small interfering RNAs (siRNAs) (gift of S. Herzig; described in reference 20). All cells were maintained at 37°C in 5% CO2.

Electrophoretic mobility shift assays (EMSA). MDA-MB-435-ß4 nuclear extracts were obtained using a nuclear extraction kit (Panomics), following the instructions of the manufacturer, and then they were dialyzed in a buffer containing 10 mM HEPES, pH 7.9, 25 mM KCl, 1 mM EDTA, 5 mM MgCl2, 1 mM dithiothreitol, 10% glycerol, and 0.05% NP-40 in the presence of protease and phosphatase inhibitors. 5' GCGAGGCAGACAGACACGTGCTGGGGCGGGCAGG 3' together with 5' CTCGCCTGCCCGCCCCAGCACGTGTCTGTCTGCC 3' and 5' GCGAGGCAGACAGACAAAAGCTGGGGCGGGCAGG 3' together with 5' CTCGCCTGCCCGCCCCAGCTTTTGTCTGTCTGCC 3' were annealed to generate, respectively, HES-1-wt and HES-1-mut double-stranded Met-promoter oligonucleotides. Probes were obtained by a Klenow fill-in reaction of 100 ng of each of the two double-stranded oligonucleotides in the presence of 100 µCi of [{alpha}-32P]GTP, according to reference 9. The probe for GAA was obtained as described in reference 64. Labeled oligonucleotides (5 x 104 cpm) were incubated with 10 µg of nuclear extracts and 1 mg/ml poly(dIdC) (Amersham-Pharmacia) for 45 min on ice. In some experiments, nuclear extracts were preincubated for 30 min on ice with 2 µg of either control immunoglobulin G (Sigma) or TransCruz Gel Supershift anti-HES-1 antibodies (Santa Cruz) (66). Complexes were separated using a 5% polyacrylamide-0.5% Tris-borate-EDTA gel and visualized using a Storm apparatus (Molecular Dynamics).

Transcriptional analysis. The wild-type Met-promoter construct used for the transcriptional analysis has been previously described (15). The putative HES binding sequence "CACGTG" (+20 from transcriptional start site) was mutated by a recombinant PCR-based approach (34) to "CAAAAG." Accuracy of the mutagenesis procedure was verified by direct sequencing. Analysis of promoter activity was performed in MDA-MB-435-ß4 cells. By using Lipofectamine (Invitrogen), 1.8 x 106 cells/100-mm-diameter plate were transfected with either 20 µg of the appropriate promoter construct, with 3.5 µg of pcDNA-HES-1 or control pcDNA3.1 vector together with 15 µg of the promoter constructs, or with 2.8 µg of the siRNA constructs together with 10 µg of the appropriate promoter constructs. For the rescuing experiments (see Fig. 4E and F), 8 x 106 of MDA-MB-435-ß4 cells/100-mm-diameter plate were transfected with 10 µg of pcDNA-HES-1; after 3 days, these cells were divided and retransfected with increasing amounts of HES-1 siRNAs (8, 16, 24, and 48 µg) or control siRNAs (48 µg). The results showed that 16 and 24 µg of HES-1 siRNAs were sufficient for silencing exogenously induced overexpression of HES-1. After 4 days, these cells were transfected with 25 µg of the appropriate promoter constructs. For the experiments presented in Fig. 5C and D, 8 x 106 N4-TM MDA-MB-435-ß4 cells/100-mm-diameter plate were transfected with 20 µg of HES-1 siRNAs; after 3 days, these cells were divided and retransfected with increasing amounts of pcDNA-HES-1 (4, 8, 12, 24, and 36 µg). The down-regulation of HES-1 visible in HES-1 siRNA-transfected cells is abrogated by 8 and 12 µg of HES-1. After 4 days, these cells were transfected with 25 µg of the appropriate promoter constructs. A TK-Renilla reporter plasmid (Promega) (0.2 µg) was added to each transfection for efficiency standardization. After 48 h, cells were processed using a dual-luciferase reporter assay system (Promega) according to the manufacturer's instructions. Ten microliters of cell lysate was used to determine reporter enzyme activity by using a Lumat LB 9507 luminometer (Berthold). Each experimental point was performed in quadruplicate.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 4. Met activation induces Notch signaling that, through HES-1, modulates Met. (A) MDA-MB-43-ß4 cells were starved for 24 then treated either with control medium (CT) or with 25 ng/ml of HGF (HGF). RNAs were extracted at the indicated time and used as templates for amplification reactions using primers specific for HES-1 and the six Notch ligands (J1, J2, and Dl1to -4). HGF induces the transcription of HES-1, Dl1, and Dl4. J1 is constitutively expressed. The amplification products obtained with primers specific for the housekeeping gene actin are shown as a control. (B) Histograms showing Met promoter activity in mock (light grey)- and HES-1 (dark grey)-expressing MDA-MB-435-ß4 cells. Cells were transfected with constructs expressing luciferase under the control of wild type (wt) or mutated (mut) Met promoter. Luciferase activity was normalized for transfection efficiency using a Renilla reporter plasmid. The histogram displays the mean promoter activity expressed as increases of values obtained with a promoterless reporter construct transfected in mock cells (basic). Standard deviations are shown. These data are the results from three independent experiments performed in quadruplicate. HES-1 inhibits wild-type Met promoter (P < 0.05), whereas the mutated promoter is unaffected. (C) Western blots of total protein extracts of mock and HES-1 MDA-MB-435-ß4 cells probed with anti-Met, anti-HES-1, and anti-actin antibodies. HES-1-expressing cells show a decrease of both precursor (p190MET) and processed (p145ß) Met isoforms in comparison with mock-transfected cells. (D) Tubulogenesis assay on MDA-MB-435-ß4 cells either mock or HES-1 transfected. HES-1 inhibits HGF-induced tubulogenesis. The micrographs show representative 10-day colonies. Scale bar, 40 µm. (E) Western blots of total protein extracts of HES-1 MDA-MB-435-ß4 cells (second lane) transfected with increasing amounts of HES-1 siRNAs (HES-1; third and fourth lanes) or with control siRNAs (CT; fifth lane). Mock-transfected MDA-MB-435-ß4 cells are shown for comparison (first lane). Specific HES-1 siRNAs inhibit HES-1 expression (second row) and result in a dose-response increasing of both precursor (p190MET) and processed (p145ß) Met isoforms (first row). As a loading control, the same blot was stained with antibodies raised against actin. (F) Histograms showing Met promoter activity in MDA-MB-435-ß4 cells transfected as indicated by arrows in panel E, labeled with the corresponding color code. These data are the results of two independent experiments performed in quadruplicate. Standard deviations are shown. HES-1 siRNAs counteract the inhibition of Met promoter mediated by HES-1 (P < 0.05).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 5. HES-1 is required for Notch-mediated Met down-regulation and impairs HGF-dependent signaling. (A) Histograms showing Met promoter activity in mock (light grey)- and N4-TM (dark grey)-transduced MDA-MB-435-ß4 cells expressing either control (solid) or HES-1 (dashed) siRNAs. Cells were transfected with constructs bearing luciferase under the control of wild type (wt) or mutated (mut) Met promoter. As before, luciferase activity was normalized for transfection efficiency using a Renilla reporter plasmid. The histogram displays the mean promoter activity expressed as increases of values obtained with a promoterless reporter construct transfected in mock cells (basic). Standard deviations are shown. These data are the results from three independent experiments performed in quadruplicate. HES-1 siRNA prevents Notch-dependent inhibition of Met promoter activity. The mutated promoter is unaffected. (B) Western blots of total protein extracts probed with anti-Met, anti-HES-1, and anti-actin antibodies. Mock and N4-TM MDA-MB-435-ß4-transduced cells were transfected with control (CT) or HES-1 (HES-1) siRNAs. Inactivation of HES-1 abrogates N4-TM-dependent down-regulation of both precursor (p190MET) and processed (p145ß) Met isoforms. (C) Western blots of total protein extracts of N4-TM MDA-MB-435-ß4 cells (second lane) transfected with HES-1 siRNAs (third lane) and with HES-1 siRNAs plus increasing amount of HES-1 (fourth and fifth lanes). Mock-transfected MDA-MB-435-ß4 cells are shown for comparison (first lane). Increasing amounts of exogenously transfected HES-1, monitored by specific anti-HES-1 antibody probing (second row),result in a dose-response down-regulation of both precursor (p190MET) and processed (p145ß) Met isoforms (first row, lanes four and five). As a loading control, the same blot was stained with antibodies raised against actin. (D) Histograms showing Met promoter activity in MDA-MB-435-ß4 cells transfected as indicated by arrows in panel C are labeled with the corresponding color code. These data are the results of two independent experiments performed in quadruplicate. Standard deviations are shown. Exogenous transfection of HES-1 rescues the Notch-mediated inhibition of Met mRNA expression in N4-TM MDA-MB-435-ß4 cells transfected with HES-1 siRNAs. (E) Western blots of total protein extracts showing a comparison of HGF-dependent signaling pathways in N4-TM and HES-1 MDA-MB-435-ß4 cells. The same blot was stained with antibodies raised against Met, pERKs, pAKT/PKB, and HES-1. Similarly to N4-TM, HES-1 overexpression determines down-regulation of Met (first panel); ERK phosphorylation in response to HGF is impaired (second panel), whereas AKT/PKB phosphorylation is unaffected (third panel). Again, the blot was reprobed with antibodies anti-actin, anti-ERK, and anti-AKT/PKB (third, fifth, and sixth panels, respectively) as loading controls.

Cell immunofluorescent staining. Cells were seeded and processed as previously described (57). The staining was performed using anti-VSV monoclonal antibody (MAb) (clone P5D4, diluted 1:200; Sigma) followed by FITC-labeled anti-mouse antibodies (1:200; Molecular Probes), tetramethyl rhodamine isocyanate-conjugated phalloidin, to evidence actin cytoskeleton, and To-Pro-I3 (1:2,000; Molecular Probes), to label nuclei. The stained cells were mounted in Mowiol, and then they were observed and photographed using a confocal microscope (Molecular Dynamics).

Biological assays. In all the biological assays we used baculovirus recombinant HGF (37). Conditioned medium of uninfected insect cells, treated as the supernatant derived from HGF-baculovirus-infected cells, provided the negative control. In the migration assays, 5 x 105 cells in 200 µl of DMEM supplemented with 0.2% FCS were seeded in the upper compartment of Transwell chambers (6.5 µm, polycarbonate filter with 8-µm pore size; Costar Corporation). DMEM (500 µl) plus 0.2% FCS, containing either control medium or 40 ng/ml of HGF, was added to the lower chamber. The plates were incubated at 37°C for 12 h, and then the cells on the upper side of the polycarbonate filter were mechanically removed. Cells that had migrated to the lower side of the filter were stained with crystal violet and counted using a Fast-Read 102 New Grid counting chamber (Roche Diagnostics) under a Dialux microscope (Leitz). The invasion assays were performed as the migration assays described above, but here the upper sides of the filters were coated with 15 µg/cm2 of reconstituted Matrigel basement membrane (Collaborative Research). For the tubulogenesis assays, the trypsinized cells were suspended to a final concentration of 1.5 x 105 cells/ml (MDA-MB-435-ß4) or 1 x 105 cells/ml (MDCK) in gelling solution prepared as follows: 800 µl of type I collagen S (3.4 mg/ml; Collaborative Biomed), 1x DMEM, 40 mM HEPES, 37 g/liter NaHCO3, all to a final volume of 1 ml. Eighty microliters of this mixture was seeded into 96 microtiter plate wells and allowed to gel for 10 min at 37°C before overlying with 80 µl DMEM containing 20% FCS. After 2 h at 37°C, the upper aqueous phase was removed and substituted with fresh DMEM medium plus 10% FCS. After further 24 h, either control medium or 80 ng/ml of HGF was added in the upper aqueous phase. Tubules were scored every day for 2 weeks.

Biochemical methods. For immunoprecipitation, 1 x 106 cells or 100 embryos were lysed for 15 min at 4°C with 1 ml of lysis buffer (50 mM HEPES, pH 7.4, 5 mM EDTA, 2 mM EGTA, 150 mM NaCl, 10% glycerol, and 1% NP-40), in the presence of protease and phosphatase inhibitors. Extracts were quantified with a bicinchoninic acid protein assay reagent kit (Pierce), and an equal amount of proteins was incubated with MAbs anti-VSV (clone P5D4; Sigma) or anti-hMet-DQ13 (produced in our laboratory). Immune complexes were collected with Sepharose-protein A resin (Amersham-Pharmacia) supplemented with 1.2 µg of rabbit anti-mouse immunoglobulin (RAMIG; Pierce) for 2 h at 4°C and then washed 4x in ice-cold lysis buffer and eluted in boiling Laemmli buffer. Western blot analysis was performed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels. The gels were blotted onto a nylon membrane (polyvinylidene difluoride transfer membrane; Millipore Corporation); the membrane was blocked using 10% bovine serum albumin in Tris-buffered saline-Tween for 2 h at 45°C; the primary antibodies (MAb anti-VSV, Sigma; polyclonal antibody [PAb] anti-Met-C12, Santa Cruz; MAb anti-phosphotyrosine, Upstate Biotechnology; PAb anti-active-MAPK, Promega; PAb anti-MAPK, Cell Signaling; PAb anti-actin, Santa Cruz; PAb anti-active-AKT, Cell Signaling; PAb anti-AKT, Cell Signaling; PAb anti-HES-1, kindly provided by T. Sudo; MAb anti-panRAS, Transduction Laboratories) were incubated in 5% bovine serum albumin in Tris-buffered saline-Tween according to the dilutions suggested by the manufacturers, for 12 h at 4°C. Specific signals were detected with peroxidase-conjugated secondary antibodies (Amersham-Pharmacia) and an enhanced chemiluminescence system (ECL; Amersham-Pharmacia). Pool-down experiments were done according to reference 47; cells were maintained in serum-free medium for 24 h, and then they were either left untreated or stimulated with 50 ng/ml of HGF for the indicated times. The construct Raf-RBD-GST-pGEX (gift of E. Audero) was expressed in bacteria and purified as described in reference 47. In each experimental point, 1 mg of total protein extracts was incubated with 40 µg of Raf-RBD-GST fusion protein. For auto-kinase assays, immunoprecipitated embryonic extracts were washed twice with ice-cold KB buffer (20 mM HEPES, pH 7.1, 5 mM MgCl2, 100 mM NaCl), and the phosphorylation reaction was performed in the presence of [{gamma}-32P]ATP and 10 mM unlabeled ATP for 15 min at 37°C. The reactions were stopped by adding boiling Laemmli buffer and the samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels. The signals were visualized with a Storm apparatus (Molecular Dynamics).

Fly stocks. The following fly strains were used in this study: the w1118 strain (gift of S. Roth) was used for P-element-mediated germ line transformation; trachealess enhancer trap line 1-eve-1 (Perrimon, 1991, no. 2014) was a gift of M. Affolter; and the NCo, CyO, and CyO-ftz-LacZ strains were provided from the Bloomington Stock Centre.

Embryo fixation and staining. Embryos were staged according to reference 6. They were collected on apple juice agar plates following standard protocols (63), and then they were processed as previously described (55). For the staining we used the following primary antibodies: MAb 2A12 (developed by C. Goodman and N. Patel; diluted 1:10) and MAb C17.9C6 (anti-Notch, intracellular domain, diluted 1:5; developed by S. Artavanis-Tsakonas), both obtained from the Developmental Studies Hybridoma Bank. Anti-ß-galactosidase (ß- gal) antibodies, purchased from Cappel, were diluted 1:1,000; anti-human Met antibody, clone C12, purchased from SantaCruz, after preabsorption using wild-type embryos, was used 1:100. The primary antibodies were diluted in 1% FCS. The incubations with the primary antibodies were performed at 4°C for 12 h. The secondary antibodies were as follows: biotinylated anti-rabbit and anti-mouse (diluted 1:5,000; Vector Laboratories) and FITC-conjugated anti-rabbit and tetramethyl rhodamine isocyanate-conjugated anti-mouse (diluted 1:500; Molecular Probes). All the secondary antibodies were incubated for 2 h at room temperature. The stainings performed with the biotinylated antibodies were developed using a Vectastain Elite ABC kit (Vector Laboratories) with 3'-3'-diaminobenzidine (Sigma) as chromogen. Subsequently, the embryos were dehydrated, rinsed in acetone, and transferred to a 1:1 mixture of acetone and Durcupan (Fluka) overnight. After acetone evaporation, embryos were observed and photographed by using a Dialux microscope (Leitz). For genotyping, embryos were first stained with biotinylated antibodies to label the tracheas and then with anti-ß-gal and MAb C17.9C6 followed by fluorochrome-conjugated secondary antibodies. NCo torso-Met mutants were identified for the absence of both ß-gal and MAb C17.9C6 staining. They were collected under an Axioplan microscope (Zeiss), mounted in Durcupan (Fluka), and photographed as previously described.


arrow
RESULTS
 
HES protein binds to Met promoter. In silico analysis of the human Met gene reveals that the Met promoter contains one putative binding site for HES proteins, a basic helix-loop-helix type of transcriptional repressor known to be a downstream target of Notch activity (Fig. 1A) (23). We therefore decided to investigate whether HES-1, the prototype of this family of transcription factors, was able to bind to the Met promoter. This was achieved by EMSA analysis in MDA-MB-435-ß4 cells (57) overexpressing HES-1 (Fig. 1B; see Materials and Methods for details). For comparison, the binding of HES-1 to the promoter of acid {alpha}-glucosidase (GAA), a known target gene of the HES-Notch pathway (64), was monitored. As expected, incubation of nuclear extracts with a probe containing the HES binding site on the GAA promoter determined the formation of a complex (Fig. 1C, first lane). The same was true when the nuclear extracts were incubated with a probe containing the wild-type HES putative binding site on the Met promoter, whereas incubation with a probe mutated in this binding site did not lead to complex formation (Fig. 1C, compare the third and second lanes). The specificity of the complex was further examined by competition experiments using either unlabeled HES wild-type or HES mutated Met promoter probes. By adding the mutated competitor, the complex was only slightly reduced in a dose-independent fashion, suggesting an unspecific quenching effect of the mutated competitor over HES-1/Met complex formation (Fig. 1C, lanes six and seven). When a 10-fold molar excess of wild-type competitor was added to the reaction, complex formation was reduced, and it was almost totally abolished in the presence of a 50-fold molar excess (Fig. 1C, lanes eight and nine). The addition of anti-HES-1 antibodies reduced the intensity of the HES-1/Met complex compared to control unspecific immunoglobulins (Fig. 1C, lanes ten and eleven), thus indicating a specific interference of anti-HES-1 antibodies in the complex formation. Altogether, these data confirm the in silico observation by demonstrating that indeed HES-1 binds to Met promoter.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 1. HES-1 binds to the Met promoter. (A) Sequence of the Met promoter. Bold residues represent the putative HES binding site. Shown in capital letters are the residues that were mutated in the EMSA and promoter analysis (CGT towards AAA). (B) Western blot of MDA-MB-435-ß4 cell extracts either mock or HES-1 transfected. The same blot was stained with antibodies anti-HES-1 and anti-actin as loading control. (C) EMSA showing HES-1 binding activity to the GAA and to the Met promoter. Nuclear extracts from cells overexpressing HES-1 were incubated with the HES-1 DNA binding domain of the GAA gene (lane 1) and with mutated (lane 2) or wild-type (wt) (lanes 3 and 5 to 11) HES-1 DNA binding domain of Met promoter. A complex is formed exclusively in the presence of both GAA and Met wild-type promoters. This complex is unaltered by adding an excess of mutated probe (lanes 6 and 7) but is affected by the addiction of wild-type probe (lanes 8 and 9). Addiction of anti-HES-1 antibodies determines a reduction in the complex (lane 10) that is absent when control immunoglobulins (Ig) are added (lane 11).

Activation of Notch down-regulates Met transcription and impairs Met-dependent Ras activation and biological responses. The observation that the Met promoter can bind the HES-1 transcription factor suggests that Met could be a transcriptional target of Notch. To study the potential effect of Notch on Met transcription, we generated stable transfectants expressing constitutive active forms of Notch. Among the four different vertebrate homologues of Notch, we focused our attention on Notch4, which, similar to Met, has been demonstrated to affect the development of different tubular organs such as the mammary gland (51, 59) and the vascular system (27, 30, 49). As cellular recipients, we chose two mammalian cell lines that have been thoroughly characterized in terms of biological responses to the Met ligand HGF, MDA-MB-435-ß4 and MDCK (42, 67). Retroviral-mediated infection of MDA-MB-435-ß4 and MDCK cells with a constitutively active form of Notch tagged with a VSV C-terminal epitope (N4-TM) resulted in expression and correct processing of the transgene product. Western blot analysis demonstrated the presence of a doublet corresponding to the unprocessed transmembrane protein and the cleaved intracellular portion of N4-TM (Fig. 2A). Moreover, N4-TM properly localized in the nucleus, as shown by confocal immunofluorescence analysis of MDA-MB-435-ß4 cells simultaneously stained for F-actin (red), a nuclear marker (blue), and N4-TM (green; Fig. 2B).



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2. Constitutive activation of Notch inhibits Met synthesis. (A) Western blot showing the expression of N4-TM in both MDA-MB-435-ß4 and MDCK cells. Cell extracts were immunoprecipitated using anti-VSV antibodies and the blot was stained using the same antibody. The arrowheads mark the two forms of N4-TM. The higher band corresponds to the full transmembrane proteins; the lower bands to the processed intracellular part. Mock-transduced cells are shown for comparison. Molecular weight markers (MWM), expressed as 1 x 103 daltons (kDa), are indicated. (B) Confocal sections of N4-TM MDA-MB-435-ß4 cells stained with phalloidin (red), To-Pro-I-3 (blue), and anti-VSV antibody (green) to visualize, respectively, actin cytoskeleton, nucleus, and N4-TM. N4-TM localizes in the nucleus. Scale bar, 2 µm. (C) Histograms showing Met promoter activity in mock (light grey) and N4-TM (dark grey) MDA-MB-435-ß4 cells. Cells were transfected with constructs expressing luciferase under the control of wild type (wt) or mutated (mut) Met promoter. Luciferase activity was normalized for transfection efficiency using a Renilla reporter plasmid. The histogram displays the mean promoter activity expressed as increases of values obtained with a promoterless reporter construct transfected in mock cells (basic). Standard deviations (S.D.) are shown. These data are the results from three independent experiments performed in quadruplicate. N4-TM inhibits wild-type Met promoter (P < 0.05), whereas the mutated promoter is unaffected. (D) semiquantitative PCRs on mRNAs extracted from mock (–) or N4-TM (+) MDA-MB-435-ß4 cells. The primers used in the different reactions are indicated. The signals obtained in each PCR were quantified by densitometric measurements. Each Met value was normalized to the corresponding actin value. The numbers indicate Met/actin mRNA expression as means ± standard deviations of three independent amplification reactions performed in triplicate. Cells expressing N4-TM show diminished Met transcripts compared to mock-transduced cells (P < 0.05). (E) Western blots of total protein extracts probed with anti-Met and anti-actin antibodies. N4-TM-transduced cells show a decrease of both precursor (p190MET) and processed (p145ß) Met isoforms in comparison with mock-transduced cells.

Subsequently, we subcloned the human Met promoter (15), either of the wild type or mutated in the HES binding site, into a reporter plasmid upstream of a luciferase gene and transfected it into mock and N4-TM MDA-MB-435-ß4 cells. Luciferase activity of transfected cells was analyzed to determine promoter activity. Constitutively active Notch depressed transcription from the Met promoter by 1.5-fold (Fig. 2C). Accordingly, mutagenesis of the HES binding site restored Met transcription in N4-TM transfectants. In line with these findings, reverse transcription (RT)-PCR analysis of Met mRNA in N4-TM and mock cells indicated that the Met transcript is diminished in N4-TM cells compared to mock cells (Fig. 2D), which leads to reduced levels of Met protein (Fig. 2E). Taken together, these data demonstrate that Notch can negatively modulate Met synthesis at the transcriptional level.

Intriguingly, Notch has been shown to affect the function of tyrosine kinase receptors through inhibition of Ras signaling (2, 8, 61). Because the need for the integrity of Ras signals in Met-dependent responses has been highlighted in several experimental settings of invasive growth, including tubulogenesis in tridimensional collagen cultures (1, 16, 25) and embryo development (31), we analyzed the activation levels of this Met effector following HGF stimulation in both MDA-MB-435-ß4 and MDCK cells, either mock or N4-TM transduced. As a biochemical readout of Ras activity, we measured the amplitude and duration of HGF-dependent activation of mitogen-activated protein kinase (MAPK). As shown in Fig. 3A, while HGF induced MAPK activation in mock cells, it failed to stimulate MAPK activity in N4-TM transfectants. To further validate this result, we monitored HGF-dependent Ras activation in mock and N4-TM MDCK cells by Ras-GTP pull-downs using the Ras-binding domain of Raf-1 fused to glutathione S-transferase (GST). HGF treatment determined an increase of Ras-GTP in mock cells but not in N4-TM cells, thus confirming a Notch-based repression of HGF-triggered Ras signaling (Fig. 3B). Ras-GTP pull-downs in MDA-MB-435-ß4 cells were hampered by low expression levels of Ras. Differently from Ras, HGF-triggered activation of AKT/PKB, a downstream target of PI3K crucially involved in Met-dependent invasive growth, was unaffected in N4-TM versus mock cells (Fig. 3C). Combined, these data suggest that Notch can, on one hand, decrease Met transcription and, on the other, selectively impinge on specific interruption of the Ras signaling cascade.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3. Constitutive activation of Notch impairs HGF-dependent Ras/MAPK signaling and Met-dependent biological responses in both MDA-MB-435-ß4 and MDCK cells. (A-C) Western blots showing time course analysis of MAPK phosphorylation (A), Ras activation (B), and PKB/AKT phosphorylation (C) upon HGF treatment in mock- and N4-TM-transduced cells. The same blot was probed with antibodies anti-phosho-ERK (A) and phospho-PKB/AKT (C) and reprobed with antibodies anti-ERK (A) and -PKB/AKT (C) as loading controls. N4-TM inhibits HGF-induced MAPK activation in both MDA-MB-435-ß4 and MDCK cells, whereas it does not affect the activation of PKB/AKT. (B) Ras-GTP pool-down experiments using Raf-RBD-GST fusion protein in mock- or N4-TM-transduced MDCK cells in response to HGF treatment (upper part of the figure). Expression of total Ras is shown in the lower part of the figure. N4-TM prevents Ras activation. (D-E) Histogram showing the migration (D) and invasion (E) ability of mock- and N4-TM-transduced cells. The mean number of migratory cells expressed as increases of migrating mock cells are reported. Standard deviations are shown. These data are the results from three independent experiments performed in triplicate. N4-TM inhibits both cell migration (C; P < 5 x 10–3 in MDA-MB-435-ß4 and P < 1 x 10–6 in MDCK) and Matrigel invasion (D; P < 5 x 10–3 in MDA-MB-435-ß4 and P < 1 x 10–6 in MDCK). (F) Tubulogenesis assay on mock- and N4-TM-expressing cells. N4-TM inhibits HGF-induced tubulogenesis. The micrographs show representative 7-day colonies. Scale bar, 50 µm. (G) Quantification of the tubulogenetic ability of MDA-MB-435-ß4 and MDCK cells, either mock or N4-TM transduced, after 6 days of coculture in collagen gel. In each experimental condition, 100 cysts were scored. CT, control.

To explore whether Notch-dependent transcriptional down-regulation of Met and disturbance of Met-triggered Ras signaling can modify HGF-dependent biological responses, we compared the ability of mock versus N4-TM transfectants to respond to HGF in migration, invasion, and tubulogenesis assays. Interestingly, in both MDA-MB-435-ß4 and MDCK cells, N4-TM inhibited HGF-stimulated motility across cell-permeable filters (Fig. 3D), decreased cell invasion through a three-dimensional matrix of Matrigel (Fig. 3E), and abolished formation of branching tubules in collagen gels (Fig. 3F; for quantification, see Fig. 3G). The striking abrogation of HGF-dependent branching morphogenesis in cells expressing N4-TM is likely due to the combined action of reduced Met expression and Notch-based selective attenuation of Ras signaling; indeed, HGF-dependent branching morphogenesis in three-dimensional collagen gels crucially relies on a fine equilibrium between Ras and PI3K activity, and any imbalance disrupting this equilibrium severely hampers tubule formation (1, 16, 25). Together, all these findings indicate that activation of Notch strongly impairs Met-dependent biological responses, thus supporting a role of Notch as a repressor of Met activity.

Met activation induces Notch signaling, which through HES-1 represses Met mRNA synthesis. It is now becoming increasingly clear that subtle regulation of tyrosine kinase activity may rely on negative checkpoints that counter-feedback positive inputs. One of the possible mechanisms whereby this can be achieved is through transcriptional induction of regulatory molecules that, in turn, can affect the activity of transcription factors and coactivators (3, 48). Based on this information, we hypothesized that the inhibitory function of Notch on Met could be induced by Met itself, within an intrinsic circuit of transcriptional cross talk.

Notch activity is first primed by elevation of the cellular levels of its ligands (in vertebrates, two homologues of Serrate [Jagged1 and -2] [26, 60] and four Delta-like genes [Delta 1 to -4] [17, 23, 50]) and further proceeds through nuclear translocation, association with the transcription factor Suppressor of Hairless/CBF-1, and transactivation of several target genes coding for basic helix-loop-helix proteins, namely the genes belonging to the hairy/Enhancer of Split that include HES-1 [E(spl) family] (23).

To validate the prediction that Met stimulates the activity of its own repressor, we performed a time course RT-PCR analysis to track HGF-dependent transcriptional induction of the various Notch ligands and of HES-1. Indeed, HGF stimulation of MDA-MB-435-ß4 cells induced the transient transcription of HES-1 and of two Delta mRNAs, Dl1 and Dl4 (Fig. 4A). Among the other ligands, J1 was expressed constitutively (Fig. 4A), whereas J2 and Dl3 were not expressed nor were they induced by HGF (data not shown).

Given that HGF induces HES-1 mRNA and that activation of Notch, the HES-1 upstream regulator, leads to Met inhibition, we tested if altered expression of HES-1 protein results in modifications of Met mRNA transcription. This was done by monitoring the luciferase activity of Met-promoter reporter constructs (see above) in MDA-MB-435-ß4 cells in which HES-1 was overexpressed by transient transfection. In agreement with the inhibitory function of the Notch pathway on Met synthesis, overexpression of HES-1 led to a 30% decrease in Met-promoter activity (Fig. 4B). As expected, luciferase activity of the Met-promoter construct in which the HES-1 binding site was mutated was insensitive to dose alterations of HES-1 (Fig. 4B). Accordingly, overexpression of HES-1 resulted in down-regulation of the Met protein (Fig. 4C), which leads to reduced biological responses to HGF treatment, measured as growth in tridimensional collagen gel (Fig. 4D). To further support the correlation between HES-1 activity and Met expression, we used the RNA interference technology to progressively down-modulate HES-1 protein levels in MDA-MB-435-ß4 cells exogenously overexpressing HES-1. Addition of a HES-1-specific siRNA resulted in a dose-response increase in Met protein (Fig. 4E, lanes three and four), whereas an unrelated siRNA had no effect (see Fig. 4E, lane five). Accordingly, luciferase activity analysis of the Met-promoter construct in these cells showed that siRNA-mediated inhibition of HES-1 expression abrogated the transcriptional down-regulation of the Met gene (Fig. 4F).

By using an opposite but complementary approach, we monitored luciferase activity of the Met-promoter constructs using MDA-MB-435-ß4 cells in which HES-1 function was knocked down by RNA interference technology. Ablation of HES-1 in cells expressing N4-TM restored a promoter activity similar to that observed in mock cells; as previously shown, mutations in the HES-1 binding domain of the Met promoter region abolished Notch-dependent down-regulation of Met synthesis irrespective of HES-1 expression (Fig. 5A). Consistent with these findings, HES-1 inactivation increased expression of the Met protein in N4-TM-expressing cells (Fig. 5B). Again, gradual increase of HES-1 expression in these HES-1 cells led to recovery of the Notch inhibitory activity, with consequent progressive reduction of Met protein levels (Fig. 5, panels C and D).

If HES-1 is the Notch effector responsible for attenuation of Met synthesis, then overexpression of HES-1 should mimic Notch activity in impairing Met-dependent signals. To test this hypothesis, we compared Met expression, PI3-kinase stimulation (in terms of activated PKB/AKT), and Ras stimulation (in terms of MAPK activity) upon HGF treatment in MDA-MB-435-ß4 cells, expressing either N4-TM or HES-1. As previously shown, both N4-TM- and HES-1-expressing cells displayed reduced Met expression (Fig. 5E, first panel), which correlates with the expression level of HES-1 (Fig. 5E, sixth panel). Moreover, cells expressing either N4-TM or HES-1 exhibited reduced MAPK activation (Fig. 5E, second panel) in response to HGF stimulation, whereas PKB/AKT activity was unaffected (Fig. 5E, fourth panel). The amounts of extracellular signal-regulated kinases (ERKs), AKT/PKB, and actin confirmed equal loading in all the experimental conditions (Fig. 5E, third, fifth, and sixth panels). This indicates that HES-1 overexpression recapitulates the repression of Met signaling observed in N4-TM transfectants.

In summary, these data define a novel epistatic relationship in which Met activation results in induction of Notch signaling that in turn represses Met activity through HES-1.

Cross talk between Met and Notch signaling in Drosophila. To date, four vertebrate Notch genes have been identified (Notch1 to -4) (23) together with six Notch ligands (17, 23, 26, 50, 60). The complexity of Notch and Notch ligand family members, as well as the evidence that loss of either HGF or Met in the mouse results in early embryonic lethality, points to the necessity of exploiting alternative animal models to explore in vivo the interaction between Met and Notch. This model should not require Met function during development and in adult life, and in the meantime it should be easily amenable to genetic manipulation. We thus decided to scrutinize the effects of Met-Notch interactions during development of the tracheal tree in Drosophila melanogaster. The advantages of such an experimental approach are twofold: Met is not expressed in Drosophila (54), so this organism represents a naive recipient for clear-cut dissection of Met-dependent responses without any kind of endogenous developmental interference; moreover, formation of the tracheal tree in Drosophila is a striking example of branching morphogenesis in vivo, in which the role of Notch pathway has been extensively documented (21, 28).

The Drosophila tracheal system is an elaborate network of epithelial tubes that ramifies in some 10,000 branches. The network arises from segmentally repeated clusters of ectodermal cells, the placodes, which invaginate to form sac-like structures called tracheal pits. Each tracheal pit sprouts successively finer branches, some of which ultimately fuse to form an arborescent pattern throughout the embryo. Unlike sprouting of the major tracheal branches, which is simple and stereotyped, ramification of the terminal branches is complex and variable and is affected by several morphogenetic regulators. Among these, the Notch signaling pathway is needed in the tracheal cells for the fusion and terminal branching programs (21, 28). In particular, Notch is first required to single out the cells that will control branch fusion from a group of competent tracheal cells and later to select the correct number of terminal branches arising from some primary branches.

To confirm in this in vivo setting our assumption that Met activation results in induction of Notch function, which in turn represses Met activity, we followed three subsequent experimental lines: first, we analyzed whether expression of a constitutively active Met in Drosophila leads to Notch stimulation (through increased expression of its physiological ligands); then, as a basal read-out of Met function, we examined the tracheal phenotype of Met-expressing flies; finally, we analyzed whether this phenotype is affected in a Notch-null background.

Construction and expression of the chimeric torso-Met receptor in Drosophila. To generate transgenic flies in which Met signaling is constitutively activated, we produced a chimeric fusion protein in which the extracellular and transmembrane domains of human Met were substituted with the corresponding domains of torso4021 (torso-Met). torso4021 is a Drosophila tyrosine kinase mutant receptor bearing a single amino acid substitution (Y 327 C) that leads to spontaneous dimerization and consequent constitutive activation of the receptor (53). The expression of this hybrid receptor was driven by the promoter hsp70, which allows a ubiquitous and heat-inducible expression of the protein.

The torso-Met construct was checked for correct expression by in vitro translation experiments (data not shown) and then introduced into Drosophila embryos by P-element-mediated gene transfer. Six independent P-element insertions were mapped by in situ hybridization onto polytene chromosomes, and different lines were generated using specific marked balancer chromosomes. All the transformant lines were maintained at 18°C to prevent torso-Met activation. To test the expression and the biochemical properties of the torso-Met recombinant protein in vivo, the transgene was induced by heat shock treatment (37°C, 20 min) in the progeny of the transformant flies, and then the embryos were transferred at 18°C for a further 3 h. Immunoprecipitation of lysates from heat-shocked and untreated embryos with specific monoclonal antibodies raised against human Met followed by Western blot analysis with anti-Met and anti-phosphotyrosine antibodies shows that the recombinant protein was expressed exclusively in the embryos exposed to heat shock treatment and had the expected molecular weight of 95,000 (Fig. 6A). Moreover, as for activated human Met receptor, torso-Met was tyrosine phosphorylated (Fig. 6B) and underwent autophosphorylation in autokinase assays (Fig. 6C). This indicates that the recombinant torso-Met protein expressed in Drosophila retains the catalytic properties of human wild-type Met.



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 6. Constitutive activation of Met affects tracheal development in Drosophila. (A-C) Analysis of torso-Met expression and enzymatic activity in vivo. One hundred embryos derived from torso-Met transformant flies were left untreated (–) or heat-shocked (HS) for 20 min at 37°C (+) and transferred at 18°C for a further 3 h to allow expression of the induced proteins. Embryonic proteins were immunoprecipitated using anti-human-Met antibodies and analyzed by Western blot techniques. The same blot was stained with anti-Met (A) or anti-phosphorylated tyrosine (B) antibodies. (C) Autoradiography of a Western blot resulting from the incubation of anti-Met immunoprecipitated embryonic proteins with [{gamma}-32P]ATP. The arrowhead marks torso-Met. The chimeric torso-Met construct is expressed and phosphorylated, and it retains its kinase activity. Molecular weight markers (MWM) are indicated. (D) Diagram showing a time course analysis of the expression of Dl mRNA in wild-type (dotted line) and torso-Met (continuous line) embryos, both heat shock treated 3 to 4 h after embryonic laying (AEL). RNAs were collected at the indicated times. For each experimental point, extracts from 200 embryos were amplified with a combination of Dl and GPDH primers; the amplification products were separated onto a 4% agarose gel, and the signals were quantified by densitometric measurements. Each Dl value was normalized to the corresponding GPDH value. This experiment was repeated three times. Standard deviations are reported. torso-Met induces Dl mRNA synthesis (P < 0.01 at 2 and P < 0.05 at 4 h after heat shock treatment). (E-H) All panels are micrographs of whole-mount embryos carrying the torso-Met and 1-eve-1 chromosomes. The tracheas were evidenced using anti-ß-gal or -2A12 antibodies. The developmental stages in which torso-Met is induced are indicated. (E) Lateral views of stage 10 embryos either untreated (left) or heat shocked (right). Embryos are shown at low (upper panels; scale bar, 35 µm) and high (lower panels, two different focal planes of the highlighted dotted line regions in the upper panels; scale bar, 12 µm) magnifications. All the tracheal cells of torso-Met mutants display a scattered migration. (F) Lateral (left) and dorsal (right) views of stage 15 embryos either untreated (upper panels) or heat shocked (lower panels). torso-Met induces supernumerary tracheal branches (asterisk in the second row). Scale bar, 35 µm. (G) Lateral views of stage 14 embryos either untreated (upper panels) or heat shocked (lower panels). Embryos are shown at low (left; scale bar, 20 µm) and high (right; scale bar, 12 µm) magnifications. Migration of the dorsal branches is severely impaired (asterisks), and occasionally cells detach form the tracheal tree (arrowhead). (H) Cephalic regions (upper panels; scale bar, 15 µm) and dorsal tracheal branches comprised from metamer 1 to 3 (lower panels; scale bar, 20 µm) of stage 17 embryos either untreated (left panels) or heat shocked (right panels). torso-Met embryos develop extra secondary and terminal dorsal branches (asterisks).

Active Met stimulates Notch function in Drosophila. To analyze whether Met activation results in induction of Notch function also in Drosophila, we employed semiquantitative RT-PCR to measure the overall expression of the Notch ligand Delta, which is responsible for Notch activation in the tracheal system (21, 28), in wild-type and torso-Met embryos. Consistent with the findings obtained in mammalian cells, embryos expressing torso-Met displayed an increase in Delta transcripts, which peaked 2 h after heat shock treatment (Fig. 6D).

Phenotypic analysis of the tracheal tree in Met-expressing Drosophila. To analyze the embryonic tracheal tree of torso-Met embryos, transformant flies were crossed with flies bearing the enhancer trap line 1-eve-1, which expresses the bacterial protein ß-gal in all tracheal cells throughout development. The tracheas were detected with antibodies against ß-gal protein or with the antibody 2A12, a marker of terminal tracheal differentiation that recognizes a glycoprotein secreted in the tracheal lumen. The heat shock treatment used for transgene expression did not alter the tracheal trees of embryos resulting from the cross of wild-type and 1-eve-1 flies (data not shown). Since the tracheas of these embryos were indistinguishable from those of uninduced embryos carrying the 1-eve-1 and torso-Met chromosomes, we elected uninduced 1-eve-1; torso-MET embryos as control organisms. About 50% of the heat-shocked embryos resulting from the cross between torso-Met and 1-eve-1 flies that expressed ß-gal protein displayed tracheal alterations.

In the first stages of tracheal development, when the tracheal placodes start to invaginate to form the tracheal pits, expression of torso-Met resulted in scattering of the cells that compose the tracheal pits, which appeared as starred aggregates of loosely associated cells (Fig. 6E), whereas in the immediately subsequent developmental stage, torso-Met led to the formation of supernumerary tracheal branches (Fig. 6F, second row). At later stages of development, the cells that form the primary dorsal branches start a highly coordinated migratory program towards the dorsal side of the embryo that ends up in the formation of the secondary and terminal dorsal tracheal branches. When expressed in this stage, torso-Met impaired this stereotyped migratory behavior (Fig. 6G). The cells that compose the stalk were much more disorganized and, in some cases, one of the uppermost two-paired cells acquired an unusual migratory route, eventually breaking its connection with the neighboring cells. As a consequence, the formation of dorsal secondary and terminal tracheal branches was severely affected (Fig. 6H), resulting in the presence of unfused dorsal branches and an excess of terminal branches.

In summary, these results suggest that exogenous expression of active Met amplifies the overall genetic program of Drosophila tracheal morphogenesis, with enhanced sprouting, primitive hyperbranching, and increased terminal ramification.

Absence of Notch enhances Met-dependent tracheal phenotype in Drosophila. If in invertebrates, as in vertebrates, Notch elicits an inhibitory effect on Met-dependent branching morphogenesis, then abrogation of Notch gene function in Drosophila embryos should enhance torso-Met-controlled tracheal branching.

Accordingly, we expressed torso-Met in flies bearing the mutation encoded by the NCo allele, which lacks the intracellular portion of the receptor and behaves as a dominant negative (62). Moreover, since NCo is an antimorphic allele, the severity of the phenotype may be modulated by the dose of wild-type allele present in the embryo. Males bearing the NCo allele were crossed with torso-Met females carrying a balancer chromosome labeled with ß-gal. In the progeny of this cross, the tracheas were evidenced using 2A12 antibody and the embryos were genotyped using anti-ß-gal antibodies and antibodies raised against the C-terminal portion of Notch receptor; embryos lacking ß-gal staining and expressing barely detectable full-length Notch protein were considered having the genotype NCo/+; torso-Met/+.

The NCo mutants presented the typical alteration of Notch loss-of-function mutants (Fig. 7, second row): the dorsal trunk showed conspicuous interruptions; some dorsal branches were irregularly fused, and some others were missing. Interestingly, when analyzing the tracheal trees following activation of torso-Met in NCo mutants, we found that lack of Notch function results in enhanced tracheal branching. In particular, the terminal portions of the tracheas, instead of being blunt-end tubes, as in torso-Met and NCo mutants (Fig. 7, first and second rows), developed additional ramifications with reiterated segmentations of the distal tips (Fig. 7, third row).



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 7. Met-dependent tracheal branching is enhanced in embryos lacking Notch gene function. (A) All micrographs show whole-mount embryos stained with the antibody 2A12. Genotypes are indicated. Notch refers to the antimorphic allele NCo. The same embryos are shown as lateral (first and second columns; LV) and dorsal (third and fourth columns; DV) views, at low and high magnifications (scale bar, 35 µm and 8 µm, respectively); the discontinuous lines mark the dorsal trunks, which are out of focus, and the arrowheads mark the tips of the branches. Embryos were heat shocked 3 to 4 h after embryonic laying and fixed at stage 15. The tips of the branches are stunned in torso-Met and Notch mutant embryos (first, second, and fourth rows), whereas expression of torso-Met in Notch heterozygous mutant embryos leads to branching in the tracheal tips (third row). This branching is even more enhanced in embryos in which the dose of wild-type Notch is further reduced (fifth row). (B) Quantification of the phenotypes described in panel A. One hundred embryos and 200 tracheal tips were scored for each genotype.

To confirm the finding that inhibition of Notch activity results in enhanced branching effects of torso-Met on terminal tracheation, we took advantage of the antimorphic properties of NCo to increase the dose of this allele versus wild-type Notch, thus enforcing the dominant negative activity induced by NCo. To this aim, females harboring the genotype NCo/+; torso-Met/+ were mated with males bearing torso-Met and a ß-gal-labeled second balancer chromosome. The resulting progeny (NCo/Y; torso-Met/+) displayed gross developmental alterations, most likely as a consequence of the high dominant negative activity of NCo that suppresses the maternal contribution of wild-type Notch (for comparison, see Fig. 7, fourth row). However, although rudimentary, the tracheas still developed and displayed many terminal branches (Fig. 7, fifth row), which appeared more ramified and elongated than those observed in NCo/+; torso-Met/+ embryos (Fig. 7, compare the third and fifth rows). Therefore, further reduction of Notch function results in potentiation of torso-Met-dependent extrabranching. This overbranching phenotype is likely due to the possibility for exogenous Met to hyperactivate the Ras pathway in the absence of Notch, which in turn results in potentiation of terminal tracheogenesis. Indeed, the crucial role of Ras in Drosophila tracheogenesis has been repeatedly documented (21, 28). In contrast, we could not explore direct transcriptional repression of Met by Notch in Drosophila because, in this system, Met is under the control of an artificial promoter.


arrow
DISCUSSION
 
In this paper we demonstrate that Notch is an inhibitor of Met-dependent branching morphogenesis and invasive growth. This inhibitory activity resides in two major mechanisms. First, Notch suppresses Met transcription. So far, the only other example of vertebrate tyrosine kinase receptor that can be transcriptionally down-regulated by Notch is VEGF receptor-2/KDR, which is crucially involved in the control of another paradigmatic example of branching morphogenesis, the capillary sprouting of endothelial cells (56). The transcriptional suppression elicited by Notch requires induction of genes belonging to the HES family. These genes encode class C helix-loop-helix proteins that act mainly as transcriptional suppressors by binding to specific consensus sequences in the promoters of the target genes (22, 32). Here we show that HES-1 binds in vitro to the class C consensus site contained within the Met promoter and that mutagenesis of such a responsive element results in increased Met transcription. Moreover, we demonstrate that HES-1 is sufficient to induce Met down-regulation and that inactivation of this transcription factor abrogates Notch-dependent inhibition of Met synthesis.

A second level of negative regulation relies on the ability of Notch to suppress Met-dependent activation of the Ras-MAPK cascade. The interactions between Ras and Notch are complex. Much evidence, both in invertebrates and in vertebrates, suggests that the Ras pathway has a role in Notch activation, but at the same time Ras can be a target of either Notch-mediated activation or suppression (2, 7, 8, 14, 21, 28, 61). Our data show that the final outcome of a constitutive activation of Notch is a dominant inhibition of HGF-dependent Ras activation.

Notch-dependent down-regulation of Met can be dynamically induced by Met itself. We found that activation of Met results in stimulation of Notch signaling by transient transcriptional induction of its Delta ligands. This suggests the existence of a negative loop in which Met, through Delta, activates Notch. Notch then acts by inhibiting Met. This conclusion if further supported by the evidence that Met activation results in transcription of HES-1, a critical nuclear effector of Notch (see above) (1, 23, 31, 44, 59). The identification of Delta and HES-1 as transcriptional targets of Met activity expands the inventory of the Met transcriptome that, so far, includes only a handful of mechanical regulators of cell movement and survival, such as matrix components (33) and matrix proteases (13, 19).

Here we exploited the versatility of the Drosophila system as a feasible model to assess the interactions between Met and Notch in vivo. As a phenotypic readout of genetic analysis, we chose the development of the embryonic tracheal tree, where the function of Notch has been thoroughly analyzed (21, 28).

In Drosophila, expression of an active form of Met induces transcription of the Notch ligand Delta, as in mammalian cells (see above). Moreover, it leads to scattering of the cells that compose the tracheal pits, potentiates the migratory behavior of the primary and secondary tracheal branches and determines the formation of supernumerary tracheal tubes. All these cues are remarkably similar to the morphogenetic processes controlled by the HGF/Met system in vertebrates, namely dissociation of epithelial cells from their original site of accretion and cell reorganization to generate protrusions that bifurcate and expand, eventually resulting in an arborescent pattern of polarized tubules (43). In embryos lacking Notch gene function, Met amplifies tracheal tubulogenesis, in agreement with the inhibitory role of Notch over Met-dependent morphogenesis postulated in this paper.

In conclusion, our findings suggest that Met can self-limit the strength and duration of its positive signals by a twofold mechanism: on the one hand, Met-dependent induction of Notch function leads to a direct repression of Met levels; on the other, Notch can further subsidize this negative tuning by decreasing Ras signaling, with consequent lessening of Met-dependent transduction pathways. This unconventional mechanism of Met negative modulation goes along with the well-established roles of receptor endocytosis and ubiquitin-mediated degradation for attenuation of receptor signaling (12, 40). A delicate balance between positive and negative signals is critical for normal cell homeostasis, and a prevalence of positive signals leading to excessive cell stimulation is commonly found in cancers. Not surprisingly, aberrant execution of HGF-dependent invasive growth in neoplastic cells leads to cancer invasion and metastasis. The finding that Notch can efficiently harness Met-dependent transcription and Met signaling discloses a novel inhibitory pathway that might be exploited to hamper Met-based cancer progression.


arrow
ACKNOWLEDGMENTS
 
P. Larghero and E. Laguzzi were of invaluable help during the early stages of this work. We thank T. Sudo, S. Herzig, S. Roth, M. Affolter, and F. Sprenger for sharing reagents, all the colleagues and especially the "Lilla's group," and E. Audero and L. Primo for helpful discussions and comments. We acknowledge N. Azpiazu for critical reading of the manuscript. We are grateful to A. Cignetto for secretarial assistance. The excellent technical assistance of L. Palmas, R. Albano, F. Grasso, and S. Tyenga is acknowledged.

This work was supported by research grants of AIRC, CNR-MIUR, FIRB-MIUR, MIUR-PRIN, and the Foundation Compagnia di San Paolo to P.M.C.


arrow
FOOTNOTES
 
* Institute for Cancer Research and Treatment (IRCC), University of Turin School of Medicine, Division of Molecular Oncology, IV Floor, Str. Prov. 142, Km. 3,95, 10060 Candiolo, Torino, Italy. Phone: (39) 011 9933232. Fax: (39) 011 9933225. E-mail: mariacristina.stella{at}ircc.it. Back


arrow
REFERENCES
 
    1
  1. Bardelli, A., M. L. Basile, E. Audero, S. Giordano, S. Wennstrom, S. Menard, P. M. Comoglio, and C. Ponzetto. 1999. Concomitant activation of pathways downstream of Grb2 and PI 3-kinase is required for MET-mediated metastasis. Oncogene 18:1139-1146.[CrossRef][Medline]
  2. 2
  3. Berset, T., E. F. Hoier, G. Battu, S. Canevascini, and A. Hajnal. 2001. Notch inhibition of RAS signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 291:1055-1058.[Abstract/Free Full Text]
  4. 3
  5. Blume-Jensen, P., and T. Hunter. 2001. Oncogenic kinase signalling. Nature 411:355-365.[CrossRef][Medline]
  6. 4
  7. Boccaccio, C., M. Ando, L. Tamagnone, A. Bardelli, P. Michieli, C. Battistini, and P. M. Comoglio. 1998. Induction of epithelial tubules by growth factor HGF depends on the STAT pathway. Nature 391:285-288.[CrossRef][Medline]
  8. 5
  9. Bussolino, F., M. F. Di Renzo, M. Ziche, E. Bocchietto, M. Olivero, L. Naldini, G. Gaudino, L. Tamagnone, A. Coffer, and P. M. Comoglio. 1992. Hepatocyte growth factor is a potent angiogenic factor which stimulates endothelial cell motility and growth. J. Cell Biol. 119:629-641.[Abstract/Free Full Text]
  10. 6
  11. Campos-Ortega, A., and V. Hartenstein. 1997. The embryonic development of Drosophila melanogaster, 2nd ed. Springer-Verlag KG, Berlin, Germany.
  12. 7
  13. Carmena, A., E. Buff, M. S. Halfon, S. Gisselbrecht, F. Jimenez, M. K. Baylies, and A. M. Michelson. 2002. Reciprocal regulatory interactions between the Notch and Ras signaling pathways in the Drosophila embryonic mesoderm. Dev. Biol. 244:226-242.[CrossRef][Medline]
  14. 8
  15. Chihara, T., and S. Hayashi. 2000. Control of tracheal tubulogenesis by Wingless signaling. Development 127:4433-4442.[Abstract]
  16. 9
  17. Coligan, S. E., B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. Wingfield. 1998. Current protocols in protein science, vol. 1. J. Wiley & Sons, Inc., New York, N.Y.
  18. 10
  19. Danilkovitch-Miagkova, A., and B. Zbar. 2002. Dysregulation of Met receptor tyrosine kinase activity in invasive tumors. J. Clin. Investig. 109:863-867.[CrossRef][Medline]
  20. 11
  21. Dickson, B., F. Sprenger, and E. Hafen. 1992. Prepattern in the developing Drosophila eye revealed by an activated torso-sevenless chimeric receptor. Genes Dev. 6:2327-2339.[Abstract/Free Full Text]
  22. 12
  23. Dikic, I., and S. Giordano. 2003. Negative receptor signalling. Curr. Opin. Cell Biol. 15:128-135.[CrossRef][Medline]
  24. 13
  25. Dunsmore, S., J. Rubin, S. Kovacs, M. Chedid, W. Parks, and H. Welgus. 1996. Mechanisms of hepatocyte growth factor stimulation of keratinocyte metalloproteinase production. J. Biol. Chem. 271:24576-24582.[Abstract/Free Full Text]
  26. 14
  27. Fitzgerald, K., A. Harrington, and P. Leder. 2000. Ras pathway signals are required for notch-mediated oncogenesis. Oncogene 19:4191-4198.[CrossRef][Medline]
  28. 15
  29. Gambarotta, G., S. Pistoi, S. Giordano, P. M. Comoglio, and C. Santoro. 1994. Structure and inducible regulation of the human MET promoter. J. Biol. Chem. 269:12852-12857.[Abstract/Free Full Text]
  30. 16
  31. Giordano, S., A. Bardelli, Z. Zhen, S. Menard, C. Ponzetto, and P. M. Comoglio. 1997. A point mutation in the MET oncogene abrogates metastasis without affecting transformation. Proc. Natl. Acad. Sci. USA 94:13868-13872.[Abstract/Free Full Text]
  32. 17
  33. Gray, G., R. Mann, R. Mitsiadis, D. Henrique, M. Carcangiu, A. Banks, J. Leiman, D. Ward, D. Ish-Horowitz, and S. Artavanis-Tsakonas. 1999. Human ligands of the Notch receptor. Am. J. Pathol. 154:785-794.[Abstract/Free Full Text]
  34. 18
  35. Gual, P., S. Giordano, T. Williams, S. Rocchi, E. Van Obberghen, and P. Comoglio. 2000. Sustained recruitment of phospholipase C-gamma to Gab1 is required for HGF-induced branching tubulogenesis. Oncogene 19:1509-1518.[CrossRef][Medline]
  36. 19
  37. Harvey, P., I. Clark, M. Jaurand, R. Warn, and D. Edwards. 2000. Hepatocyte growth factor/scatter factor enhances the invasion of mesothelioma cell lines and the expression of matrix metalloproteinases. Br. J. Cancer 89:1147-1153.
  38. 20
  39. Herzig, S., S. Hedrick, I. Morantte, S. H. Koo, F. Galimi, and M. Montminy. 2003. CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR-gamma. Nature 426:190-193.[CrossRef][Medline]
  40. 21
  41. Ikeya, T., and S. Hayashi. 1999. Interplay of Notch and FGF signaling restricts cell fate and MAPK activation in the Drosophila trachea. Development 126:4455-4463.[Abstract]
  42. 22
  43. Iso, T., L. Kedes, and Y. Hamamori. 2003. HES and HERP families: multiple effectors of the Notch signaling pathway. J. Cell. Physiol. 194:237-255.[CrossRef][Medline]
  44. 23
  45. Joutel, A., and E. Tournier-Lasserve. 1998. Notch signaling pathway and human diseases. Semin. Cell Dev. Biol. 9:619-625.[CrossRef][Medline]
  46. 24
  47. Kawaida, K., K. Matsumoto, H. Shimazu, and T. Nakamura. 1994. Hepatocyte growth factor prevents acute renal failure and accelerates renal regeneration in mice. Proc. Natl. Acad. Sci. USA 91:4357-4361.[Abstract/Free Full Text]
  48. 25
  49. Khwaja, A., K. Lehmann, B. M. Marte, and J. Downward. 1998. Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway. J. Biol. Chem. 273:18793-18801.[Abstract/Free Full Text]
  50. 26
  51. Lindsell, C. E., C. J. Shawber, J. Boulter, and G. Weinmaster. 1995. Jagged: a mammalian ligand that activates Notch1. Cell 80:909-917.[CrossRef][Medline]
  52. 27
  53. Liu, Z. J., T. Shirakawa, Y. Li, A. Soma, M. Oka, G. P. Dotto, R. M. Fairman, O. C. Velazquez, and M. Herlyn. 2003. Regulation of Notch1 and Dll4 by vascular endothelial growth factor in arterial endothelial cells: implications for modulating arteriogenesis and angiogenesis. Mol. Cell. Biol. 23:14-25.[Abstract/Free Full Text]
  54. 28
  55. Llimargas, M. 1999. The Notch pathway helps to pattern the tips of the Drosophila tracheal branches by selecting cell fates. Development 126:2355-2364.[Abstract]
  56. 29
  57. Maher, J. J. 1993. Cell-specific expression of hepatocyte growth factor in liver. Upregulation in sinusoidal endothelial cells after carbon tetrachloride. J. Clin. Investig. 91:2244-2252.
  58. 30
  59. Mailhos, C., U. Modlich, J. Lewis, A. Harris, R. Bicknell, and D. Ish-Horowicz. 2001. Delta4, an endothelial specific notch ligand expressed at sites of physiological and tumor angiogenesis. Differentiation 69:135-144.[CrossRef][Medline]
  60. 31
  61. Maina, F., G. Pante, F. Helmbacher, R. Andres, A. Porthin, A. M. Davies, C. Ponzetto, and R. Klein. 2001. Coupling Met to specific pathways results in distinct developmental outcomes. Mol. Cell 7:1293-1306.[CrossRef][Medline]
  62. 32
  63. Massari, M. E., and C. Murre. 2000. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20:429-440.[Free Full Text]
  64. 33
  65. Medico, E., G. Gambarotta, A. Gentile, P. M. Comoglio, and P. Soriano. 2001. A gene trap vector system for identifying transcriptionally responsive genes. Nat. Biotechnol. 19:579-582.[CrossRef][Medline]
  66. 34
  67. Michieli, P., C. Basilico, S. Pennacchietti, A. Maffe, L. Tamagnone, S. Giordano, A. Bardelli, and P. M. Comoglio. 1999. Mutant Met-mediated transformation is ligand-dependent and can be inhibited by HGF antagonists. Oncogene 18:5221-5231.[CrossRef][Medline]
  68. 35
  69. Morgenstern, J. P., and H. Land. 1990. A series of mammalian expression vectors and characterisation of their expression of a reporter gene in stably and transiently transfected cells. Nucleic Acids Res. 18:1068-1078.[Free Full Text]
  70. 36
  71. Nagaike, M., S. Hirao, H. Tajima, S. Noji, S. Taniguchi, K. Matsumoto, and T. Nakamura. 1991. Renotropic functions of hepatocyte growth factor in renal regeneration after unilateral nephrectomy. J. Biol. Chem. 266:22781-22784.[Abstract/Free Full Text]
  72. 37
  73. Naldini, L., E. Vigna, A. Bardelli, A. Follenzi, F. Galimi, and P. M. Comoglio. 1995. Biological activation of pro-HGF (hepatocyte growth factor) by urokinase is controlled by a stoichiometric reaction. J. Biol. Chem. 270:603-611.[Abstract/Free Full Text]
  74. 38
  75. Nijjar, S. S., L. Wallace, H. A. Crosby, S. G. Hubscher, and A. J. Strain. 2002. Altered Notch ligand expression in human liver disease: further evidence for a role of the Notch signaling pathway in hepatic neovascularization and biliary ductular defects. Am. J. Pathol. 160:1695-1703.[Abstract/Free Full Text]
  76. 39
  77. Pennacchietti, S., P. Michieli, M. Galluzzo, M. Mazzone, S. Giordano, and P. M. Comoglio. 2003. Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3:347-361.[CrossRef][Medline]
  78. 40
  79. Petrelli, A., G. F. Gilestro, S. Lanzardo, P. M. Comoglio, N. Migone, and S. Giordano. 2002. The endophilin-CIN85-Cbl complex mediates ligand-dependent downregulation of c-Met. Nature 416:187-190.[CrossRef][Medline]
  80. 41
  81. Ponzetto, C., A. Bardelli, Z. Zhen, F. Maina, P. dalla Zonca, S. Giordano, A. Graziani, G. Panayotou, and P. M. Comoglio. 1994. A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter factor receptor family. Cell 77:261-271.[CrossRef][Medline]
  82. 42
  83. Ponzetto, C., Z. Zhen, E. Audero, F. Maina, A. Bardelli, M. L. Basile, S. Giordano, R. Narsimhan, and P. Comoglio. 1996. Specific uncoupling of GRB2 from the Met receptor. Differential effects on transformation and motility. J. Biol. Chem. 271:14119-14123.[Abstract/Free Full Text]
  84. 43
  85. Rosario, M., and W. Birchmeier. 2003. How to make tubes: signaling by the Met receptor tyrosine kinase. Trends Cell Biol. 13:328-335.[CrossRef][Medline]
  86. 44
  87. Royal, I., N. Lamarche-Vane, L. Lamorte, K. Kaibuchi, and M. Park. 2000. Activation of cdc42, rac, PAK, and rho-kinase in response to hepatocyte growth factor differentially regulates epithelial cell colony spreading and dissociation. Mol. Biol. Cell 11:1709-1725.[Abstract/Free Full Text]
  88. 45
  89. Royal, I., and M. Park. 1995. Hepatocyte growth factor-induced scatter of Madin-Darby canine kidney cells requires phosphatidylinositol 3-kinase. J. Biol. Chem. 270:27780-27787.[Abstract/Free Full Text]
  90. 46
  91. Sambrock, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  92. 47
  93. Sander, E. E., S. van Delft, J. P. ten Klooster, T. Reid, R. A. van der Kammen, F. Michiels, and J. G. Collard. 1998. Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either cell-cell adhesion or cell migration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol. 143:1385-1398.[Abstract/Free Full Text]
  94. 48
  95. Schlessinger, J. 2000. Cell signaling by receptor tyrosine kinases. Cell 103:211-225.[CrossRef][Medline]
  96. 49
  97. Shirayoshi, Y., Y. Yuasa, T. Suzuki, K. Sugaya, E. Kawase, T. Ikemura, and N. Nakatsuji. 1997. Proto-oncogene of int-3, a mouse Notch homologue, is expressed in endothelial cells during early embryogenesis. Genes Cells 2:213-224.[Abstract]
  98. 50
  99. Shutter, J., S. Scully, W. Fan, W. Richards, J. Kitajewski, G. Deblandre, C. Kintner, and K. Stark. 2000. Dll4, a novel Notch ligand expressed in arterial endothelium. Genes Dev. 14:1313-1318.[Abstract/Free Full Text]
  100. 51
  101. Smith, G. H., D. Gallahan, F. Diella, C. Jhappan, G. Merlino, and R. Callahan. 1995. Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development. Cell Growth Differ. 6:563-577.[Abstract]
  102. 52
  103. Soriano, J. V., M. S. Pepper, T. Nakamura, L. Orci, and R. Montesano. 1995. Hepatocyte growth factor stimulates extensive development of branching duct-like structures by cloned mammary gland epithelial cells. J. Cell Sci. 108:413-430.[Abstract]
  104. 53
  105. Sprenger, F., and C. Nuesslein-Volhard. 1992. Torso receptor activity is regulated by a diffusible ligand produced at the extracellular terminal regions of the Drosophila egg. Cell 71:987-1001.[CrossRef][Medline]
  106. 54
  107. Tamagnone, L., S. Artigiani, H. Chen, Z. He, G. I. Ming, H. Song, A. Chedotal, M. L. Winberg, C. S. Goodman, M. Poo, M. Tessier-Lavigne, and P. M. Comoglio. 1999. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99:71-80.[CrossRef][Medline]
  108. 55
  109. Tautz, D., and C. Pfeifle. 1989. A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosome 98:81-85.
  110. 56
  111. Taylor, K. L., A. M. Henderson, and C. C. Hughes. 2002. Notch activation during endothelial cell network formation in vitro targets the basic HLH transcription factor HESR-1 and downregulates VEGFR-2/KDR expression. Microvasc. Res. 64:372-383.[CrossRef][Medline]
  112. 57
  113. Trusolino, L., A. Bertotti, and P. M. Comoglio. 2001. A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107:643-654.[CrossRef][Medline]
  114. 58
  115. Trusolino, L., and P. M. Comoglio. 2002. Scatter-factor and semaphorin receptors: cell signalling for invasive growth. Nat. Rev. Cancer 2:289-300.[CrossRef][Medline]
  116. 59
  117. Uyttendaele, H., J. V. Soriano, R. Montesano, and J. Kitajewski. 1998. Notch4 and Wnt-1 proteins function to regulate branching morphogenesis of mammary epithelial cells in an opposing fashion. Dev. Biol. 196:204-217.[CrossRef][Medline]
  118. 60
  119. Valsecchi, V., C. Ghezzi, A. Ballabio, and E. I. Rugarli. 1997. JAGGED2: a putative Notch ligand expressed in the apical ectodermal ridge and in sites of epithelial-mesenchymal interactions. Mech. Dev. 69:203-207.[CrossRef][Medline]
  120. 61
  121. Weijzen, S., P. Rizzo, M. Braid, R. Vaishnav, S. M. Jonkheer, A. Zlobin, B. A. Osborne, S. Gottipati, J. C. Aster, W. C. Hahn, M. Rudolf, K. Siziopikou, W. M. Kast, and L. Miele. 2002. Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nat. Med. 8:979-986.[CrossRef][Medline]
  122. 62
  123. Wesley, C. S., and L. Saez. 2000. Analysis of Notch lacking the carboxyl terminus identified in Drosophila embryos. J. Cell Biol. 149:683-696.[Abstract/Free Full Text]
  124. 63
  125. Wieschaus, E., and C. Nuesslein-Volhard. 1998. Looking at embryos, p. 179-214. In D. B. Roberts (ed.), Drosophila, a practical approach. IRL Press, Oxford, England.
  126. 64
  127. Yan, B., N. Rabe, and H. Plotz. 2002. HES-1, a known transcriptional repressor, acts as a transcriptional activator for the human acid {alpha}-glucosidase gene in human fibroblast cells. Biochem. Biophys. Res. Commun. 291:582-587.[CrossRef][Medline]
  128. 65
  129. Yang, Y., E. Spitzer, D. Meyer, M. Sachs, C. Niemann, G. Hartmann, K. M. Weidner, C. Birchmeier, and W. Birchmeier. 1995. Sequential requirement of hepatocyte growth factor and neuregulin in the morphogenesis and differentiation of the mammary gland. J. Cell Biol. 131:215-226.[Abstract/Free Full Text]
  130. 66
  131. Zayzafoon, M., S. A. Abdulkadir, and J. M. McDonald. 2004. Notch signaling and ERK activation are important for the osteomimetic properties of prostate cancer bone metastatic cell lines. J. Biol. Chem. 279:3662-3670.[Abstract/Free Full Text]


Molecular and Cellular Biology, May 2005, p. 3982-3996, Vol. 25, No. 10
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.10.3982-3996.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Mascarenhas, J. B., Young, K. P., Littlejohn, E. L., Yoo, B. K., Salgia, R., Lang, D. (2009). PAX6 Is Expressed in Pancreatic Cancer and Actively Participates in Cancer Progression through Activation of the MET Tyrosine Kinase Receptor Gene. J. Biol. Chem. 284: 27524-27532 [Abstract] [Full Text]  
  • Dai, T. (2009). Notch Signaling and Cancer. aacredbook 2009: 71-79 [Full Text]  
  • Stella, M. C., Trusolino, L., Comoglio, P. M. (2009). The Slit/Robo System Suppresses Hepatocyte Growth Factor-dependent Invasion and Morphogenesis. Mol. Biol. Cell 20: 642-657 [Abstract] [Full Text]  
  • Gude, N. A., Emmanuel, G., Wu, W., Cottage, C. T., Fischer, K., Quijada, P., Muraski, J. A., Alvarez, R., Rubio, M., Schaefer, E., Sussman, M. A. (2008). Activation of Notch-Mediated Protective Signaling in the Myocardium. Circ. Res. 102: 1025-1035 [Abstract] [Full Text]  
  • Beuret, L., Flori, E., Denoyelle, C., Bille, K., Busca, R., Picardo, M., Bertolotto, C., Ballotti, R. (2007). Up-regulation of MET Expression by {alpha}-Melanocyte-stimulating Hormone and MITF Allows Hepatocyte Growth Factor to Protect Melanocytes and Melanoma Cells from Apoptosis. J. Biol. Chem. 282: 14140-14147 [Abstract] [Full Text]  
  • Ku, T. K.S., Nguyen, D. C., Karaman, M., Gill, P., Hacia, J. G., Crowe, D. L. (2007). Loss of p53 Expression Correlates with Metastatic Phenotype and Transcriptional Profile in a New Mouse Model of Head and Neck Cancer. Mol Cancer Res 5: 351-362 [Abstract] [Full Text]  
  • Hoffmann, K. M., Tapia, J. A., Berna, M. J., Thill, M., Braunschweig, T., Mantey, S. A., Moody, T. W., Jensen, R. T. (2006). Gastrointestinal Hormones Cause Rapid c-Met Receptor Down-regulation by a Novel Mechanism Involving Clathrin-mediated Endocytosis and a Lysosome-dependent Mechanism. J. Biol. Chem. 281: 37705-37719 [Abstract] [Full Text]  
  • Mazzone, M., Comoglio, P. M. (2006). The Met pathway: master switch and drug target in cancer progression. FASEB J. 20: 1611-1621 [Abstract] [Full Text]  
  • Sundaram, M. V. (2005). The love-hate relationship between Ras and Notch. Genes Dev. 19: 1825-1839 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stella, M. C.
Right arrow Articles by Comoglio, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stella, M. C.
Right arrow Articles by Comoglio, P. M.