![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Pharmacology and Therapeutics, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, New York 14263
Received 10 September 2004/ Returned for modification 20 October 2004/ Accepted 23 February 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It is currently unknown whether metazoan species with long, intron-containing genes utilize an analogous mechanism to couple transcriptional elongation and RNA processing. Human structural homologues are apparent in the protein databases only for some yeast TREX proteins, including Tho2 (yeast THO component Tho2p), UAP56 (yeast RNA export factor Sub2p), and Aly (yeast RNA export factor Yra1p) (18, 28, 31, 33). In vitro pulldown assays, however, have identified additional human proteins that associate with a glutathione S-transferase (GST)-UAP56 fusion protein (30). These proteins may represent additional components of human THO or TREX complexes. It is unknown whether any of these putative human THO/TREX proteins regulate transcriptional elongation, whether they associate with each other in intact cells, or whether they bind elongating RNA PolII.
One of the proteins interacting with GST-UAP56 has previously been discovered based on its ability to associate with the retinoblastoma tumor suppressor protein (Rb1) and originally named p84 (9). The gene and its encoded protein are also referred to as hHpr1 and p84N5. The official symbol as annotated in the human genome database is Thoc1. Here we will refer to the gene as Thoc1 and its encoded protein as pThoc1. While pThoc1 does not show overall, statistically significant, primary amino acid sequence similarity to known yeast TREX proteins in BLASTP alignments, its primary sequence and predicted molecular mass most closely match those of yeast THO component Hpr1p. In this study, we explore the hypothesis that pThoc1 is a functional orthologue of yeast Hpr1p. Consistent with this hypothesis pThoc1 binds UAP56, human Tho2, and elongating forms of RNA PolII in intact cells. Depletion of pThoc1 compromises the expression of some genes due to a molecular defect in transcriptional elongation similar to that observed in Hpr1p-deficient yeast. Other cellular phenotypes previously associated with loss of Hpr1p, including slow growth, increased sensitivity to DNA damage, and defects in nucleotide excision repair (NER), are also observed in pThoc1-depleted human cells. We conclude that pThoc1 is required for the normal transcriptional elongation of some human genes and physically links transcribing RNA PolII to the RNA splicing and export factor UAP56. We suggest that pThoc1 is a human functional orthologue of yeast Hpr1p and participates in a human protein complex analogous to yeast TREX, coupling the processes of transcriptional elongation and RNA processing.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cloning of the pThoc1 full-length cDNA was described previously (8, 9). The UAP56 and Tho2 cDNAs were cloned by PCR amplification from total HeLa cell cDNA generated using the SMART cDNA synthesis procedure (Clontech, Palo Alto, CA). The cDNAs were subcloned into pDNR-CMV (Clontech, Palo Alto, CA) or pCEP4 (Invitrogen, Carlsbad, CA), and the coding DNA sequences were verified against published sequences. The *pThoc1 expression plasmids were constructed by mutating the Thoc1 cDNA to introduce silent mutations in codons 472 and 473 of the pThoc1 cDNA (wild-type GAA CAG to GAG CAA) by the QuikChange method (Stratagene, La Jolla, CA). For expression of green fluorescent protein (GFP) fusion proteins, the cDNAs were transferred to pLP-EGFP-C1 (Clontech, Palo Alto, CA) by in vitro cre-mediated recombination. Plasmids were introduced into cultured cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendations.
Adenoviral stocks were obtained from the University of Texas M. D. Anderson Cancer Center Vector Core Facility and used as recommended. Expression of the cytomegalovirus (CMV)-lacZ adenoviral gene is driven by the early promoter of CMV. Expression of the GV16-lacZ gene is driven by a promoter responsive to a GAL4-VP16 fusion protein expressed by the Ad/PKG-GV16 adenovirus. Infections were typically performed at a multiplicity of infection of 25 to 50 IU per cell. For the UV reactivation assay, Ad/CMV-GFP was UV irradiated (0.1 to 0.3 J/m2) before infection.
siRNAs. Small interfering RNA (siRNA) oligonucleotides were introduced into cultured cells by transfection with Lipofectamine 2000 as recommended by the manufacturer (Invitrogen, Carlsbad, CA). The concentration of siRNA duplexes used was 10 to 50 nM. The siRNA duplexes directed against pThoc1 were N52 (5'GCCAUUGAACAGGCAGACCdTdT and 5'GGUCUGCCUGUUCAAUGGCdTdT) and N54 (5'CACAUCCUGUUGCAGUAUCdTdT and 5'GAUACUGCAACAGGAUGUGdTdT). The siRNA duplexes directed against UAP56 were UAP562 (5'GUCACACUCGGGAGUUGGCdTdT and 5'GCCAACUCCCGAGUGUGACdTdT) and UAP564 (5'AGAGAUCCGUCCAGUCUGCdTdT and 5'GCAGACUGGACGGAUCUCUdTdT). The Tho2 siRNA duplexes were Tho21 (5'ACACUGGAAUCAUUAGGGCdTdT and 5'GCCCUAAUGAUUCCAGUGUdTdT) and Tho22 (5'GCCAGUCGAUACGGAAGGUdTdT and 5'ACCUUCCGUAUCGACUGGCdTdT). The control N52 M siRNA targets the same region as N52 but contains mismatches to the wild-type sequence (5'GCCAUUAAGCAGGACGACCdTdT and 5"GGUCGUCCUGCUUAAUGGCdTdT). The nonspecific control siRNA duplex (SC) contained scrambled sequence from the firefly luciferase gene (Dharmacon, Lafayette, CO).
Growth and gene expression assays. Cells were extracted, and ß-galactosidase activity was measured by o-nitrophenyl-ß-D-galactopyranoside (ONPG) assay according to the manufacturer's instructions (Promega, Madison, WI). Optical density of samples was measured at 405 nm. ß-Galactosidase activity in intact cells was visualized using 1 mg/ml X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) according to standard procedures. Growth of cells was monitored by direct counting of viable, trypan blue-excluding cells or by XTT assay performed as recommended (Roche Applied Science, Indianapolis, IN) with similar results. After incubation with the XTT labeling reagent, optical density of the samples was measured at 490 nm.
For analysis of RNA, total RNA was extracted from cells using the RNeasy method (QIAGEN, Chatsworth, CA). For reverse transcription (RT), 0.8 µg of total RNA and 50 ng of random primer were used in a 20-µl reaction volume with Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA), followed by PCR amplification with 1 µl of the synthesized cDNA and Taq polymerase (Fermentas, Hanover, MD). The PCR products were resolved by agarose gel electrophoresis and stained with ethidium bromide. The primers used to amplify the respective cDNAs were as follows: pThoc1, 5'CCCTTGACCAAGCTTTCAGA and 5'TTCCCAGCAGCATAGAAGGT; UAP56, 5'ATGGCAGAGAACGATGTG and 5'TAACTGGCTCCAGCTGTT; Tho2, 5'ATGTTTGTTTCAGACACAGT and 5'GTTCCTGGTAAAACTTGAAT; ACC1, 5'TGGCCAGATTCAAGCCATGT and 5'ACCAAGCTGCGGATTTGCTT; calreticulin, 5'ACATGCACGGAGACTCAGAAT and 5'TGTTGTCTGGCCGCACAAT; topoisomerase I, 5'AGGTTCCTTCTCCTCCTCCA and 5' CCTTTTCATTGCCTGCTCTC; ß-actin, 5'GTGGCATCCACGAAACTACC and 5'AGTACTTGCGCTCAGGAGGA.
RNA levels were quantitated by slot or Northern blotting. Total cellular RNA (1 µg to 10 µg) isolated as described above was blotted onto Hybond N+ membrane (Amersham Biosciences Corp, Piscataway, NJ). The blots were hybridized to random-primed, 32P-labeled hybridization probes for lacZ (600 bp spanning the middle of the coding sequence) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in Rapid-hyb buffer (Amersham Biosciences Corp, Piscataway, NJ) at 65°C for 2 h. Blots were washed according to the manufacturer's recommendations, and the radioactive signals were quantitated and visualized using a PhosphorImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
For DNA-RNA hybrid analysis, siRNA-transfected HeLa cells were infected with the CMV-lacZ adenovirus at a multiplicity of infection of 50 and nucleic acid was subsequently extracted by the RNeasy method (QIAGEN, Chatsworth, CA). Four micrograms of total nucleic acid was treated with 3 U of RNase-free DNase I (Promega) for 2 h at 37°C, followed by phenol-chloroform purification and ethanol precipitation. Another 4-µg aliquot was treated with 5 U of RNase H (Fermentas) or RNase H plus RNase A for 2 h at 37°C in 40 mM Tris (pH 8.0)-8 mM MgCl2-50 mM NaCl-3 mM dithiothreitol-2.5 mM spermidine. The samples were purified as described above and then digested with 3 U of RNase-free DNase I. The treated samples were analyzed by RT-PCR as described above or by slot blot analysis. Random prime labeled full-length lacZ or GAPDH cDNA was used as a hybridization probe.
Immunostaining, Western blotting, and immunoprecipitation. For immunostaining, 2 days following transfection cells were washed in phosphate-buffered saline (PBS) and fixed in 4% formaldehyde-10% acetic acid in PBS. Cells were permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate in PBS, washed, and incubated for 1 h at 37°C with mouse anti-pThoc1 antibody diluted 1:1,000 (GeneTex, San Antonio, TX). After washing, cells were incubated for 1 h at 37°C with Texas red anti-mouse immunoglobulin G (IgG) antibody diluted 1:200. Stained cells were analyzed by confocal fluorescent microscopy.
For Western blotting and immunoprecipitation, cells were harvested and washed with ice-cold PBS. Cell pellets were extracted in buffer containing 50 mM Tris (pH 7.4), 250 mM NaCl, 5 mM EDTA, and 0.1% NP-40 and supplemented with a cocktail of protease and phosphatase inhibitors (Sigma, St. Louis, MO). Extracts were clarified by centrifugation, and protein concentration were measured by Bradford assay. For Western blotting, 20 µg of total protein for each sample was resolved by 7.5% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis. The proteins were transferred to polyvinylidene difluoride membrane, and the blot was blocked with 5% nonfat dry milk in 20 mM Tris (pH 7.5)-150 mM NaCl-0.1% Tween 20 (TBST) for 1 h at room temperature. The blot was incubated with primary antibody diluted in fresh TBST-5%milk, and the bound antibody was detected using horseradish peroxidase-conjugated secondary antibody and chemiluminescence (Amersham Biosciences Corp, Piscataway, NJ).
For immunoprecipitation, cell extracts (600 µg to 1 mg of total cell protein) were incubated overnight with rabbit polyclonal antibody directed against pThoc1 or GFP (Clontech, Palo Alto, CA). A GST fusion protein containing the carboxy-terminal half of pThoc1 was used to raise the rabbit anti-pThoc1 antibody. Immune complexes were collected by incubation with protein A/G plus agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) and eluted by boiling in 2x SDS Laemmli loading buffer. Proteins were resolved by 7.5% SDS-polyacrylamide gel electrophoresis and analyzed by Western blotting using 1:1,000-diluted mouse monoclonal GFP antibody (Clontech, Palo Alto, CA), 1:5,000-diluted mouse monoclonal pThoc1 antibody, or H5 monoclonal antibody (Covance, Berkeley, CA).
ChIP.
Formaldehyde cross-linking and chromatin immunoprecipitation (ChIP) were carried out as recommended by the manufacturer (Upstate, Charlottesville, VA). Cells were fixed in Dulbecco modified Eagle medium with 1% formaldehyde. Sonicated, cross-linked chromatin was adjusted to 1x ChIP dilution buffer before immunoprecipitation. Affinity-purified rabbit pThoc1 antibody (see above) or RNA PolII antibody (N-20; Santa Cruz Biotechnology, Santa Cruz, CA) was used to immunoprecipitate protein-chromatin complexes. Preimmune rabbit IgG was used as a negative control. Immunoprecipitated samples were washed in wash buffer I
IV, followed by cross-link reversal and purification of the precipitated chromatin.
Immunoprecipitated DNA was detected by PCR using 2 µl of immunoprecipitated material, 0.5 µM each PCR primer, 2 mM MgCl2, 0.2 mM deoxynucleoside triphosphates, 1x Taq buffer, and 1 U of Taq DNA polymerase (Fermentas, Hanover, MD). The primers used to detect the lacZ gene were as follows: P, 5'TCGGTACCCGGGTCGAGTA (227 bases 5' of the start codon) and 5'TCTTTCGATCCCGGGGAT (28 bases 5' of the start codon); M, 5'ATGGTCAGGTCATGGATG (1,159 bases 3' of the start codon) and 5'TCTCCAGGTAGCGAAAGC (1,640 bases 3' of the start codon); 3', 5'ATGGCGATTACCGTTGAT (2,658 bases 3' of the start codon) and 5'TTTTTGACACCAGACCAA (3,140 bases 3' of the start codon). The primers used to detect the human calreticulin gene were as follows: P, 5'GCGCTCCCGCGGTTTCTTTA (434 bases 5' of the start codon) and 5'TGCCCATGGCCGTCTTTT (170 bases 5' of the start codon); M, 5'TGAGTACAAGGTGAGTTTGG (1,963 bases 3' of the start codon) and 5'CAGCACGCCAAAGTTATC (2,170 bases 3' of the start codon); 3', 5'TAGGAACACAGGTGGAAA (4,775 bases 3' of the start codon) and 5'TTGTTTCTCTGCTGCCTG (5,031 bases 3' of the start codon). Input DNA was diluted 200-fold, and 0.5 µl was analyzed by PCR as described above. Relative PCR signals were quantitated using ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Inhibition of RNA expression in pThoc1-depleted cells. The expression of a subset of yeast genes is dependent on Hpr1p (7). In particular, expression of the bacterial lacZ gene in yeast is highly dependent on Hpr1p, possibly due to its high G+C content (7). We have used the bacterial lacZ gene driven by the early promoter of the CMV and contained within a replication-defective recombinant adenovirus to measure the effects of pThoc1 depletion on gene expression in human cells. siRNA targeting pThoc1 (N52 or N54), but not SC or a point-mutated version of N52 (N52 M), effectively reduces pThoc1 levels but has no detectable effect on the levels of ß-actin (Fig. 2A). Depletion of pThoc1 by N52 or N54 decreases ß-galactosidase activity expressed from the lacZ adenovirus by two- to fivefold relative to cells treated with SC or N52 M (Fig. 2B). To ascertain whether the defect in ß-galactosidase activity extends to RNA expression, lacZ RNA has been assayed by Northern blotting in pThoc1-depleted or control cells. The level of full-length lacZ mRNA decreases upon pThoc1 depletion (Fig. 2C). GAPDH RNA levels are not affected by loss of pThoc1. Consistent with the loss in ß-galactosidase activity, quantitation of lacZ RNA by slot blotting indicates that depletion of pThoc1 causes a twofold reduction in total lacZ RNA relative to control cells (see Fig. 5D; data not shown). To demonstrate the specificity of the observed effects for pThoc1 depletion, we have tested whether ß-galactosidase activity can be rescued by expression of pThoc1 mRNA containing silent mutations in the region targeted by the N52 siRNA (*pThoc1) and thus resistant to siRNA-mediated gene silencing. Cotransfection of the *pThoc1 plasmid with N52 siRNA causes a significant increase in both ß-galactosidase and pThoc1 levels relative to N52-treated cells cotransfected with the empty vector control (Fig. 2D).
|
|
Depletion of pThoc1 causes a transcriptional elongation defect. Reduced lacZ RNA expression may be due to defects in the initiation of transcription. To address this possibility, we have tested whether the effects of pThoc1 depletion on ß-galactosidase activity were dependent on the particular promoter used to drive expression. We have used three different promoters to measure the effects of pThoc1 depletion on lacZ gene expression. In addition to the CMV promoter, lacZ genes utilizing a GAL4VP16 fusion protein-dependent synthetic promoter (GV16) and a tetracycline-inducible synthetic promoter (Tet) have been tested. The CMV-lacZ and GV16-lacZ genes are expressed from within a replication-defective recombinant adenovirus. The Tet-lacZ gene is stably integrated into the HeLa cell genome. Depletion of pThoc1 by N52 treatment decreases ß-galactosidase activity expressed from each of the three lacZ genes tested by two- to sixfold relative to control siRNA-treated cells (Fig. 3A). Hence, the effects of pThoc1 depletion on lacZ expression are promoter independent. The decrease in lacZ expression is specific since GFP expression driven by an identical CMV promoter is relatively unaffected by pThoc1 depletion, perhaps owing to its lower G+C content (GFP at 39% versus lacZ at 56%) (Fig. 3B).
|
|
Hpr1p-deficient yeast cells are more sensitive to transcriptional elongation inhibitors like 6-azauracil (5). To more directly test whether pThoc1 plays a role in transcriptional elongation, we have tested the sensitivity of pThoc1-depleted cells to the transcriptional elongation inhibitor 5,6-dichloro-1-ß-D-ribofuranosylbenzimidazole (DRB). Cells transfected with control siRNA show a dose-dependent decrease in cell viability after treatment with DRB (Fig. 5A) . Cells depleted of pThoc1 are three- to fivefold more sensitive to DRB at a given dose. In contrast, both control and pThoc1-depleted cells are equally sensitive to the protein synthesis inhibitor cycloheximide. Interestingly, treatment with DRB specifically reduces accumulation of soluble pThoc1 protein. pThoc1 levels decrease significantly within 4 h of DRB treatment, despite the fact that a 24-h treatment with cycloheximide affects pThoc1 levels only slightly (Fig. 5B). The effect of DRB on pThoc1 levels is specific since p53 levels increase upon DRB treatment (data not shown), consistent with a recent report by O'Hagan and Ljungman (21). This observation is consistent with specific loss of pThoc1 stability or solubility upon DRB treatment. It is noteworthy that Hpr1p abundance declines in yeast upon genetic depletion of Cdc73p, a component of the Hpr1p-containing Paf1-RNA PolII complex that is distinct from Srbp-containing RNA PolII complexes (4).
Impairment of transcriptional elongation in Hpr1p-deficient yeast is mediated by cotranscriptionally formed, RNase H-sensitive DNA-RNA hybrids (13). To test whether the transcription defect caused by pThoc1 depletion is also associated with increased DNA-RNA hybrid formation, we extracted nucleic acid from pThoc1-depleted cells and assayed for RNase H-sensitive lacZ RNA by RT-PCR and slot blotting. Under the conditions used, RT-PCR of DNase I-treated nucleic acid (total RNA) with primers spanning the middle of the lacZ gene yield similar signals from pThoc1-depleted and control cells (Fig. 5C). Upon RNase H treatment, the RT-PCR signal for the pThoc1-depleted cells is reduced to background levels, while the signal for control cells remains detectable. This suggests that upon pThoc1 depletion a significant fraction of lacZ RNA spanning the analyzed region is sensitive to RNase H and thus at least partially in the form of a DNA-RNA hybrid. To quantitate the relative extent of DNA-RNA hybrid formation, we slot blotted nuclease-treated nucleic acid and probed using the full-length lacZ cDNA. In control cells, the RNase H-resistant RNA signal (RNase H then DNase I) is 48% of the total lacZ RNA signal (DNase I) as quantitated by a phosphorimager analysis (Fig. 4D and E). In pThoc1-depleted cells, however, the RNase H-resistant signal is only 27% of the total lacZ RNA signal. Hence, there is an increase in the proportion of RNase H-sensitive lacZ RNA upon pThoc1 depletion, consistent with increased formation of DNA-RNA hybrids. In wild-type yeast cells, the fraction of lacZ RNA detected in DNA-RNA hybrids is lower than that measured in control cells here (5% versus 50%) (13). This could be due to the different methods employed to detect DNA-RNA hybrids (RNase A resistance versus RNase H sensitivity), differences in the structure of the lacZ genes used, or biological differences between yeast and human cells.
Secondary phenotypes associated with pThoc1 depletion. Hpr1p-deficient yeast cells are associated with additional phenotypes, including a reduced growth rate (26). We have measured cell proliferation in several cell lines in the presence or absence of normal levels of pThoc1. The growth rate of pThoc1-depleted 293 cells is reduced for 3 days posttransfection compared to control cells (Fig. 6A). Between 3 and 4 days posttransfection, the growth rate of N52-transfected cells increase to near normal levels, coincident with recovery of normal pThoc1 levels (data not shown). Four additional cell lines have been transfected with N52 or control siRNA, and the effects on cell proliferation were measured. In three of the cell lines, N52 transfection is accompanied by a decrease in cell accumulation (Fig. 6B). One cell line, C33a, grows at a similar rate whether transfected with N52 or SC. However, N52 siRNA transfection does not efficiently deplete pThoc1 in this cell line (Fig. 6C). Hence, in all cell lines examined, there is a correlation between pThoc1 levels and cell growth rate.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several lines of evidence support the primary conclusions. First, pThoc1 forms stable interactions with UAP56, Tho2, and elongating forms of RNA PolII in intact cells. pThoc1 also colocalizes with UAP56 in subnuclear speckles. Our data confirm and extend findings from in vitro pulldown assays using UAP56 as bait (30). Since the role of UAP56 in RNA splicing and export has been previously documented (18), the stable interactions detected here are consistent with the hypothesis that these proteins form complexes in cells that physically link transcription and RNA processing. Additional biochemical characterization is required to discover whether these protein interactions reflect a single complex analogous to yeast TREX or multiple complexes.
It is noteworthy that pThoc1 interacts predominantly with a serine 2 phosphorylated form of RNA PolII that migrates in gels differently from the RNA PolIIo form typically associated with elongating transcription complexes. This pThoc1-associated RNA PolII makes up a relatively minor fraction of the total N-20- or H5-immunoreactive RNA PolII in these cells, consistent with the small percentage of genes affected by loss of pThoc1. These data suggest the possibility that pThoc1 interacts primarily with an elongating form of RNA PolII containing a set of posttranslational modifications distinct from those of the RNA PolIIo form.
A second line of evidence in support of the primary conclusion is that many of the same phenotypes observed in Hpr1p-deficient yeast are recapitulated in human cells depleted of pThoc1. Both Hpr1p-deficient yeast and pThoc1-depleted human cells show promoter-independent defects in the expression of an overlapping set of genes, including bacterial lacZ and endogenous ACC1. In both humans and yeast, the proteins associate with promoter-distal regions of actively transcribing genes. Both Hpr1p-deficient yeast and pThoc1-depleted human cells are especially sensitive to chemical inhibitors of transcriptional elongation (6-azauracil and DRB, respectively). Finally, the molecular mechanism contributing to the observed transcriptional elongation defect, formation of DNA-RNA hybrids, appears to be similar in both yeast and human cells. Further support for functional analogy between human pThoc1 and yeast Hpr1p is provided by the overlapping set of cellular phenotypes associated with their depletion. In particular, both human and yeast cells show defects in cell growth, increased sensitivity to DNA damage, increased sensitivity to loss of topoisomerase activity, and defects in nucleotide excision repair. Finally depletion of pThoc1 or other putative human TREX proteins yields an overlapping set of phenotypes, as in yeast.
While the data presented here establish a role for pThoc1 in transcriptional elongation, we cannot exclude the possibility that pThoc1 also functions earlier in transcription. ChIP analysis indicates that pThoc1 associates with DNA spanning the TATAA box of the promoters tested. This suggests the possibility that pThoc1 may influence events during initiation or very early during elongation. Our data also indicate that pThoc1 and UAP56 colocalize within nuclear speckles. Phosphorylated forms of RNA PolII also colocalize to these splicing factor-rich nuclear speckles (20). Since active transcription occurs primarily at perichromatin fibrils outside of or at the periphery of nuclear speckles (19), pThoc1 and UAP56 may be preassembled and could associate with RNA PolII before recruitment to actively transcribed genes. Therefore, it is possible that pThoc1 and TREX influence events prior to transcription elongation.
pThoc1 lacks overall, statistically significant primary amino acid sequence similarity to any of the yeast TREX proteins in BLASTP alignments. Further, human pThoc1 and its metazoan orthologues contain protein interaction motifs, such as the death domain, that are apparently not present in fungi (11, 32). Hence, it is likely that differences in the structure and function of metazoan and yeast TREX complexes will be identified notwithstanding the observation that they have remarkably similar effects on transcription, cell growth, and response to DNA damage. To date, limited efforts to characterize metazoan TREX complexes have identified proteins conserved across higher eukaryotes, but not with S. cerevisiae proteins (23). Like pThoc1, these proteins may function analogously to yeast TREX proteins despite divergence in the primary amino acid sequence. TREX complex components may be among a class of proteins, like some spliceosomal proteins, whose amino acid sequence in S. cerevisiae has diverged well beyond expectation from functionally related proteins in Schizosaccharomyces pombe or other eukaryotic species (1). Alternatively, the subunit composition and function of TREX complexes may vary among species or biological contexts, possibly specifying distinct regulatory inputs. Nonetheless, the general mechanism of coupling transcriptional elongation to RNA processing factors through assembly of protein complexes containing both transcription elongation and RNA processing factors is shared from yeast to humans.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the National Institutes of Health (CA-70292) and the Ralph C. Wilson Foundation to D.W.G.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bennett, C. B., L. K. Lewis, G. Karthikeyan, K. S. Lobachev, Y. H. Jin, J. F. Sterling, J. R. Snipe, and M. A. Resnick. 2001. Genes required for ionizing radiation resistance in yeast. Nat. Genet. 29:426-434.[CrossRef][Medline]
3. Castano, E., P. Gross, Z. Wang, R. G. Roeder, and T. Oelgeschlager. 2000. The C-terminal domain-phosphorylated IIO form of RNA polymerase II is associated with the transcription repressor NC2 (Dr1/DRAP1) and is required for transcription activation in human nuclear extracts. Proc. Natl. Acad. Sci. USA 97:7184-7189.
4. Chang, M., D. French-Cornay, H. Y. Fan, H. Klein, C. L. Denis, and J. A. Jaehning. 1999. A complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p, and Ccr4p plays a role in protein kinase C signaling. Mol. Cell. Biol. 19:1056-1067.
5. Chavez, S., and A. Aguilera. 1997. The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev. 11:3459-3470.
6. Chavez, S., T. Beilharz, A. G. Rondon, H. Erdjument-Bromage, P. Tempst, J. Q. Svejstrup, T. Lithgow, and A. Aguilera. 2000. A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. EMBO J. 19:5824-5834.[CrossRef][Medline]
7. Chavez, S., M. Garcia-Rubio, F. Prado, and A. Aguilera. 2001. Hpr1 is preferentially required for transcription of either long or G+C-rich DNA sequences in Saccharomyces cerevisiae. Mol. Cell. Biol. 21:7054-7064.
8. Doostzadeh-Cizeron, J., R. Evans, S. Yin, and D. W. Goodrich. 1999. Apoptosis induced by the nuclear death domain protein p84N5 is inhibited by association with Rb protein. Mol. Biol. Cell 10:3251-3261.
9. Durfee, T., M. A. Mancini, D. Jones, S. J. Elledge, and W.-H. Lee. 1994. The amino-terminal region of the retinoblastoma gene product binds a novel nuclear matrix protein that co-localizes to centers for RNA processing. J. Cell Biol. 127:609-622.
10. Fan, H. Y., K. K. Cheng, and H. L. Klein. 1996. Mutations in the RNA polymerase II transcription machinery suppress the hyperrecombination mutant hpr1 delta of Saccharomyces cerevisiae. Genetics 142:749-759.[Abstract]
11. Feinstein, E., A. Kimchi, D. Wallach, M. Boldin, and E. Varfolomeev. 1995. The death domain: a module shared by proteins with diverse cellular functions. Trends Biochem. Sci. 20:342-344.[CrossRef][Medline]
12. Gonzalez-Barrera, S., F. Prado, R. Verhage, J. Brouwer, and A. Aguilera. 2002. Defective nucleotide excision repair in yeast hpr1 and tho2 mutants. Nucleic Acids Res. 30:2193-2201.
13. Huertas, P., and A. Aguilera. 2003. Cotranscriptionally formed DNA-RNA hybrids mediate transcription elongation impairment and transcription-associated recombination. Mol. Cell 12:711-721.[CrossRef][Medline]
14. Keene, J. D., and S. A. Tenenbaum. 2002. Eukaryotic mRNPs may represent posttranscriptional operons. Mol. Cell 9:1161-1167.[CrossRef][Medline]
15. Kim, M., S. H. Ahn, N. J. Krogan, J. F. Greenblatt, and S. Buratowski. 2004. Transitions in RNA polymerase II elongation complexes at the 3' ends of genes. EMBO J. 23:354-364.[CrossRef][Medline]
16. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14:2452-2460.
17. Lee, D. F., R. Drouin, P. Pitsikas, and A. J. Rainbow. 2004. Detection of an involvement of the human mismatch repair genes hMLH1 and hMSH2 in nucleotide excision repair is dependent on UVC fluence to cells. Cancer Res. 64:3865-3870.
18. Luo, M. L., Z. Zhou, K. Magni, C. Christoforides, J. Rappsilber, M. Mann, and R. Reed. 2001. Pre-mRNA splicing and mRNA export linked by direct interactions between UAP56 and Aly. Nature 413:644-647.[CrossRef][Medline]
19. Misteli, T., and D. L. Spector. 1998. The cellular organization of gene expression. Curr. Opin. Cell Biol. 10:323-331.[CrossRef][Medline]
20. Mortillaro, M. J., B. J. Blencowe, X. Wei, H. Nakayasu, L. Du, S. L. Warren, P. A. Sharp, and R. Berezney. 1996. A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix. Proc. Natl. Acad. Sci. USA 93:8253-8257.
21. O'Hagan, H. M., and M. Ljungman. 2004. Nuclear accumulation of p53 following inhibition of transcription is not due to diminished levels of MDM2. Oncogene 23:5505-5512.[CrossRef][Medline]
22. Reed, R. 2003. Coupling transcription, splicing and mRNA export. Curr. Opin. Cell Biol. 15:326-331.[CrossRef][Medline]
23. Rehwinkel, J., A. Herold, K. Gari, T. Kocher, M. Rode, F. L. Ciccarelli, M. Wilm, and E. Izaurralde. 2004. Genome-wide analysis of mRNAs regulated by the THO complex in Drosophila melanogaster. Nat. Struct. Mol. Biol. 11:558-566.[CrossRef][Medline]
24. Rondon, A. G., S. Jimeno, M. Garcia-Rubio, and A. Aguilera. 2003. Molecular evidence that the eukaryotic THO/TREX complex is required for efficient transcription elongation. J. Biol. Chem. 278:39037-39043.
25. Sadoff, B. U., S. Heath-Pagliuso, I. B. Castano, Y. Zhu, F. S. Kieff, and M. F. Christman. 1995. Isolation of mutants of Saccharomyces cerevisiae requiring DNA topoisomerase I. Genetics 141:465-479.[Abstract]
26. Santos-Rosa, H., and A. Aguilera. 1994. Increase in incidence of chromosome instability and non-conservative recombination between repeats in Saccharomyces cerevisiae hpr1 delta strains. Mol. Gen. Genet. 245:224-236.[Medline]
27. Schneiter, R., C. E. Guerra, M. Lampl, G. Gogg, S. D. Kohlwein, and H. L. Klein. 1999. The Saccharomyces cerevisiae hyperrecombination mutant hpr1
is synthetically lethal with two conditional alleles of the acetyl coenzyme A carboxylase gene and causes a defect in nuclear export of polyadenylated RNA. Mol. Cell. Biol. 19:3415-3422.
28. Strasser, K., and E. Hurt. 2000. Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export. EMBO J. 19:410-420.[CrossRef][Medline]
29. Strasser, K., and E. Hurt. 2001. Splicing factor Sub2p is required for nuclear mRNA export through its interaction with Yra1p. Nature 413:648-652.[CrossRef][Medline]
30. Strasser, K., S. Masuda, P. Mason, J. Pfannstiel, M. Oppizzi, S. Rodriguez-Navarro, A. G. Rondon, A. Aguilera, K. Struhl, R. Reed, and E. Hurt. 2002. TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417:304-308.[CrossRef][Medline]
31. Stutz, F., A. Bachi, T. Doerks, I. C. Braun, B. Seraphin, M. Wilm, P. Bork, and E. Izaurralde. 2000. REF, an evolutionary conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA 6:638-650.[Abstract]
32. Weber, C. H., and C. Vincenz. 2001. The death domain superfamily: a tale of two interfaces? Trends Biochem. Sci. 26:475-481.[CrossRef][Medline]
33. West, R. W., Jr., B. Kruger, S. Thomas, J. Ma, and E. Milgrom. 2000. RLR1 (THO2), required for expressing lacZ fusions in yeast, is conserved from yeast to humans and is a suppressor of SIN4. Gene 243:195-205.[CrossRef][Medline]
34. Zenklusen, D., P. Vinciguerra, J. C. Wyss, and F. Stutz. 2002. Stable mRNP formation and export require cotranscriptional recruitment of the mRNA export factors Yra1p and Sub2p by Hpr1p. Mol. Cell. Biol. 22:8241-8253.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
-GFP) or pThoc1 (
