This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nguyen, H. G.
Right arrow Articles by Ravid, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nguyen, H. G.
Right arrow Articles by Ravid, K.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2005, p. 4977-4992, Vol. 25, No. 12
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.12.4977-4992.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Mechanism of Aurora-B Degradation and Its Dependency on Intact KEN and A-Boxes: Identification of an Aneuploidy-Promoting Property

Hao G. Nguyen,1 Dharmaraj Chinnappan,1 Takeshi Urano,2 and Katya Ravid1*

Department of Biochemistry, Department of Medicine, and Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts 02118,1 Department of Biochemistry II, Nagoya University School of Medicine, Nagoya 466-0065, Japan2

Received 9 November 2004/ Returned for modification 3 January 2005/ Accepted 7 March 2005


arrow
ABSTRACT
 
The kinase Aurora-B, a regulator of chromosome segregation and cytokinesis, is highly expressed in a variety of tumors. During the cell cycle, the level of this protein is tightly controlled, and its deregulated abundance is suspected to contribute to aneuploidy. Here, we provide evidence that Aurora-B is a short-lived protein degraded by the proteasome via the anaphase-promoting cyclosome complex (APC/c) pathway. Aurora-B interacts with the APC/c through the Cdc27 subunit, Aurora-B is ubiquitinated, and its level is increased upon treatment with inhibitors of the proteasome. Aurora-B binds in vivo to the degradation-targeting proteins Cdh1 and Cdc20, the overexpression of which accelerates Aurora-B degradation. Using deletions or point mutations of the five putative degradation signals in Aurora-B, we show that degradation of this protein does not depend on its D-boxes (RXXL), but it does require intact KEN boxes and A-boxes (QRVL) located within the first 65 amino acids. Cells transfected with wild-type or A-box-mutated or KEN box-mutated Aurora-B fused to green fluorescent protein display the protein localized to the chromosomes and then to the midzone during mitosis, but the mutated forms are detected at greater intensities. Hence, we identified the degradation pathway for Aurora-B as well as critical regions for its clearance. Intriguingly, overexpression of a stable form of Aurora-B alone induces aneuploidy and anchorage-independent growth.


arrow
INTRODUCTION
 
The Aurora/Ipl1 protein kinases have been shown to orchestrate vital mitotic events, including G2/M transition, centrosome duplication, chromosome condensation, bipolar spindle-kinetochore attachment, chromosome segregation, and cytokinesis. Their roles are conserved in yeast cells, nematodes, and mammalian cells (reviewed in references 1 and 20). While lower organisms have only one form of Aurora kinase (Ipl-1), mammalian cells have three types, Aurora-A, Aurora-B, and Aurora-C, whose function and localization are distinct in space and time during cell division. The function of Aurora-C in mammalian cells has not been studied extensively. Aurora-A localizes to the centrosomes during anaphase, and it is required for mitotic entry (3). Aurora-B (also called AIM-1 and Stk-5) regulates the formation of a stable bipolar spindle-kinetochore attachment in mitosis. It colocalizes with surviving, inner centromere protein (INCENP) and a recently discovered protein named Borealin or hDasra B to form the chromosome passenger complex needed for chromosome segregation and cytokinesis (10, 14, 40). During telophase, Aurora-B also plays a unique role by ensuring the completion of cytokinesis (12, 44). Drosophila cells lacking Aurora-B protein do not undergo cytokinesis and become a mass of polyploid cells (11), and drug-mediated inhibition of this kinase in proliferating mammalian cells induces polyploidy (14). In bone marrow megakaryocytes (the platelet precursors), which undergo endomitotic cell cycles and polyploidization during normal development, Aurora-B is missing at late anaphase, e.g., it is not found localized to the midzone (52). On the other hand, Aurora kinases have been found to be overexpressed in a variety of malignant cancers (a full list of such tumors is listed at http://cgap.nci.nih.gov); hence, they have been suspected to contribute to chromosome instability (45). Studies have shown that ectopic expression of Aurora-B in mammalian cell lines might induce genetic instability, polyploidy, and/or aneuploidy (45). Our lab has recently described the first in vivo expression of Aurora-B, showing that transgenic megakaryocytes overexpressing this protein have an increased proliferation potential, but malignancy has not been observed, suggesting that perhaps a second hit(s) is needed to promote transformation (52).

Entry into mitosis is dependent upon the activation of several protein kinases, while exit from mitosis relies on their regulated proteolysis through the ubiquitin-dependent anaphase-promoting cyclosome complex (APC/c) pathway (reviewed in references 33 and 46). During the cell cycle, Aurora-B is regulated both at mRNA and protein levels, peaking at mitosis (22, 45). Typically, the functions of mitotic kinases are effectively turned off by their regulated proteolysis to guarantee accurate transition between various stages of mitosis, including metaphase/anaphase and the telophase/G1 phase (31). An E3 ligase is selective in identifying a target protein, and the APC/c-E3 ligase transiently associates with either the Cdc20 or Cdh1 modulator protein not only to determine substrate specificity but also to provide temporal control over when substrates are targeted for polyubiquitination (15, 16). The association of these proteins to the APC/c is tightly regulated in a cell cycle-dependent manner. The switching from the active form of Cdc20-APC to a Cdh1-APC/c occurs during the transition to anaphase, with Cdh1-APC remaining active up to the end of G1 phase. The active forms of these two complexes cannot coexist at any time during mitosis, since the activation of Cdh1-APC/c directly targets the Cdc20 protein for degradation (reviewed in references 24 and 37). Cdc20-APC degrades a number of targets, including securin and cyclin B prior to anaphase transition, whereas Cdh1-APC is required to prevent the accumulation of targets in late mitosis and G1 phase to ensure timely progression into S phase (18, 25, 35). The Cdc20-APC/c generally recognizes its substrates for targeted proteolysis through the consensus sequence RXXL (D-box) with X being any amino acid. It can also recognize the A-box (5, 26, 55). Likewise, the Cdh1-APC/c recognizes and binds to the KEN box, D-box, and/or A-box consensus sequences for targeted polyubiquitination (23, 37). Few proteins, such as Xkid, which regulates chromosome congregation, are degraded by APC/Cdc20 and APC/Cdh1, dependent on a KEN box and independent of a D-box (4). In some cases, Cdc20 does not need to bind the substrate to induce degradation, as was recently described (51).

In Xenopus oocytes and HeLa cells, Aurora-A expression peaks at G2/M phase of the cell cycle and is degraded by the Cdh1-APC/c at the onset of anaphase (9, 43). It was shown that Aurora-A degradation depends on an intact A-box, in which a conserved core consists of amino acids QRVL, and on a D-box at the C terminus (26). Aurora-B also contains the putative D-box and KEN boxes, as typical of all Aurora family members (23, 37), as well as an A-box (26). However, the degradation mechanism of Aurora-B during mitosis has not been studied. In this report, we provide direct evidence that Aurora-B is degraded by the ubiquitin-proteasome pathway via the APC/c. We show that Aurora-B interacts with the APC/c through the Ccd27 subunit and is capable of binding in vivo to Cdh1 or Cdc20. Expression studies with Aurora-B bearing targeted mutations in conjunction with biochemical assays and immunohistochemistry led to the identification of the KEN and QRVL sequences as important determinants of Aurora-B degradation. We also found that despite the presence of a few D-boxes in its sequence, Aurora-B degradation is not dependent on these motifs. Finally, the degradation-resistant cDNA generated in this study has proven useful in examining the effects of sustained expression of this kinase on development of aneuploidy and anchorage-independent growth.


arrow
MATERIALS AND METHODS
 
Cell cultures, synchronization procedures, and cell cycle analysis. HeLa cells were grown in Dulbecco modified Eagle medium (DMEM) (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 IU/ml and 100 µg/ml, respectively) in 37°C and 5% CO2 atmosphere. Normal mouse mammary gland epithelial cells (NMuMG) (ATCC CRL 1636) were grown in DMEM supplemented with 10% FBS, 2 mM glutamine, and 10 µg/ml insulin. Cells were seeded at a density of 500,000 cells/ml. NIH 3T3 cells (ATCC CRL 1658) were grown in DMEM plus 10% FBS. To synchronize cells at G2/M phase, cells were treated with 40 ng/ml nocodazole (Sigma, St. Louis, MO) for 16 h. To release cells from drug-induced G2/M-phase arrest, cells were washed three times with phosphate-buffered saline (PBS) and switched into fresh medium for further incubation. In each experiment, a sample of 10,000 cells was subjected to DNA staining with propidium iodine (PI) to evaluate cell cycle distribution, using flow cytometry analysis. Briefly, cells were trypsinized, washed, and fixed in PBS with 1% formaldehyde for 10 min. To stain cells with PI, the following solution was used: PBS, 1 mg/ml PI, 33 µg/ml RNase A, 10% Nonidet P-40 [NP-40], pH 7.4. Flow cytometry analysis was carried out using a FACScan system and CellQuest program (Becton Dickinson, San Jose, CA).

Protein stability experiments. To determine the half-life of Aurora-B, 50 µg/ml cycloheximide (Sigma, St. Louis, MO) was added to cells to inhibit protein synthesis, and cells were harvested in radioimmunoprecipitation assay (RIPA) buffer (1x PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 10 mg/ml phenylmethylsulfonyl fluoride, aprotinin [2 µg/ml], and 100 mM sodium orthovanadate) at various time intervals indicated in the figures. To determine the effects of proteasome inhibitors on Aurora-B protein stability, cells were preincubated with 25 µM MG132 (Z-Leu-Leu-Leu-H-aldehyde) or 10 µM clasto-lactacystin (Peptide International, Inc., Louisville, KY) or with the corresponding volume of the vehicle dimethyl sulfoxide (DMSO) before addition of cycloheximide. Additionally, cells were also treated with proteasome inhibitors in the absence of cycloheximide for up to 10 h to observe protein accumulation.

Cell extraction, immunoprecipitation, and immunoblotting. Cells were collected in RIPA buffer (composition given above), allowed to lyse on ice for 5 min, vortexed, and cleared by centrifugation in a microcentrifuge at 14,000 rpm for 8 min at 4°C. Protein was subjected to Western blot analysis (40 µg/lane) as described previously (52). Immunoprecipitation experiments were pursued according to standard procedures (Santa Cruz Biotech, Santa Cruz, CA) and as described previously (53). Briefly, 500 µg of soluble protein was first incubated with primary antibodies for 2 h at room temperature and further incubated overnight at 4°C after addition of 25 µl of protein A/G-Sepharose beads (Santa Cruz Biotech, Santa Cruz, CA). To pull down the immunocomplexes, the beads were washed one time with RIPA buffer and washed three times with 1x PBS at 2,500 rpm for 5 min and finally suspended in 30 µl of 2x SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer. The immunoprecipitated proteins were separated by SDS-PAGE. Western blot analysis was performed as previously described (54). The following antibodies were used in this study: mouse monoclonal anti-Aurora-B (1:1,000-fold dilution) from BD Biosciences (San Jose, CA); mouse monoclonal anti-cyclin B1 (1:1,000-fold dilution), mouse monoclonal antiubiquitin (1:1,000-fold dilution), goat polyclonal antiactin (1:1500-fold dilution), rabbit polyclonal anti-phospho-histone H3-Ser10 (1:500-fold dilution), rabbit polyclonal anti-histone H3 (1:1,000-fold dilution), and rabbit polyclonal anti-cyclin A (1:1,000-fold dilution), all from Santa Cruz Biotech (Santa Cruz, CA); mouse monoclonal anti-human Cdh1 (anti-hCdh1) and anti-human Cdc20 (hCdc20) (1:1,000-fold dilution), a generous gift from Takeshi Orano, Nagoya University School of Medicine, Japan; and mouse monoclonal anti-V5 antibody (1:5,000-fold dilution) from Invitrogen (Carlsbad, CA). In the case of cell lysate preparation for extraction of histone, and phospho-histone H3-Ser10, the following changes were applied to the protocol. Cells were lysed on ice with RIPA buffer (1x PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/ml phenylmethylsulfonyl fluoride, aprotinin [2 µg/ml]) supplemented with phosphatase inhibitors, 0.5 mM sodium orthovanadate (Sigma, St. Louis, MO) and 10 µM okadaic acid (Calbiochem, La Jolla, Calif.). Lysate were allowed an additional 15 min of vigorous vortexing at 4°C.

In vivo ubiquitination assay. Cells were cultured in DMEM with 10% FBS, treated with 25 µM MG132 or a corresponding volume of the vehicle DMSO, and lysed on ice with RIPA buffer. The lysates were cleared by centrifugation in a microcentrifuge at 14,000 rpm for 8 min. Five hundred micrograms of total cellular protein was used for each immunoprecipitation reaction with equal amounts of normal mouse immunoglobulin G (IgG) and Aurora-B IgG. The immunocomplexes were pulled down as described above and resolved by SDS-PAGE using a 10% gel and probed for the presence of polyubiquitin-Aurora-B protein complex using monoclonal mouse ubiquitin antibody (as above).

Plasmid constructions, mutagenesis, and cell transfection. V5-tagged-Aurora-B (V5-Aurora-B) expression plasmid was generated using rat Aurora-B cDNA (52) cut at KpnI and BamHI sites and ligated to a KpnI-BamHI PCR fragment (subjected to DNA sequencing prior to application) containing a 14-amino-acid tag sequence encoding the V5 epitope (GKPIPNPLLGLDST) linked in frame to the first 65 amino acids of Aurora-B at the 5' end. This coding fragment and all the subsequent ones were subcloned into the pCDNA3 expression vector (including cytomegalovirus as a promoter). To identify the sequences that potentially constitute degradation signals for Aurora-B, we generated several deletion and site-directed mutation constructs. There are three putative D-boxes with RXXL motifs within the C-terminal domain of Aurora-B. We named them D-box 1, 2, and 3 appearing from 5' to 3' (please see Fig. 5). V5-Aurora-B (D-box 1) mutation was generated using site-directed mutagenesis as previously described (49). Briefly, PCR primer sets (sense, 5'ATAGCCGCTGCAGCTGCTGGTCATAGAAG3'; antisense, 5'AGCAGGCTGCAGCGGCTATACTCGAATACG3') were custom ordered from Invitrogen (Carlsbad, CA) to specifically change the consensus sequence RXXL to AAAA. PCRs were carried out with upstream and downstream primer sets (sense, 5'TAATACGACTCACTATAGGG3'; antisense, 5'CGATATGTCTCACTGTGGCTA3'). The resulting PCR products were gene cleaned using GeneOne kit (Bio101, Carlsbad, CA), cut with appropriate restriction enzymes (New England Biolabs, Beverly, MA) and ligated back into the original expression vector containing V5-Aurora-B cDNA. In a similar approach, V5-Aurora-B with D-box 2 and D-box 3 mutations were constructed with the following specific primer sets: for D-box 2 mutation, we used sense 5'CTCACAAGCTGCAGCAGCAGAGCAG3') and antisense 5'GACCTGCTCGTGCTGCTGCTGCAGCTTGTGAGGG3' primers; for D-box 3 mutation, we used sense 5'CAACTCACGGCTGCAGCAGCACTCCCTCTG3' and antisense 5'GAGGGAGGTGCCTGCTGCAGCTGAGTTGGC3' primers. Deletions of the KEN box and the first 65 amino acids were generated using PCR primer sets with EcoRI and BamHI overhangs at the 5' and 3' ends, respectively (5'GCGAATTCGGTCTACCCGTGGCCCTACGGC3' and 5'GTAGACCGATATGTCTCACTGTGGCTA3', respectively). To mutate KEN to AAN, we digested the original construct (V5-Aurora-B) with EcoRI (5') and BamHI (3') and inserted a PCR product with the mutated site. For this purpose, we used the following primers: sense 5'TCGGCTCAGGCAGCTAACGTCTACCCGTGGCCC3' and antisense 5'GTAGACGTTAGCTGCCTGAGCCGAATTCGATCC3' primers. Since all primer sets were designed to contain EcoRI (5') and BamHI (3') cohesive ends, the amplified fragment was then replaced with the excised EcoRI-BamHI fragment from V5-Aurora-B plasmid. All mutations were confirmed by DNA sequencing (Boston University School of Medicine Genetic Program Core Facility). A tag at the N terminus of Aurora-B does not have any effect on this protein's degradation or localization patterns (please refer to Results). Plasmid preparation was done using QIAGEN Maxi Prep kit (QIAGEN, Valencia, CA).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 5. Mutation of KEN box or A-box inhibits Aurora-B polyubiquitination. A. HeLa cell extracts with ectopic expression of wild-type Aurora-B (V5 tagged) were subjected to immunoprecipitation (IP) with anti-Aurora-B (AurB Ab), anti-Ccd20, or anti-Cdh1 antibody and probed with anti-V5 antibody. WB, Western blotting. B. To show the interaction/lack of interaction of Aurora-B mutant with Cdh1 and Cdc20, an IP assay similar to the IP assay in panel A was performed, using HeLa cell extracts with ectopic expression of wild-type (Wt) and mutated (mut.) Aurora-B. HC, heavy-chain IgG. C. HeLa cells were transiently cotransfected with equal amounts of wild-type V5-Aurora-B, or A-box-mut-Aurora-B or KEN-box-mut-Aurora-B constructs, each together with Cdh-1 or Cdc20 or empty vector, and isolated protein extracts were subjected to immunoprecipitation (IP) with anti-V5 antibody. The immunocomplexes were resolved by SDS-PAGE and Western blotted (WB) with antiubiquitin antibody (Anti-Ub Ab). Samples overexpressing wild-type V5-Aurora-B displayed Aurora-B-polyubiquitin complex (heavy-chain IgG [HC], 55 kDa) as a smear pattern. However, this pattern was significantly reduced in samples containing mutant forms of Aurora-B. To confirm similar expression of Aurora protein (wild type or mutated) derived from the different constructs, protein extracts were also used in Western blot analysis with anti-V5 (bottom panel). Results shown are representative of three experiments.

Transient transfection of cells (grown at a density of 5 x 105 cells/ml in six-well plates) was performed using Fugene-6 (Roche Applied Biosciences, Indianapolis, IN) and carried out according to the manufacturer's instructions. The efficiency of transfection of HeLa cells is in the range of 50 to 60%, as determined by transfection with pCMCß-Gal and determination of ß-galactosidase-positive cells as described previously (49).

Generation and expression of GFP-Aurora-B fusion proteins. The three forms of green fluorescent protein (GFP)-Aurora-B fusion proteins we chose to generate are wild type, KEN mutated, and A-box mutated, each linked in frame to GFP. Aurora-B fused with enhanced green fluorescent protein (EGFP) was constructed by inserting the corresponding Aurora-B cDNA (from the previously engineered construct as described above with Kpn1/Apa1 cohesive ends) into the pEGFP-C1 expression vector (BD Biosciences, San Jose, CA) with compatible restriction sites. This resulted in 5' GFP-Aurora-B 3'. DNA sequencing was carried out to confirm in-frame insertion. Expression of the fusion protein in transiently transfected HeLa cells (using the Fugene-6 method as described above at a concentration of 500 ng DNA/well, in six-well plate cell culture) was confirmed by Western blot analysis using both anti-GFP (BD Biosciences, San Jose, CA) and Aurora-B antibodies. Subsequently, transiently transfected cells were viewed with an Olympus IX70 inverted fluorescence microscope (Melville, NY). Images were documented with a Hamamatsu charge-coupled device camera C4742-95 (Hamamatsu City, Japan) and analyzed with OpenLab software (Improvision, Lexington, MA).

Chromosome analysis. Cells were grown to 70% confluency and treated with 15 ng/ml Colcemid (GIBCO BRL, Life Technologies). Cells were spun down at 500 x g for 10 min, resuspended in 12 ml hypotonic solution (0.075 M KCl), and incubated at 37°C for 20 min. At the end of the incubation period, a few drops of cold Carnoy's fixative (3:1 ratio of methanol:acetic acid) were added to the cells. Cells were then washed twice in Carnoy's fixative. Chromosome spreading and 4',6'-diamidino-2-phenylindole (DAPI) staining were performed by conventional methods and as we described previously (6). The samples were then analyzed by fluorescence microscopy at a magnification of x1,000.

Soft-agar colony formation assay. NMuMG or NIH 3T3 cells were transfected as described above with an empty vector carrying GFP, or wild-type Aurora-B (GFP tagged), or A-box mutated Aurora-B (GFP tagged). Cells were selected on the basis of resistance to G418 (400 µg/ml) (Invitrogen, Carlsbad, CA), as the expression vector contains a gene for resistance to neomycin. To further purify GFP-expressing cells, GFP-positive cells were sorted by flow cytometry (MoFlow; DakoCytomation, Carpinteria, CA). Cells were grown in soft agar as we described elsewhere (27). In brief, cells were treated with 1x trypsin (Invitrogen) for 5 min in a 37°C incubator and pipetted several times so that most cells were in single-cell forms. Cells were counted with a hemacytometer (Hausser Scientific/VWR, South Plainfield, NJ), and 5,000 cells were mixed with 1 ml top agar and plated onto a 35-mm six-well plate containing bottom plugs (0.8% agarose, 10% FBS, 1x DMEM). After the top agar had solidified (about 2 h of incubation at 37°C), 1 ml of DMEM was added into each well to prevent dehydration. This covering medium was changed every 2 or 3 days during culture. After 20 days, cultures were fixed and stained with crystal violet solution (10% acetic acid, 10% ethanol, and 0.06% crystal violet) and then visualized using an Olympus IX70 microscope (with 4x and 40x objectives). The number of colonies formed was counted for each well. A cell colony was defined as any cluster of cells that had a diameter of greater than 35 pixels (diameter of one cell is 12 pixels at 1,280 x 1,022 resolution, grey-scale digital image, using OpenLab software). Hence, a colony approximately contains more than three cells. The average of counts from three random fields for each well was taken as the colony number.


arrow
RESULTS
 
Aurora-B level is affected by proteasome inhibitors and is ubiquitinated and immunoprecipitated by anti-Cdc27 antibody. Similar to most mitotic proteins, Aurora-B is predicted to have a short half-life. The half-life of Aurora-B was determined in HeLa cells treated with the protein synthesis inhibitor cycloheximide. At approximately 3 h postinhibition of protein synthesis, Aurora-B protein was reduced by 50% compared to no change in the protein level in nontreated cells (Fig. 1A and B). A similar short half-life was reported for Aurora-A (43).




View larger version (46K):
[in this window]
[in a new window]
 
FIG. 1. Aurora-B has a short half-life and accumulates in the presence of proteasome inhibitors. A. HeLa cells were treated with 250 µg/ml cycloheximide and collected at the indicated times for Western blot analysis. Proteins (50 µg/lane) were loaded onto an SDS-polyacrylamide gel, transferred to a filter, and incubated with anti-Aurora-B antibody (showing a 40-kDa protein). ß-Actin level was also blotted for a loading control (43-kDa protein). B. To quantitatively evaluate the half-life of Aurora-B, its protein level, as determined by Western blotting, was normalized to ß-actin level in five independent experiments. Averages shown were calculated using the NIH Image V1.62 software (freeware from the National Institutes of Health). Error bars represent standard deviations. C. HeLa cells were treated for different lengths of time with a proteasome inhibitor, MG132 (20 µM) or lactasystin (10 µM). The cells were lysed and subjected to Western blot analysis with anti-Aurora-B and -ß-actin antibodies. Results shown are representative of five independent experiments.

The APC/c E3 ligase, through its ability to tag specific proteins with polyubiquitin for targeted degradation, is believed to globally direct the progression of mitosis (reviewed in references 13 and 34). Because Aurora-B plays important roles in metaphase/anaphase transition and cytokinesis, we suspected its degradation to involve the APC/c ubiquitin-proteasome pathway. Treatment of cells with a selective inhibitor of the proteasome, MG132 or lactacystin, resulted in increased Aurora-B level (Fig. 1C). This strongly suggests that degradation of Aurora-B is mediated by the ubiquitin-proteasome pathway. To further prove this, immunoprecipitation experiments with anti-Aurora-B were pursued, followed by Western blotting with antiubiquitin antibodies. It was concluded that ubiquitin is in a complex with Aurora-B and that the level of this complex is further enhanced when the proteasome is inhibited (allowing accumulation of nondegraded complex) (Fig. 2A). Furthermore, we sought to determine whether Aurora-B interacts with the APC/c subunit Cdc27 (19, 38). Immunoprecipitation assays indicated that Cdc27 is in a complex with Aurora-B (Fig. 2B). In accordance, the Aurora-B/Cdc27 immunocomplex was detected mainly in mitosis-arrested cell extracts (nocodazole treated). A longer exposure of the film showed Aurora-B in a similar complex in the asynchronous cells. Together, these results suggest that Aurora-B degradation is mediated by the APC/c-ubiquitin pathway.




View larger version (120K):
[in this window]
[in a new window]
 
FIG. 2. Aurora-B is ubiquitinated and capable of binding in vivo to the APC component Cdc27. A. HeLa cells were incubated with (+) or without (–) MG132 (20 µM) for 6 h, lysed, and collected for immunoprecipitation (IP) with anti-Aurora-B antibody (Aur.B Ab) or with mouse IgG as a control. Equal amounts of immunoprotein complex were loaded and resolved by SDS-PAGE. To detect the presence of ubiquitin in the Aurora-B-immunocomplex, antiubiquitin monoclonal antibody was used in the Western blot (WB) analysis shown in the top panel. Polyubiquitinated Aurora-B appears in multiple forms with a molecular mass range greater than 40 kDa. The positions of heavy-chain (HC) and light-chain (LC) mouse IgG and a nonspecific band(which also appears with mouse IgG) (asterisk) are also indicated. The presence of Aurora-B in the immunocomplex was further verified by blotting the same membrane with anti-Aurora-B antibody, as shown in the lower panel. B. To test whether Aurora-B can bind directly to the APC/c, HeLa cells were arrested at M phase with nocodazole (40 ng/ml) for 16 h, lysed, and subjected to IP with anti-Cdc27 or anti-Aurora-B mouse monoclonal antibodies. IP with normal mouse IgG was also performed as a negative control. The same blot was reprobed with anti-Cdc27 to show the efficiency of Cdc27 immunoprecipitation. As expected, the heavy-chain (HC) mouse IgG showed as a 55-kDa protein. The data shown are representative of two experiments. The Aurora-B-Cdc27 immunocomplex was present in synchronized mitotic cells but was scarce in asynchronized cells, as attested by Western blotting and reaction with anti-Aurora B.

Cdh1 or Cdc20 stimulates Aurora-B degradation. Cdc20 and Cdh1 are WD repeat proteins that give temporal control and substrate specificity to the APC/c E3 ligase (37, 48). The role of Cdh1 or Cdc20 in degradation of Aurora-A has been examined via overexpression experiments (43). Using a similar approach, we demonstrated that Cdh1 or Cdc20 stimulates Aurora-B degradation. Figure 3A shows the results from a representative analysis as well as a summary of several independent experiments, with the Aurora-B level determined by Western blotting. Cdh1 or Cdc20 upregulation results with a decrease in the levels of transfected (Fig. 3A) or endogenous Aurora-B (Fig. 3B). Overexpression of Cdc20 or Cdh1 was also confirmed by this mode of analysis (Fig. 3A, top panel). The baseline levels of these proteins were hardly noted in the nonsynchronized cells transfected with vector (unless the film was subjected to longer exposure time). In addition, flow cytometry analysis of these cells rules out the possibility that ectopic expression of the APC modulators could indirectly affect Aurora-B levels by altering mitosis entry/exit (Fig. 3B, bottom panel). In accordance, immunoprecipitation assays indicated that Aurora-B associates in vivo with Cdh1 or Cdc20 in nonsynchronized cells (Fig. 3C) and to a greater extent in nocadazole-treated cells (Fig. 3D). In both the Cdh1 and Cdc20 immunoprecipitates, Aurora-B was detected in a smear pattern at high molecular weights, suggesting that the complex contains covalently modified Aurora-B complex that cannot be disrupted under denaturing conditions (i.e., polyubiquitination). A larger fraction of Aurora-B seemed associated with Cdh1, although we cannot rule out differences attributed to variations in antibody efficiency. Intriguingly, our data revealed a similarity between Aurora-B, cyclin B, Xkid, and only a few other mitotic proteins, which can be degraded by both Cdc20 and Cdh1 (4, 39), the significance of which is summarized below in the Discussion.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 3. Aurora-B protein level decreases in cells transiently transfected with the APC/c modulator protein Cdh1 or Cdc20. A. HeLa cells were transiently transfected with different concentrations (1 to 3 µg DNA as shown) of hCdh1 or hCdc20 expression vectors. Mock transfections were also pursued with empty vector. Cells were lysed after 48 h of incubation and evaluated for Aurora-B (40-kDa), Cdh1 (55.2-kDa), and Cdc20 (54.7-kDa) protein levels by Western blot analysis with appropriate antibodies. The Western blot was also probed with anti-ß-actin (43 kDa) for a loading control. The Western blots at the top of the figure show the results of a representative experiment involving detection of transfected protein, and the graph shows quantification (as in Fig. 1) of three experiments (averages ± standard deviations). B. (Top panel) Similarly, endogenous (endo) Aurora-B too, followed by Western blot analysis with anti-Aurora-B, was also found to be reduced upon Cdc20 or Cdh1 upregulation. Reaction with anti-ß-actin served as a loading control. Data shown are representative of two experiments. The bottom graphs show fluorescence-activated cell sorting analysis with increasing ectopic expression of Cdh1 or Cdc20. C. Asynchronized HeLa cell extracts were subjected to immunoprecipitation (IP) with equal amounts of control mouse IgG, anti-Aurora-B (Aur.B Ab), anti-Cdh1, or anti-Cdc20 antibody and resolved by SDS-PAGE. The immunoprecipitate was subjected to Western blotting (WB) with anti-Aurora-B antibody. D. To show the binding between Aurora-B and the APC/c modulator protein, HeLa cells were synchronized with nocodazole as described for Fig. 2B or nonsynchronized, followed by IP with anti-Aurora-B (Aur.B Ab) or anti-Cdc20 or anti-Cdc20 or as a control with mouse IgG. The immunoprecipitate was subjected to SDS-PAGE and Western blotting with anti-Aurora-B. The positions of Aurora-B as a single band or as a high-molecular-mass complex, as well as the 55-kDa immunoglobulin heavy chains (HC), are shown. Results shown are representative of three experiments.

Identification of sites in Aurora-B needed for its degradation. Since our data indicated a role for Cdh1 and Cdc20 in Aurora-B degradation, we sought to further explore this finding by mutating the conserved motifs that have been reported to constitute recognition signals for these proteins (36). Generally, it is believed that Cdh1 recognizes the KEN sequence, D-box and A-box, while Cdc20 is restricted to D-box and A-box (5, 26, 55). Figure 4A illustrates the putative destruction boxes in Aurora-B, including KEN and A- and D-boxes. Figure 4B lists the deletions and specific mutations created in Aurora-B and their effects on protein stability. Figure 4C, D, E, F, and G show examples of determinations of the protein level of wild-type or mutated Aurora-B in synchronized cells transfected with different constructs. To verify cell synchronization, we utilized flow cytometry analysis (Fig. 4C) and probed the protein extracts for cyclin B1, a known mitotic marker whose level accumulates at G2/M phase and diminishes upon exit from mitosis (2). Since our first attempt to delete the C-terminal D-box was unsuccessful in identifying a stable mutant, we turned our attention to the N terminus. It is clear that the deletion of the first 65 amino acids or of the KEN box (Fig. 4D) results in protein stabilization. Mutation of the three putative D-boxes, both individually and in combination, is without consequence for the stability of Aurora-B (Fig. 4G). Similarly, the direct mutation of KEN to AAN or of the A-box conserved sequence QRVL to AAAA results in protein stability (Fig. 4E and F). Therefore, key sequences responsible for Aurora-B degradation have been identified. Given that Cdc20 and/or Cdh1 has been hypothesized to interact and recruit targeted proteins to the APC/c E3 ligase for ubiquitination (25), we sought to evaluate this possibility in Aurora-B degradation. First, we performed a control immunoprecipitation experiment to show that the V5 epitope tagged to Aurora-B did not compromise its ability to complex with either Cdc20 or Cdh1, as shown in Fig. 5A. Next, we overexpressed wild-type V5-Aurora-B, KEN box, and A-box mutants in HeLa cells and subjected their protein extracts to immunoprecipitation with V5 antibodies or Cdc20 or Cdh1 antibody (Fig. 5B). In this assay, mutation of KEN box did not compromise the binding of Aurora-B to either Cdc20 or Cdh1. Interestingly, mutation of the A-box region significantly diminished Aurora-B's ability to coimmunoprecipitate with Cdh1, but not with Cdc20. Hence, these data indicated that the A-box sequence in Aurora-B is not the site for Cdc20 binding but is important for Cdh1 binding (although this does not rule out that other sequences could in unison or independently serve as the sites for Cdh1 and/or Cdc20 binding). In accordance, mutations of the KEN or A-box affect ubiquitination of this protein in the absence or presence of elevated Cdh1 or Cdc20. Figure 5C shows transfection of cells with wild-type or mutated constructs followed by immunoprecipitation with anti-V5 antibody (to distinguish endogenous from transfected proteins) and Western blotting with antiubiquitin. These cells were also cotransfected with either Cdh1 or Cdc20 to increase Aurora-B polyubiquitination. The top panels in Fig. 5C show an accumulation of polyubiquitinated wild-type Aurora-B (>41 kDa) in cells cotransfected with Cdh1 or Cdc20. As also noted, the ability of A- or KEN box-mutated Aurora-B to bind ubiquitin was significantly compromised. Similar results were obtained when cells were treated with a proteasome inhibitor, MG132, to allow accumulation of polyubiquitinated protein (data not shown). To examine whether the level of the nonubiquitinated form of Aurora-B, wild type or mutant, is affected by Cdh1 or Cdc20 overexpression, we subjected cell extracts derived from transfected cells to Western blot analysis, using anti-V5 antibody (bottom panels). As shown, the level of wild-type Aurora-B was decreased, whereas the level of mutated Aurora-B was not altered in Cdh1- or Cdc20-overexpressing cells (Fig. 5C). Provided that KEN box mutation has no significant impact on the binding of Cdh1 or Cdc20 to Aurora-B, as shown in Fig. 5B, it is highly possible that this mutation prevents polyubitiquination by disrupting the N-terminal lysine residue (protein destruction mediated through the APC/c does not necessarily requires the binding of the modulator protein Cdc20/Cdh1 [50]). The other possibility is that the KEN mutation may prevent efficient polyubiquitination, since it tends to accumulate in the cytosol (Fig. 6).




View larger version (89K):
[in this window]
[in a new window]
 
FIG. 4. Stability of wild-type versus mutated Aurora-B. A. A schematic presentation of Aurora-B (a 343-amino-acid, 40-kDa protein) denoting the five putative degradation signals, including three D-boxes (RXXL) within the C terminus, one KEN box, and an A-box. These degradation sequences are conserved in rat (GenBank accession number BAA23794), mouse (GenBank accession number XP_181344), human (GenBank access number AAH09751), and Xenopus laevis (GenBank accession number AAM76715) Aurora-B proteins. The numbers on the top of the scheme denote the amino acid number at which the consensus sequence starts in relation to the start codon. The conserved amino acids are indicated below the bar in bold print, and the nonconserved ones are denoted by x. B. Summary of different deletions and mutations in Aurora-B and consequences on Aurora-B protein stability. Its stability was examined as illustrated in Fig. 4C to G. C. HeLa cells were arrested at M phase by nocodazole (40 ng/ml) treatment for 16 h, followed by washing off the drug and cell collection at different time points postrelease from synchrony for flow cytometry analysis (A) or for Western blotting (B-D). For flow cytometry analysis, the cells were first stained with PI as detailed in Materials and Methods. Asynchronous (Asyn) cells were not treated with nocodazole. Results shown are from a representative experiment. D. HeLa cells were transfected with Aurora-B construct deleted of the first 65 amino acids (Del-65N Aurora-B). Two days posttransfection, the cells were synchronized and then released from synchrony as in panel A. Cells collected at different time points were subjected to Western blot analysis using an antibody to Aurora-B, which recognizes on the same blot the endogenous and transfected proteins, with the latter being of a lowermolecular weight. Reaction with anti-cyclin B1 served as an additional mitotic marker, while anti-ß-actin confirmed equal loading of protein. E and F. HeLa cells were transiently transfected with wild-type (wt) Aurora-B construct or Aurora-B construct deleted of the KEN box (Del-KEN-Aurora-B) or with mutated KEN (to AAN) (KEN-mut-Aurora-B) or with mutated A-box (QRVL to AAAA) (A-box-mut-Aurora-B), as indicated. Each of these constructs is tagged at the 5' end with V5. Two days posttransfection, cells were synchronized and released from synchrony as in panel A and collected for Western blotting with anti-V5 or anti-cyclin B1 or antiactin (control). Results shown are representative of five experiments. G. The top two blots show the results of a similar assay with HeLa cells transiently transfected with wild-type Aurora-B or 3D-boxesmut (in which the three D-boxes were mutated). The bottom two blots shows HeLa cells transfected with Del-16C mutant. This mutant migrated at a lower molecular weight than endogenous Aurora-B, as the last 16 amino acids at the C terminus were truncated.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 6. A-box Aurora-B or KEN box-mutated Aurora-B accumulates in the midbody zone. HeLa cells were transiently transfected with equal concentrations of wild-type (wt) Aurora-B-GFP construct (panels A to C) or mutant Aurora-B-GFP, containing AAAA instead of QRVL in the A-box (panels A' to C'). Cells were stained with 1 µM Hoechst stain and visualized using a fluorescence microscope (Olympus IX70, 100x objective) to view GFP (green) or Hoechst stain (blue) or the fluorescence images merged with a phase-contrast microscope. Pictures shown are representative of at least 10 images taken at each phase of the cell cycle, guided by the presence or lack of chromosome condensation viewed viaHoechst staining. Starting at metaphase, both wild-type and A-box-mutated Aurora-B-GFP are localized on chromosomes (A and A'). They are then clearly viewed at the midzone (indicated by arrow) during anaphase (B and B'). In late cytokinesis (C and C'), wild-type Aurora-B-GFP dissociates from the midbody and it reaches undetectable levels. In contrast, mutant Aurora-B-GFP remains at the midzone (B') and persists there. Consequently, the frequency of cells captured at late anaphase (likely arrested) was much greater (at least threefold) in cultures transfected with the mutated construct. Cells were also transfected with a KEN box-mutated Aurora-B-GFP construct (panels A", B", and C" cells at metaphase, late anaphase, and cytokinesis, respectively). A greater abundance of Aurora-B-GFP in the midbody zone, compared with that of the wild-type construct, was evident; however, a modest level was also localized in the cytosol (indicated by the three arrows in panel A").

Expression of wild-type or mutated Aurora-B-GFP fusion proteins. Several studies showed that GFP subcloned in frame does not interfere with the cell cycle-regulated expression and localization of Aurora-B in transfected cells (28, 29, 50). Hence, we decided to follow the localization of mutated Aurora-B in comparison with that of wild-type protein. Each was fused in frame to GFP as described in Materials and Methods. Although the efficiency of transfection of these cells is in the range of 50%, as also determined with a cytomegalovirus-ß-galactosidase construct (our data not shown), only a fraction of the cells is expected to be captured at mitosis and hence, to display fluorescence. We noted that a large number of cells transfected with the A-box mutant Aurora-B-GFP construct are arrested at late anaphase with Aurora-B accumulated at the midzone, compared to normal localization and degradation of the wild-type protein (compare Fig. 6A to C to Fig. 6A' to C'). Also, the signal is significantly less intense in the latter cells. Cells transfected with KEN box-mutated Aurora-B-GFP construct show abundance of this protein compared with the wild-type protein. It is properly localized during late mitosis; however, a modest level is also detected in the cytosol (Fig. 6A" to C"). This could be due to excess overexpressed protein or truncation of a localization signal. Examination of sequences surrounding the KEN box (QKENAYPWP), using the PSORT program (30), suggested a nuclear localization signal with a probability of 94%. Interestingly, a similar KEN box-containing motif was identified as both a stabilizing and nuclear localization element in the kinesin-related motor protein Cin8p (17).

Stable Aurora-B significantly promotes aneuploidy and anchorage-independent growth. Aurora-B has been reported as highly expressed in transformed cells, while malignancy is often associated with aneuploidy (see the introduction). Here, we examined whether expression of stable Aurora-B in nontransformed epithelial cells affects these cellular parameters. Figure 7A shows a representative Western blot analysis of a cell extract prepared from NMuMG or from stable NMuMG clones carrying the empty vector or expressing the wild-type or A-box mutated Aurora-B. We have chosen to analyze a pool of cells which represents a population of events so as not to base conclusions on properties of single (and perhaps unique) clones. We selected pools in which the protein level and activity of overexpressed wild-type or mutated Aurora-B were in a similar range, as indicated by Western blot analysis of Aurora-B and of phosphorylated histone H3 (Ser10) (indicator of Aurora-B activity). Although both KEN box and A-box mutations conferred stability, we decided to pursue these functional studies using the A-box mutated Aurora-B, since the mutation did not compromise its localization pattern during mitosis. As shown in Fig. 6, the wild-type protein, although notable, is degraded at late anaphase, while cells that express the A-box-mutated, stable protein atypically display it at telophase. Hence, we examined whether this stable mutant has a greater tendency to induce aneuploidy. Flow cytometry analysis clearly indicated a greater accumulation of aneuploid cells and reduction in the fraction of diploid cells in mutated Aurora-B-expressing cell cultures compared with those of control cells or cells overexpressing the wild-type form (Fig. 7B). Furthermore, we performed similar analyses on several populations of cells derived from single cells to address the clonal variation of this phenotype (a representative clone 1 is shown in Fig. 7B and C). Data indicated that clonal variation among different populations of cells is not significant with respect to the degree of aneuploidy induced by the stable A-box mutant. In accordance, chromosome analysis indicated a significantly larger number of cells with more than the diploid number of chromosomes in cultures expressing A-box-mutated Aurora-B (Fig. 7C). Similar results were obtained when NIH 3T3 cells transfected with the above constructs (data not shown).





View larger version (89K):
[in this window]
[in a new window]
 
FIG. 7. A-box mutated Aurora-B increases mitotic histone H3-Ser10 phosphorylation and contributes to chromosome number instability. A. Shown is a representative Western blot analysis of cellular extract prepared from NMuMG stably transfected with empty vector or with wild-type (Wt) or A-box-mutated Aurora-B (both forms have GFP linked to the N terminus), using anti-Aurora-B. Phosphorylated (Phospho) histone H3 (Ser10) level in the stable transfectants was evaluated by blotting with phosphor-S10-H3-specific antibody. Longer exposure of the blots revealed a ban in the vector-transfected or control samples as well. Total histone H3 levels were also evaluated to verify equal loading of samples. Normalization based on the latter showed that these wild-type or mutated Aurora-B clones (which express the protein at levels similar to those shown here) display comparable levels of histone H3 phosphorylation. B. Fluorescence-activated cell sorting (FACS) analysis showing the ploidy state in NMuMG (Normal), empty vector-, wild-type (Wt)- and mutated Aurora-B-stable transfectants. To show clonal variation, FACS analysis was also performed on a population of cells (clone 1) derived from a single cell via limited dilution. C. The effect of nondegradable Aurora-B on chromosome number instability was also evaluated by chromosome analysis (100 cells analyzed per each sample) and tabulated according to the number of metaphase chromosomes. NMuMG stably expressed with empty vector or with wild-type and A-box mutated Aurora-B were treated with Colcemid (15 ng/ml) for 18 h, chromosomes were prepared by acetic acid-methanol fixation, stained with DAPI, and visualized with a fluorescence microscope with a 1,000x objective as detailed in Materials and Methods. D. Typical metaphase chromosome spreads in NMuMG (Normal),and cells stably expressing empty vector or wild-type (Wt) and A-box-mutated Aurora-B. The numbers of chromosomes (40 for diploid cells) are indicated below the images.

To further study the cellular function of nondegradable Aurora-B, the above stable clones were plated in soft agar as described in Materials and Methods. As expected, the normal epithelial cells did not form an appreciable number of colonies in soft agar. Some colonies were noted in cultures overexpressing wild-type Aurora-B, and a significantly greater number was scored in the case of mutated Aurora-B (Fig. 8). Interestingly, the size of the colonies was also substantially larger in cells overexpressing the mutated Aurora-B.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 8. Nondegradable Aurora-B mutant promotes anchorage-independent growth in soft agar. A. To study the cellular functions of nondegradable Aurora-B, we used NMuMG (Normal) engineered to stably overexpress wild-type (Wt) or nondegradable Aurora-B mutant. NMuMG were plated in soft agar as described in Materials and Methods. Pictures shown are typical light-phase fields viewed with a 4x objective. B. Colony numbers were determined by scoring the ones with a diameter greater than 35 pixels, representing three cells (using digital image by OpenLab software in conjunction with Olympus IX70 fluorescence microscope) (top panel). The bottom panel displays colony number segregated based on colony size, comparing mammary epithelial cells stably expressing wild-type (Wt) and A-box-mutated Aurora-B. All experiments were repeated three times.


arrow
DISCUSSION
 
As Aurora-B is a mitotic kinase, it is conceivable that Aurora-B might be regulated throughout the cell cycle at different levels, including at mRNA and protein levels, as shown in megakaryocytic and other cell lines (21, 22), and/or at enzyme activity level (42). Mitotic regulators are typically degraded via the ubiquitin-proteasome pathway and APC/c. This has also been proven to be the case for Aurora-A (9, 43). In the present study we showed that Aurora-B has a relatively short half life and that it is ubiquitinated and capable of associating in vivo with the APC/c subunit Cdc27. Furthermore, its level is elevated by inhibitors of the proteasome. These properties are hallmarks of degradation via the ubiquitin-proteasome pathway. Regulators of early mitosis are typically targeted to degradation by association with Cdc20 protein, while regulators of late mitosis are targeted by Cdh1 (reviewed in references 24, 25, and 35). Aurora-B has been recognized as expressed at early as well as late mitosis, being localized to kinetochores at early mitosis, and relocated to the midbody as the cells prepare for cytokinesis (reviewed in reference 44). Live imaging of GFP-tagged Aurora-B suggested that this protein level remains the same at the metaphase/anaphase transition and that it is degraded at the completion of cytokinesis (28). Hence, it became of interest to examine whether Cdc20 and/or Cdh1 can promote Aurora-B degradation. To our surprise, we found that both these proteins can associate in vivo with Aurora-B and that their overexpression resulted in diminished Aurora-B levels in the cells. This method of overexpression has been previously employed to demonstrate that Cdc20, but not Cdh1, reduces Aurora-A level in HeLa cells (43). It is conceivable that a low level of degradation of Aurora-B by Cdc20 takes place during early mitosis, leaving an adequate concentration of this kinase to execute late mitotic functions. Alternatively, it is possible that the binding of Aurora-B to Cdc20 is of no major functional significance under normal conditions and that it becomes relevant when the protein is mislocalized (e.g., not translocated from the chromosomes to the midzone) or not attached to the chromosome passenger protein complex. It was shown in living Drosophila cells and in Xenopus laevis that Cdc20 predominately localizes to spindles, kinetochores, and centrosomes in early mitosis, while Cdh1 is found at centrosomes throughout mitosis (7, 39, 47). Interestingly, a recent study reported that the Aurora-B/INCENP complex induces the localization of Cdc20 at the kinetochore, among other proteins (47).

In order to obtain further insight on mechanisms of Aurora-B stabilization, we examined the roles of putative destruction boxes in this respect. The degradation of early regulators of mitosis, such as cyclin B, typically depends on an intact D-box consisting of RXXL (51). Here, we showed that mutation or deletion of different or all D-boxes had no impact on Aurora-B stability. On the other hand, mutation of the KEN box at the N terminus is sufficient to stabilize the protein. Interestingly, the newly recognized A-box (5, 26) is also important for Aurora-B degradation. In the Xenopus, human, or mouse form of Aurora-A, the A-box consists of several conserved residues, AQRXLXXSXXXQRVL, which constitute degradation signals that can be recognized by both Cdc20 and Cdh1, as suggested by Castro et al. (5). In the above species, Aurora-B contains the residues QRVL conserved at amino acid positions 26 to 29. Mutation of QRVL, which we refer to as A-box, results in Aurora-B stabilization. Mutation of A-box sequences significantly reduces the binding of Cdh1 to Aurora-B, as revealed by an immunoprecipitation assay. On the other hand, mutation of KEN box sequences does not compromise the binding of Cdh1 or Cdc20, suggesting other possible ways in which Aurora-B is recruited/recognized by the APC/c. Our data also indicated that mutation of either of these boxes clearly reduces Aurora-B polyubiquitination, including in cells overexpressing Cdh1 or Cdc20. Finally, we generated and examined Aurora-B fusion proteins (wild type or mutated) tagged with GFP. Other studies demonstrated that GFP tagging of Aurora-B does not interfere with its proper expression and nuclear localization (28, 29, 50). We showed that expression of a construct in which the A-box was mutated results in a high frequency of cells arrested at late anaphase and in cells where Aurora-B accumulates at the midzone. Cells transfected with KEN box-mutated Aurora-B-GFP construct displayed greater abundance of this protein compared with cells transfected with the wild-type construct. While this report was under review, work was published by Scrittori et al. that focused on the effects of specific sequence deletions on Aurora-B localization and activity (41). Cells transfected with an Aurora-B construct deleted of the first 66 amino acids (including the KEN box) displayed this protein as properly localized at anaphase/telophase, although careful examination of the images also indicates some diffused protein (41). In accordance, in our investigation, expression of the KEN box-mutated Aurora-B (amino acids 4 to 6) resulted in its proper localization at the midzone at anaphase, but some protein was also detected out of the midzone area. This could be due to excess of overexpressed protein. Interestingly, however, examination of sequences surrounding the KEN box (QKENAYPWP), using the PSORT program (30), suggests a high probability of a nuclear localization signal. A similar KEN box-containing motif was identified as both a stabilizing and nuclear localization element in the kinesin-related motor protein Cin8p (17).

Various studies have linked aneuploidy with cellular transformation. A major inducer of aneuploidy is an aberrant cytokinesis. The latter can be caused by deregulated expression of related regulators, such as the chromosome passenger proteins, including Aurora-B. As described in the introduction, Aurora-B is highly expressed in various tumors and overexpression of wild-type protein in Chinese hamster embryo cells causes accumulation of polyploid cells (32). Here, we show that sustained expression of a form of Aurora-B, which tends to accumulate in the midbody zone at anaphase, induces significant aneuploidy in normal cells as well as anchorage-independent growth, a hallmark of transformation. Overexpression of wild-type Aurora-B is also capable of inducing these effects, albeit to a significantly lesser extent. Future studies will examine this phenomenon in a variety of cell types, including those of primary origin. Of note is a recent study in which knock down of the tumor suppressor BRCA2 and a consequent aneuploidy are linked to a newly established role for this protein in promoting cytokinesis (8).

In summary, our study demonstrates that Aurora-B is a short-lived protein, which is polyubiquitinated and degraded by the proteasome pathway. It is targeted by Cdh1 or Cdc20 binding and is dependent for its degradation on intact KEN and QRVL sequences at the N-terminal domain. An intact KEN box is also required for protein targeting to the nucleus. The degradation-resistant form of Aurora-B, which we identified here, has been valuable in proving that sustained levels of Aurora-B expression can lead to aneuploidy and anchorage-independent growth.


arrow
ACKNOWLEDGMENTS
 
We thank Dorothy Pazin for participating in construction of GFP constructs. We also thank Michael Sherman for critically reading this paper and for insight.

This work was partially supported by NIH grant NHLBI 58537 to Katya Ravid and by a cancer center core grant (NCI) at BUSM. Katya Ravid is an Established Investigator with the American Heart Association. Hao Nguyen was supported by NIH institutional training grant T32 HL07035-NHLBI and by a Grunebaum Cancer Research fellowship.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Boston University School of Medicine, 715 Albany Street, K225, Boston, MA 02118. Phone: (617) 638-5053. Fax: (617) 638-5054. E-mail: ravid{at}biochem.bumc.bu.edu. Back


arrow
REFERENCES
 
    1
  1. Adams, R. R., M. Carmena, and W. C. Earnshaw. 2001. Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol. 11:49-54.[CrossRef][Medline]
  2. 2
  3. Brandeis, M., and T. Hunt. 1996. The proteolysis of mitotic cyclins in mammalian cells persists from the end of mitosis until the onset of S phase. EMBO J. 15:5280-5289.[Medline]
  4. 3
  5. Castro, A., Y. Arlot-Bonnemains, S. Vigneron, J. C. Labbe, C. Prigent, and T. Lorca. 2002. APC/Fizzy-related targets Aurora-A kinase for proteolysis. EMBO Rep. 3:457-462.[CrossRef][Medline]
  6. 4
  7. Castro, A., S. Vigneron, C. Bernis, J. C. Labbe, and T. Lorca. 2003. Xkid is degraded in a D-box, KEN-box, and A-box-independent pathway. Mol. Cell. Biol. 23:4126-4138.[Abstract/Free Full Text]
  8. 5
  9. Castro, A., S. Vigneron, C. Bernis, J. C. Labbe, C. Prigent, and T. Lorca. 2002. The D-Box-activating domain (DAD) is a new proteolysis signal that stimulates the silent D-Box sequence of Aurora-A. EMBO Rep. 3:1209-1214.[CrossRef][Medline]
  10. 6
  11. Chinnappan, D., Y. Zhang, and K. Ravid. 2002. AIM-1 transgenic mice with a curly tail phenotype and its chromosome location. Cytogenet. Genome Res. 98:231A.[CrossRef][Medline]
  12. 7
  13. Clute, P., and J. Pines. 1999. Temporal and spatial control of cyclin B1 destruction in metaphase. Nat. Cell Biol. 1:82-87.[CrossRef][Medline]
  14. 8
  15. Daniels, M. J., Y. Wang, M. Lee, and A. R. Venkitaraman. 2004. Abnormal cytokinesis in cells deficient in the breast cancer susceptibility protein BRCA2. Science 306:876-879.[Abstract/Free Full Text]
  16. 9
  17. Farruggio, D. C., F. M. Townsley, and J. V. Ruderman. 1999. Cdc20 associates with the kinase aurora2/Aik. Proc. Natl. Acad. Sci. USA 96:7306-7311.[Abstract/Free Full Text]
  18. 10
  19. Gassmann, R., A. Carvalho, A. J. Henzing, S. Ruchaud, D. F. Hudson, R. Honda, E. A. Nigg, D. L. Gerloff, and W. C. Earnshaw. 2004. Borealin: a novel chromosomal passenger required for stability of the bipolar mitotic spindle. J. Cell Biol. 166:179-191.[Abstract/Free Full Text]
  20. 11
  21. Giet, R., and D. M. Glover. 2001. Drosophila aurora B kinase is required for histone H3 phosphorylation and condensin recruitment during chromosome condensation and to organize the central spindle during cytokinesis. J. Cell Biol. 152:669-682.[Abstract/Free Full Text]
  22. 12
  23. Goto, H., Y. Yasui, A. Kawajiri, E. A. Nigg, Y. Terada, M. Tatsuka, K. Nagata, and M. Inagaki. 2003. Aurora-B regulates the cleavage furrow-specific vimentin phosphorylation in the cytokinetic process. J. Biol. Chem. 278:8526-8530.[Abstract/Free Full Text]
  24. 13
  25. Harper, J. W., J. L. Burton, and M. J. Solomon. 2002. The anaphase-promoting complex: it's not just for mitosis any more. Genes Dev. 16:2179-2206.[Free Full Text]
  26. 14
  27. Hauf, S., R. W. Cole, S. LaTerra, C. Zimmer, G. Schnapp, R. Walter, A. Heckel, J. van Meel, C. L. Rieder, and J. M. Peters. 2003. The small molecule Hesperadin reveals a role for Aurora-B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J. Cell Biol. 161:281-294.[Abstract/Free Full Text]
  28. 15
  29. Hershko, A. 1999. Mechanisms and regulation of the degradation of cyclin B. Philos. Trans. R. Soc. Lond. B 354:1571-1576.[Abstract/Free Full Text]
  30. 16
  31. Hershko, A. 1997. Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr. Opin. Cell Biol. 9:788-799.[CrossRef][Medline]
  32. 17
  33. Hildebrandt, E. R., and M. A. Hoyt. 2001. Cell cycle-dependent degradation of the Saccharomyces cerevisiae spindle motor Cin8p requires APC(Cdh1) and a bipartite destruction sequence. Mol. Biol. Cell 12:3402-3416.[Abstract/Free Full Text]
  34. 18
  35. Irniger, S., and K. Nasmyth. 1997. The anaphase-promoting complex is required in G1 arrested yeast cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase. J. Cell Sci. 110:1523-1531.[Abstract]
  36. 19
  37. Jorgensen, P. M., E. Brundell, M. Starborg, and C. Hoog. 1998. A subunit of the anaphase-promoting complex is a centromere-associated protein in mammalian cells. Mol. Cell. Biol. 18:468-476.[Abstract/Free Full Text]
  38. 20
  39. Katayama, H., W. R. Brinkley, and S. Sen. 2003. The Aurora kinases: role in cell transformation and tumorigenesis. Cancer Metastasis Rev. 22:451-464.[CrossRef][Medline]
  40. 21
  41. Katayama, H., T. Ota, K. Morita, Y. Terada, F. Suzuki, O. Katoh, and M. Tatsuka. 1998. Human AIM-1: cDNA cloning and reduced expression during endomitosis in megakaryocyte-lineage cells. Gene 224:1-7.[CrossRef][Medline]
  42. 22
  43. Kawasaki, A., I. Matsumura, J.-I. Miyagawa, S. Ezoe, H. Tanaka, Y. Terada, M. Tatsuka, T. Machii, H. Miyazaki, Y. Furukawa, and Y. Kanakura. 2001. Downregulation of an AIM-1 kinase couples with megakaryocytic polyploidization of human hematopoietic cells. J. Cell Biol. 152:275-287.[Abstract/Free Full Text]
  44. 23
  45. King, R. W., M. Glotzer, and M. W. Kirschner. 1996. Mutagenic analysis of the destruction signal of mitotic cyclins and structural characterization of ubiquitinated intermediates. Mol. Biol. Cell 7:1343-1357.[Abstract]
  46. 24
  47. Kornitzer, D., and A. Ciechanover. 2000. Modes of regulation of ubiquitin-mediated protein degradation. J. Cell. Physiol. 182:1-11.[CrossRef][Medline]
  48. 25
  49. Kramer, E. R., N. Scheuringer, A. V. Podtelejnikov, M. Mann, and J. M. Peters. 2000. Mitotic regulation of the APC activator proteins CDC20 and CDH1. Mol. Biol. Cell 11:1555-1569.[Abstract/Free Full Text]
  50. 26
  51. Littlepage, L. E., and J. V. Ruderman. 2002. Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora-A during mitotic exit. Genes Dev. 16:2274-2285.[Abstract/Free Full Text]
  52. 27
  53. Lu, J., A. Pierron, and K. Ravid. 2003. An adenosine analogue, IB-MECA, down-regulates estrogen receptor alpha and suppresses human breast cancer cell proliferation. Cancer Res. 63:6413-6423.[Abstract/Free Full Text]
  54. 28
  55. Murata-Hori, M., M. Tatsuka, and Y. L. Wang. 2002. Probing the dynamics and functions of aurora B kinase in living cells during mitosis and cytokinesis. Mol. Biol. Cell 13:1099-1108.[Abstract/Free Full Text]
  56. 29
  57. Murata-Hori, M., and Y. L. Wang. 2002. The kinase activity of aurora B is required for kinetochore-microtubule interactions during mitosis. Curr. Biol. 12:894-899.[CrossRef][Medline]
  58. 30
  59. Nakai, K., and P. Horton. 1999. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem. Sci. 24:34-36.[CrossRef][Medline]
  60. 31
  61. Nigg, E. A. 2001. Mitotic kinases as regulators of cell division and its checkpoints. Nat. Rev. Mol. Cell Biol. 2:21-32.[CrossRef][Medline]
  62. 32
  63. Ota, T., S. Suto, H. Katayama, Z. B. Han, F. Suzuki, M. Maeda, M. Tanino, Y. Terada, and M. Tatsuka. 2002. Increased mitotic phosphorylation of histone H3 attributable to AIM-1/Aurora-B overexpression contributes to chromosome number instability. Cancer Res. 62:5168-5177.[Abstract/Free Full Text]
  64. 33
  65. Pagano, M. 1997. Cell cycle regulation by the ubiquitin pathway. FASEB J. 11:1067-1075.[Abstract]
  66. 34
  67. Peters, J. M. 2002. The anaphase-promoting complex: proteolysis in mitosis and beyond. Mol. Cell 9:931-943.[CrossRef][Medline]
  68. 35
  69. Petersen, B. O., C. Wagener, F. Marinoni, E. R. Kramer, M. Melixetian, E. L. Denchi, C. Gieffers, C. Matteucci, J. M. Peters, and K. Helin. 2000. Cell cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on APC-CDH1. Genes Dev. 14:2330-2343.[Abstract/Free Full Text]
  70. 36
  71. Pfleger, C. M., and M. W. Kirschner. 2000. The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev. 14:655-665.[Abstract/Free Full Text]
  72. 37
  73. Pfleger, C. M., E. Lee, and M. W. Kirschner. 2001. Substrate recognition by the Cdc20 and Cdh1 components of the anaphase-promoting complex. Genes Dev. 15:2396-2407.[Abstract/Free Full Text]
  74. 38
  75. Prinz, S., E. S. Hwang, R. Visintin, and A. Amon. 1998. The regulation of Cdc20 proteolysis reveals a role for APC components Cdc23 and Cdc27 during S phase and early mitosis. Curr. Biol. 8:750-760.[CrossRef][Medline]
  76. 39
  77. Raff, J. W., K. Jeffers, and J. Y. Huang. 2002. The roles of Fzy/Cdc20 and Fzr/Cdh1 in regulating the destruction of cyclin B in space and time. J. Cell Biol. 157:1139-1149.[Abstract/Free Full Text]
  78. 40
  79. Sampath, S. C., R. Ohi, O. Leismann, A. Salic, A. Pozniakovski, and H. Funabiki. 2004. The chromosomal passenger complex is required for chromatin-induced microtubule stabilization and spindle assembly. Cell 118:187-202.[CrossRef][Medline]
  80. 41
  81. Scrittori, L., D. A. Skoufias, F. Hans, V. Gerson, P. Sassone-Corsi, S. Dimitrov, and R. L. Margolis. 2005. A small C-terminal sequence of Aurora B is responsible for localization and function. Mol. Biol. Cell 16:292-305.[Abstract/Free Full Text]
  82. 42
  83. Sugiyama, K., K. Sugiura, T. Hara, K. Sugimoto, H. Shima, K. Honda, K. Furukawa, S. Yamashita, and T. Urano. 2002. Aurora-B associated protein phosphatases as negative regulators of kinase activation. Oncogene 21:3103-3111.[CrossRef][Medline]
  84. 43
  85. Taguchi, S., K. Honda, K. Sugiura, A. Yamaguchi, K. Furukawa, and T. Urano. 2002. Degradation of human Aurora-A protein kinase is mediated by hCdh1. FEBS Lett. 519:59-65.[CrossRef][Medline]
  86. 44
  87. Terada, Y. 2001. Role of chromosomal passenger complex in chromosome segregation and cytokinesis. Cell Struct. Funct. 26:653-657.[CrossRef][Medline]
  88. 45
  89. Terada, Y., M. Tatsuka, F. Suzuki, Y. Yasuda, S. Fujita, and M. Otsu. 1998. AIM-1: a mammalian midbody-associated protein required for cytokinesis. EMBO J. 17:667-676.[CrossRef][Medline]
  90. 46
  91. Townsley, F. M., and J. V. Ruderman. 1998. Proteolytic ratchets that control progression through mitosis. Trends Cell Biol. 8:238-244.[CrossRef][Medline]
  92. 47
  93. Vigneron, S., S. Prieto, C. Bernis, J. C. Labbe, A. Castro, and T. Lorca. 2004. Kinetochore localization of spindle checkpoint proteins: who controls whom? Mol. Biol. Cell 15:4584-4596.[Abstract/Free Full Text]
  94. 48
  95. Vodermaier, H. C. 2001. Cell cycle: waiters serving the destruction machinery. Curr. Biol. 11:R834-R837.[CrossRef][Medline]
  96. 49
  97. Wang, Z., Y. Zhang, J. Lu, S. Sun, and K. Ravid. 1999. Mp1 ligand enhances the transcription of the cyclin D3 gene: a potential role for Sp1 transcription factor. Blood 93:4208-4221.[Abstract/Free Full Text]
  98. 50
  99. Wheatley, S. P., A. Carvalho, P. Vagnarelli, and W. C. Earnshaw. 2001. INCENP is required for proper targeting of Survivin to the centromeres and the anaphase spindle during mitosis. Curr. Biol. 11:886-890.[CrossRef][Medline]
  100. 51
  101. Yamano, H., J. Gannon, H. Mahbubani, and T. Hunt. 2004. Cell cycle-regulated recognition of the destruction box of cyclin B by the APC/C in Xenopus egg extracts. Mol. Cell 13:137-147.[CrossRef][Medline]
  102. 52
  103. Zhang, Y., Y. Nagata, G. Yu, H. G. Nguyen, M. R. Jones, P. Toselli, C. W. Jackson, M. Tatsuka, K. Todokoro, and K. Ravid. 2004. Aberrant quantity and localization of Aurora-B/AIM-1 and survivin during megakaryocyte polyploidization and the consequences of Aurora-B/AIM-1-deregulated expression. Blood 103:3717-3726.[Abstract/Free Full Text]
  104. 53
  105. Zhang, Y., S. Sun, Z. Wang, J. M. Zimmet, Y. Kaluzhny, A. Thompson, and K. Ravid. 2002. Signaling by the Mpl receptor involves IKK and NF-{kappa}B. J. Cell. Biochem. 85:523-535.[CrossRef][Medline]
  106. 54
  107. Zhang, Y., Z. Wang, and K. Ravid. 1996. The cell cycle in polyploid megakaryocytes is associated with reduced activity of cyclin B1-dependent cdc2 kinase. J. Biol. Chem. 271:4266-4272.[Abstract/Free Full Text]
  108. 55
  109. Zur, A., and M. Brandeis. 2001. Securin degradation is mediated by fzy and fzr, and is required for complete chromatid separation but not for cytokinesis. EMBO J. 20:792-801.[CrossRef][Medline]


Molecular and Cellular Biology, June 2005, p. 4977-4992, Vol. 25, No. 12
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.12.4977-4992.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Nguyen, H. G., Korach, A., Collura, C., Eskenazi, B. R., Vita, J. A., Shapira, O. M. (2009). Differential effects of natriuretic peptides on arterial and venous coronary artery bypass conduits.. Ann. Thorac. Surg. 87: 748-756 [Abstract] [Full Text]  
  • Ryser, S., Dizin, E., Jefford, C. E., Delaval, B., Gagos, S., Christodoulidou, A., Krause, K.-H., Birnbaum, D., Irminger-Finger, I. (2009). Distinct Roles of BARD1 Isoforms in Mitosis: Full-Length BARD1 Mediates Aurora B Degradation, Cancer-Associated BARD1{beta} Scaffolds Aurora B and BRCA2. Cancer Res. 69: 1125-1134 [Abstract] [Full Text]  
  • Slawson, C., Lakshmanan, T., Knapp, S., Hart, G. W. (2008). A Mitotic GlcNAcylation/Phosphorylation Signaling Complex Alters the Posttranslational State of the Cytoskeletal Protein Vimentin. Mol. Biol. Cell 19: 4130-4140 [Abstract] [Full Text]  
  • Park, H. J., Costa, R. H., Lau, L. F., Tyner, A. L., Raychaudhuri, P. (2008). Anaphase-Promoting Complex/Cyclosome-Cdh1-Mediated Proteolysis of the Forkhead Box M1 Transcription Factor Is Critical for Regulated Entry into S Phase. Mol. Cell. Biol. 28: 5162-5171 [Abstract] [Full Text]  
  • Yamamoto, T. M., Lewellyn, A. L., Maller, J. L. (2008). Regulation of the Aurora B Chromosome Passenger Protein Complex during Oocyte Maturation in Xenopus laevis. Mol. Cell. Biol. 28: 4196-4203 [Abstract] [Full Text]  
  • Mukai, A., Mizuno, E., Kobayashi, K., Matsumoto, M., Nakayama, K. I., Kitamura, N., Komada, M. (2008). Dynamic regulation of ubiquitylation and deubiquitylation at the central spindle during cytokinesis. J. Cell Sci. 121: 1325-1333 [Abstract] [Full Text]  
  • Connell, C. M., Colnaghi, R., Wheatley, S. P. (2008). Nuclear Survivin Has Reduced Stability and Is Not Cytoprotective. J. Biol. Chem. 283: 3289-3296 [Abstract] [Full Text]  
  • Wang, Y., Zhan, Q. (2007). Cell Cycle-dependent Expression of Centrosomal Ninein-like Protein in Human Cells Is Regulated by the Anaphase-promoting Complex. J. Biol. Chem. 282: 17712-17719 [Abstract] [Full Text]  
  • Hong, K. U., Park, Y. S., Seong, Y.-S., Kang, D., Bae, C.-D., Park, J. (2007). Functional Importance of the Anaphase-Promoting Complex-Cdh1-Mediated Degradation of TMAP/CKAP2 in Regulation of Spindle Function and Cytokinesis. Mol. Cell. Biol. 27: 3667-3681 [Abstract] [Full Text]  
  • Fu, J., Bian, M., Jiang, Q., Zhang, C. (2007). Roles of Aurora Kinases in Mitosis and Tumorigenesis. Mol Cancer Res 5: 1-10 [Abstract] [Full Text]  
  • Yu, X., Fu, S., Lai, M., Baer, R., Chen, J. (2006). BRCA1 ubiquitinates its phosphorylation-dependent binding partner CtIP.. Genes Dev. 20: 1721-1726 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nguyen, H. G.
Right arrow Articles by Ravid, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nguyen, H. G.
Right arrow Articles by Ravid, K.