![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, June 2005, p. 5171-5182, Vol. 25, No. 12
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.12.5171-5182.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Prashant Sharma,1,
Meropi Athanasiou,2,
Amit Kumar,1
Satoru Yamada,1, and
Michael R. Kuehn1*
Laboratory of Protein Dynamics and Signaling Basic Research Program, SAIC—Frederick, National Cancer Institute, NCI—Frederick, Frederick, Maryland 217022
Received 30 March 2004/ Returned for modification 10 May 2004/ Accepted 11 March 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B indirectly affects its stability by antagonizing ubiquitination (8), whereas sumoylation of RanGAP1 and PML regulates their subcellular localization to the nuclear pore and nuclear bodies, respectively (31, 35, 45). In addition, mammals have four SUMOs: SUMO-1 (also known as GMP-1, PIC1, UBL1, Sentrin, SMT3C, or Smt3h3) and the highly related SUMO-2 (also known as Sentrin-3, SMT3B, or Smt3h2), SUMO-3 (also known as Sentrin-2, SMT3A, or Smt3h1), and the recently discovered SUMO-4 (7). These can modify distinct sets of target proteins and therefore probably serve distinct functions (40). SUMO is added to lysine residues on target proteins by a three-step process involving E1, E2, and E3 enzymatic activities that show great similarity to the corresponding ubiquitin-specific pathway enzymes. Again like ubiquitination, sumoylation is a dynamic, reversible process with deconjugation influencing overall levels of sumoylated forms of target proteins. The first desumoylating enzyme identified, Ulp1 from yeast, was found to be bifunctional, acting both to deconjugate sumoylated proteins and to carry out proteolytic processing of immature SUMO (26). A second yeast protein, Smt4/Ulp2, and several vertebrate proteins that share homology to Ulp1 and show evidence for desumoylation activity have since been identified (reviewed in references 15, 32, and 43). These include Sentrin protease 1 (SENP1) (13), SUMO-specific protease 1 (SUSP1, also known as SENP6) (19), and Smt3-specific isopeptidase 1 (Smt3IP1, also called SENP3, SUSP3, or SuPr-3) (37). There are also three proteins encoded by splice variants of the same gene, namely: SENP2, also called Axam; Smt3IP2, also called Axam2; and SuPr-1 (6, 17, 36). In yeast, Ulp1 and Smt4/Ulp2 have nonoverlapping biological functions. Mutations in Ulp1 cause cell cycle defects and are lethal (26), whereas Smt4/Ulp2 mutants are viable but do not undergo normal meiosis, among other defects (28, 42). In addition, Ulp1 and Smt4/Ulp2 have distinct subcellular localizations, a characteristic which appears to be a key element in determining their different substrate specificities (27). The vertebrate desumoylating enzymes also have apparent differences in intracellular distribution, and therefore probably also have different substrates and distinct overall biological functions. However, no mutations that would provide insight into these roles have yet been described.
Here, we describe the characterization of a random retroviral insertional mutation in the gene for the mouse ortholog of SENP1, also known as SuPr-2 (6). The mutation causes a net increase in the level of conjugation with SUMO-1, but leaves SUMO-2 and SUMO-3 protein sumoylation levels unaffected. In addition, mutant cells show accumulation of unprocessed SUMO-1. These results confirm a role for SENP1/SuPr-2 in both deconjugation and maturation of SUMO-1. The physiological consequences of loss of SENP1/SuPr-2 function during mouse development are first apparent after midgestation in the placenta. These defects appear incompatible with normal placental function and embryonic viability. Our findings highlight the critical importance of regulating levels of sumoylation in the developing mammalian organism.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Gene structure, expression, and enhancer analysis. To extend the 5' end of expressed sequence tag (EST) W64824, 5' rapid amplification of cDNA ends (12) was used. Briefly, first-strand cDNA was synthesized from total e12.5 RNA isolated with TRIzol Reagent (Invitrogen), using Superscript II reverse transcriptase (Invitrogen) primed with oligonucleotides TGAGCCAAGGAAACTGTCTGAGG (lying in SENP1/SuPr-2 exon 5) and AAGCAGTGGTATCAACGCAGAGTACGCGGG. Nested PCR was then carried out using first-round primers AAGCAGTGGTATCAACGCAGAGT and CTGGTCAGAAAGCAGAAGCTGC (lying in exon 2) and second-round primers AAGCAGTGGTATCAACGCAGAGTA and AGCGTCCATCTTCACCCCATCAGC (also lying in exon 2). PCR details are available upon request. PCR products were cloned in pGEM-T Easy (Promega) and sequenced.
For reverse transcriptase (RT)-PCR analysis, first-strand cDNA was synthesized from total RNA isolated from e12.5 wild types and mutants, using random hexamers to prime and SuperScript III First-Strand Synthesis System (Invitrogen) according to the manufacturer's instructions. To amplify upstream exon A (UEA)-specific isoforms, primers CTAGCAGCCGGTTCCGGTTCG (located in UEA) and either GTCACCTGAGCCAAGGAAACTG (in exon 5) or CATCAATGTGACTCCGTGGTGTC (in exon 4) were used. To amplify upstream exon B (UEB) isoforms, primer CCTTACCTGGCTCATCGCCTCTTG (in UEB) was used with either CAAGGAAACTGTCTGAGGAAGGG (in exon 5) or the above exon 4-specific primer. To amplify hypoxanthine phosphoribosyltransferase (HPRT), primers GCTGGTGAAAAGGACCTCTC and CACAGGACTAGAACACCTGC were used. PCR conditions are available upon request.
Real-time PCR was carried out with an Optican2 DNA engine (MJ Research) using a SYBR green PCR kit (Applied Biosystems) with primers CTACAAGAAGCCCAGCCTATCGTC and GTCACCTGAGCCAAGGAAACTG, located in exons 3 and 5, respectively. Amplification with the same HPRT-specific primers served as a reference standard. PCR conditions are available upon request. Cycle threshold (CT) values were determined using Optical2 software with the fluorescence threshold set to 0.016.
To assess enhancer activity, fragments from the first intron were cloned into pGL3-Promoter (Promega), transfected into P19 cells using Lipofectamine, and assayed for luciferase activity as described previously (24).
Transgene phenotype rescue. The complete coding region from W64284, linked to the ROSA26 promoter (22) and polyadenylation sequences from the PGK gene, was introduced into fertilized eggs of the FVB strain by standard methods. Transgene positive founders, identified by Southern blot analysis, were mated with proviral heterozygotes. F1 progeny were intercrossed, and F2 mice were PCR genotyped for the proviral integration as described previously (49) and scored for presence of the transgene by PCR using primers GATTCTGTGTCTTTACTAAAGC and TTGACCAAAGGTTCTTACGTCACC.
Western blotting and antibodies. To prepare protein extracts, fetus and nonmaternal portions of the placenta were isolated separately, washed in cold phosphate-buffered saline (without Ca and Mg), quickly minced, and then transferred into either sodium dodecyl sulfate (SDS) sample buffer (250 mM Tris HCl [pH 6.8], 4% SDS, 10% glycerol, 2% beta-mercaptoethanol) or NP-40 lysis buffer (50 mM Tris HCl [pH 8.0], 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), both supplemented with protease inhibitor cocktail, phenylmethylsulfonyl fluoride, and 10 mM iodoacetamide (prepared fresh at the time of use). Lysates were then passed successively through 19-, 22-, and 25-gauge needles and clarified by centrifugation (13,000 rpm for 30 min at 4°C). Samples in SDS buffer were boiled for 5 min prior to centrifugation. Protein concentrations were determined using a modified Bradford assay (Bio-Rad Laboratories). From 10 to 30 µg of protein extract was then fractionated on 8 to 16% gradient SDS-polyacrylamide gels (Invitrogen), transferred to polyvinylidene difluoride or nitrocellulose membranes using semidry electrophoretic transfer (Hoefer), and processed as described previously (24). The primary antibodies used were rabbit polyclonal anti-SUMO-1 (gift of M. Dasso), mouse monoclonal anti-SUMO-1 (anti-GMP-1; Zymed), rabbit polyclonal anti-SUMO-2 (gift of M. Dasso), rabbit polyclonal anti-SUMO-3 (anti-Sentrin-2; Zymed), mouse monoclonal anti-RanGAP1 (Zymed), and mouse monoclonal anti-green fluorescent protein (anti-GFP) (Clontech). Mouse monoclonal anti-ß-actin (Sigma) was used to confirm equivalent protein loading. Detection of secondary antibody-horseradish peroxidase conjugates was done using Super Signal West Pico solution (Pierce). Blots were stripped using Restore Western Blot Stripping buffer (Pierce) according to the manufacturer's specifications.
Mouse embryo fibroblasts. Mouse embryo fibroblasts (MEFs) were isolated from e12.5 mutant and wild-type fetuses by passing eviscerated torsos successively through 18- and 21-gauge needles. The cell suspension was then placed in a 25-cm2 flask containing Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin. After 2 days, cells were transferred to 75-cm2 flasks, cultured to 90% confluency, and then subcultured at 5 x 105 cells per 75-cm2 flask every 3 to 4 days in the absence of antibiotics. MEFs were maintained in reduced oxygen (3%) to allow long-term culture as described previously (38). To prepare protein extracts, MEFs were lysed directly in flasks by adding either SDS sample buffer or NP-40 lysis buffer and proceeding as described above.
Retrovirus production and infection. An NheI/SmaI fragment containing the GFP-SUMO-1 sequence (20) was inserted at the HindIII site of retroviral vector LNCX (33). High-titer stocks of helper-free retrovirus were generated by transient transfection of Phoenix Ampho packaging cells (21). The LNCX-GFP-SUMO-1 virus-containing supernatants were collected at 6- to 12-h intervals starting 48 h after transfection and were used to infect wild-type and mutant MEFs seeded at 1 x 106 per 10-cm dish in the presence of 8 µg/ml Polybrene. After 24 h, infected cultures were subjected to selection in the presence of 400 µg/ml G418 (Gemini).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
Proviral insertion disrupts SENP1/SuPr-2 expression. As a first step in determining whether SENP1/SuPr-2 is affected in mutants, we examined mRNA expression during normal development. Using RT-PCR analysis with primers corresponding to sequences in UEA and in a downstream exon, we detected SENP1/SuPr-2 mRNA expression starting at about e9.5 (data not shown). This study also revealed a second, larger transcript present at only very low levels, which further analysis showed to be due to alternative inclusion of an intervening exon (Fig. 2B, exon 4). Transcripts initiating in UEB also show alternative splicing of this exon. Examination of the EST database revealed a small number of entries corresponding to the larger transcript, but the majority lacks this exon. Due to its inclusion, these larger transcripts have a frame shift in the following exon (exon 5), resulting in a stop codon, and thus encode truncated translational isoforms lacking the more carboxyl-terminal protease active site (Fig. 2C).
To examine mRNA expression in mutants, RT-PCR was carried out using the above primer sets to detect transcripts initiating in UEA or UEB, supplemented with additional primer sets specific for the minor transcripts. Analysis of e12.5 mutants and wild-type littermates revealed a significant reduction of all transcripts in mutants (Fig. 3A). To obtain a more quantitative estimate of the total level of SENP1/SuPr-2 expression in the mutant compared to the wild type, we carried out real-time RT-PCR using a primer pair that amplifies all of the transcripts. This analysis showed an over 50-fold decrease in transcription in the mutant (Fig. 3B).
|
|
|
|
To provide additional evidence for reduced desumoylation, we carried out immunohistological staining of paraffin sections of e12.5 wild-type and mutant fetus and placenta using anti-SUMO-1 antiserum (Fig. 6). With wild-type fetus and placenta sections, we found strong staining around the nucleus as well as diffuse cytoplasmic staining (Fig. 6A and C). With mutant sections, the staining pattern showed a dramatic shift to strong intranuclear staining (Fig. 6B and D). The intensity of the anti-SUMO-1 staining was such that it occluded the nuclear counterstaining seen for the wild type. These results are consistent with either an increase in the level of sumoylation of nuclear proteins or accumulation of sumoylated proteins within the nucleus due to retargeting to, or retention within, the nuclear compartment.
|
|
RanGAP1 sumoylation in SENP1/SuPr-2 mutants. Studies in cell lines have shown that the major target for sumoylation in higher eukaryotes is the RanGTPase-activating protein RanGAP1, which is approximately 70 kDa when unconjugated and 90 kDa when sumoylated (29). By Western blot analysis of fetal and placental lysates, we found that one of the strongest, if not the strongest, anti-SUMO-1 reactive band was 90 kDa, consistent with it being SUMO-RanGAP1 (Fig. 5A and B; Fig. 8A). Analysis with anti-RanGAP1 antisera also detected a strong band at 90 kDa, which was presumed to be SUMO-conjugated RanGAP1, and a weak 70-kDa band, which was presumed to represent the unsumoylated form (Fig. 8B, lane 1). Thus, as in cell lines, RanGAP1 is the major target for sumoylation also in the developing fetus and placenta and is found predominantly in the conjugated form.
|
We also carried out RanGAP1 immunostaining of sections of wild-type and mutant fetuses. Because anti-RanGAP1 antiserum detects both the unconjugated and sumoylated forms, this approach did not allow a direct determination of any increase in sumoylation. However, because SUMO-RanGAP1 localizes to the nuclear pore complex (29, 31), an increase in perinuclear staining provides indirect evidence for increased RanGAP1 sumoylation in mutants. With wild-type samples, we found strong perinuclear and cytoplasmic staining for RanGAP1, consistent with a significant fraction of the protein normally being sumoylated and associated with the nuclear pore complex (Fig. 8C). In most tissues of the mutant fetus, there was an apparent increase in staining around nuclei, consistent with an accumulation of the sumoylated form of RanGAP1 (Fig. 8D). However, no changes in the placenta were seen (data not shown). Together, these findings provide evidence for a role for SENP1/SuPr-2 desumoylating activity in the normal low-level turnover of SUMO-RanGAP1, but only in the fetal compartment during development.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mutation results in the accumulation of the sumoylated forms of a number of proteins both in the fetus and placenta. Thus, a wide variety of cellular processes potentially could be affected, although the first phenotypic defects are seen in the placenta just after midgestation. At this stage, the fetus begins to exceed the size for simple diffusion and starts to depend on placental circulation for gas and nutrient exchange. In the developing placenta, fetal blood vessels grow up into the labyrinth layer and intercalate into sinuses that fill with maternal blood. Specialized trophoblast cells lining these spaces mediate the necessary interaction between the fetal and maternal blood supplies (1, 9). In the mutant, the placenta appears to develop normally up to approximately e11.5, but by e12.5, the normally porous structure of the labyrinth is absent. There is an increase of apparently undifferentiated trophoblast, which may contribute to there being fewer blood spaces and an overall decrease in fetal blood flow into the placenta. The conspicuous increase in blood in mutant fetuses may be a secondary consequence of the reduced circulation into the placenta, with blood normally allocated to the placental compartment instead being retained within the fetus. Reduced blood flow into the labyrinth, together with an observed increase in the physical separation of the fetal and maternal blood supplies, no doubt severely restricts placental function and compromises fetal survival. An important question is whether these defects are intrinsic to the placenta or arise due to defective instructive signaling from fetal derived cells within the labyrinth. Relevant to this, our preliminary attempts to rescue mutants with either a SENP1/SuPr-2 transgene under the control of the labyrinth-specific promoter of the CYP19 gene (18), or by aggregation of mutant with tetraploid embryos (25) have failed. Thus, it is quite possible that the primary defect is in the fetal compartment.
Our major focus now is to identify SENP1/SuPr-2 targets and ascertain those candidate substrates whose altered sumoylation levels might underlie the mutant phenotype. Our analysis of RanGAP1 has revealed an increase of SUMO-RanGAP1 levels in the fetus and a compensatory loss of unconjugated RanGAP1 as well as increased perinuclear accumulation, providing evidence that sumoylated RanGAP1 is normally an in vivo target. This result was unexpected given that in tissue culture cells, transfected human SENP1 was reported to lack any activity on SUMO-RanGAP1 (13). One explanation for this discrepancy may be the very tightly regulated and extremely low desumoylation rate for SUMO-RanGAP1 revealed in our study. The small amount of SUMO-RanGAP1 available for deconjugation would be handled by endogenous SENP1 activity, and no amount of overexpression of SENP1 would alter the overall levels of the modified form.
A key issue is whether increased steady-state sumoylation of RanGAP1 contributes to the mutant phenotype. The lack of any detectable changes in SUMO-RanGAP1 levels in the placenta might argue against such a role. However, if placental failure in SENP1/SuPr-2 mutants results from fetal defects, the increase in SUMO-RanGAP1 might be contributing in whole or part by causing some adverse effect on nucleocytoplasmic transport, perhaps specifically in the import of sumoylated proteins, as has been postulated previously (39). Thus, the significant increase in nuclear SUMO-1 staining observed with the mutant may be due to altered levels of SUMO-RanGAP1 at the nuclear pore as well as to the lack of SENP1/SuPr-2 desumoylating activity in the nucleus itself.
The nuclear accumulation of SUMO in the mutant is consistent with most known sumoylated proteins being either components of nuclear bodies, transcription factors or cofactors, or proteins involved in maintaining genome integrity (reviewed in reference 43). SUMO modification has been shown to negatively regulate the activity of most known sumoylated transcription factors (10, 47). Thus, overall higher levels of sumoylation might mimic loss of function mutations in a wide variety of transcription factors. In this regard, it is interesting that a targeted null mutation of ARNT, a subunit of the heteromeric transcription factor hypoxia-inducible factor (HIF) recently shown to be sumoylated and to have an altered subnuclear localization and reduced transcriptional activity when modified (46), results in abnormal placental labyrinth development (2, 23). The HIF-1
subunit of HIF also has been shown recently to be sumoylated, which appears to stabilize HIF-1 and thereby increase HIF transcriptional activity (3, 44). Interestingly, null mutation of pVHL, which normally destabilizes HIF-1 by targeting it for proteasomal degradation, results in increased levels of HIF-1 and leads to placental failure (11). Thus, abnormal sumoylation levels of components of the HIF pathway might also lead to placental defects.
Further evaluation of ARNT and HIF-1 as potential SENP1/SuPr-2 substrates and the identification of other candidates, which may include known and previously unknown SUMO target proteins, should be facilitated by exploiting the unique attributes of this mutant mouse strain. For most SUMO targets, the sumoylated forms exist at low levels and/or are sumoylated only transiently and are thus hard to detect. The significant increase in steady-state levels of sumoylated proteins in the mutant, and the use of relaxed stringency lysis conditions that allow continued SUMO protease activity and thus enrich for conjugated proteins specifically targeted by SENP1/SuPr-2, should now permit proteomic approaches to determine their identities and allow an assessment of their potential roles in the mutant phenotype. Regardless of the underlying mechanism, it is clear that perturbations in sumoylation due to deficiency of SENP1/SuPr-2 function illustrate the critical importance of maintaining SUMO homeostasis.
|
ACKNOWLEDGMENTS |
|---|
Animal care was provided in accordance with the procedures outlined in the "Guide for the care and use of laboratory animals" (NIH publication no. 86-23, 1985).
This study has been funded in part by federal funds from the National Cancer Institute under contract no. NO1-CO-12400.
The content of the manuscript does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. government.
|
FOOTNOTES |
|---|
Present address: Kagoshima University Dental School, Department of Preventive Dentistry, Sakuragaoka 8-35-1, Kagoshima-shi, Kagoshima 890-8544, Japan.
Present address: Osaka University Graduate School of Dentistry, Department of Periodontology, Division of Oral Biology and Disease Control, 1-8 Yamadaoka, Suita, Osaka 565-0871, Japan.
P.S. and M.A. contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Adelman, D. M., M. Gertsenstein, A. Nagy, M. C. Simon, and E. Maltepe. 2000. Placental cell fates are regulated in vivo by HIF-mediated hypoxia responses. Genes Dev. 14:3191-3203.
3. Bae, S.-H., J.-W. Jeong, J. A. Park, S.-H. Kim, M.-K. Bae, S.-J. Choi, and K.-W. Kim. 2004. Sumoylation increases HIF-1 stability and its transcriptional activity. Biochem. Biophys. Res. Commun. 324:394-400.[CrossRef][Medline]
4. Bailey, D., and P. O'Hare. 2004. Characterization of the localization and proteolytic activity of the SUMO-specific protease, SENP1. J. Biol. Chem. 279:692-703.
5. Barker, D. D., H. Wu, S. Hartung, M. Breindl, and R. Jaenisch. 1991. Retrovirus-induced insertional mutagenesis: mechanism of collagen mutation in Mov13 mice. Mol. Cell. Biol. 11:5154-5163.
6. Best, J. L., S. Ganiatsas, S. Agarwal, A. Changou, P. Salomoni, O. Shirihai, P. B. Meluh, P. P. Pandolfi, and L. I. Zon. 2002. SUMO-1 protease-1 regulates gene transcription through PML. Mol. Cell 10:843-855.[CrossRef][Medline]
7. Bohren, K. M., V. Nadkarni, J. H. Song, K. H. Gabbay, and D. Owerbach. 2004. A M55V polymorphism in a novel SUMO gene (SUMO-4) differentially activates heat shock transcription factors and is associated with susceptibility to type I diabetes mellitus. J. Biol. Chem. 279:27233-27238.
8. Desterro, J. M., M. S. Rodriguez, and R. T. Hay. 1998. SUMO-1 modification of IB inhibits NF-B activation. Mol. Cell 2:233-239.[CrossRef][Medline]
9. Georgiades, P., A. C. Ferguson-Smith, and G. J. Burton. 2002. Comparative developmental anatomy of the murine and human definitive placentae. Placenta 23:3-19.[CrossRef][Medline]
10. Gill, G. 2003. Post-translational modification by the small ubiquitin-related modifier SUMO has big effects on transcription factor activity. Curr. Opin. Genet. Dev. 13:108-113.[CrossRef][Medline]
11. Gnarra, J. R., J. M. Ward, F. D. Porter, J. R. Wagner, D. E. Devor, A. Grinberg, M. R. Emmert-Buck, H. Westphal, R. D. Klausner, and W. M. Linehan. 1997. Defective placental vasculogenesis causes embryonic lethality in VHL-deficient mice. Proc. Natl. Acad. Sci. USA 94:9102-9107.
12. Gong, B., and R. Ge. 2000. Using the SMART cDNA system to map the transcription initiation site. BioTechniques 28:846-848, 850-852.[Medline]
13. Gong, L., S. Millas, G. G. Maul, and E. T. Yeh. 2000. Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J. Biol. Chem. 275:3355-3359.
14. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu. Rev. Biochem. 67:425-479.[CrossRef][Medline]
15. Johnson, E. S. 2004. Protein modification by SUMO. Annu. Rev. Biochem. 73:355-382.[CrossRef][Medline]
16. Johnson, E. S. 2002. Ubiquitin branches out. Nat. Cell Biol. 4:E295-E298.[CrossRef][Medline]
17. Kadoya, T., H. Yamamoto, T. Suzuki, A. Yukita, A. Fukui, T. Michiue, T. Asahara, K. Tanaka, M. Asashima, and A. Kikuchi. 2002. Desumoylation activity of Axam, a novel Axin-binding protein, is involved in downregulation of beta-catenin. Mol. Cell. Biol. 22:3803-3819.
18. Kamat, A., and C. R. Mendelson. 2001. Identification of the regulatory regions of the human aromatase P450 (CYP19) gene involved in placenta-specific expression. J. Steroid Biochem. Mol. Biol. 79:173-180.[CrossRef][Medline]
19. Kim, K. I., S. H. Baek, Y. J. Jeon, S. Nishimori, T. Suzuki, S. Uchida, N. Shimbara, H. Saitoh, K. Tanaka, and C. H. Chung. 2000. A new SUMO-1-specific protease, SUSP1, that is highly expressed in reproductive organs. J. Biol. Chem. 275:14102-14106.
20. Kim, Y. H., C. Y. Choi, and Y. Kim. 1999. Covalent modification of the homeodomain-interacting protein kinase 2 (HIPK2) by the ubiquitin-like protein SUMO-1. Proc. Natl. Acad. Sci. USA 96:12350-12355.
21. Kinsella, T. M., and G. P. Nolan. 1996. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene Ther. 7:1405-1413.[Medline]
22. Kisseberth, W. C., N. T. Brettingen, J. K. Lohse, and E. P. Sandgren. 1999. Ubiquitous expression of marker transgenes in mice and rats. Dev. Biol. 214:128-138.[CrossRef][Medline]
23. Kozak, K. R., B. Abbott, and O. Hankinson. 1997. ARNT-deficient mice and placental differentiation. Dev. Biol. 191:297-305.[CrossRef][Medline]
24. Kumar, A., V. Novoselov, A. J. Celeste, N. M. Wolfman, P. ten Dijke, and M. R. Kuehn. 2001. Nodal signaling uses activin and transforming growth factor-beta receptor-regulated Smads. J. Biol. Chem. 276:656-661.
25. Kupriyanov, S., and H. Baribault. 1998. Genetic control of extraembryonic cell lineages studied with tetraploid
diploid chimeric concepti. Biochem. Cell Biol. 76:1017-1027.[CrossRef][Medline]
26. Li, S. J., and M. Hochstrasser. 1999. A new protease required for cell-cycle progression in yeast. Nature 398:246-251.[CrossRef][Medline]
27. Li, S. J., and M. Hochstrasser. 2003. The Ulp1 SUMO isopeptidase: distinct domains required for viability, nuclear envelope localization, and substrate specificity. J. Cell Biol. 160:1069-1081.
28. Li, S. J., and M. Hochstrasser. 2000. The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol. Cell. Biol. 20:2367-2377.
29. Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88:97-107.[CrossRef][Medline]
30. Matunis, M. J. 2002. On the road to repair: PCNA encounters SUMO and ubiquitin modifications. Mol. Cell 10:441-442.[CrossRef][Medline]
31. Matunis, M. J., E. Coutavas, and G. Blobel. 1996. A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J. Cell Biol. 135:1457-1470.
32. Melchior, F., M. Schergaut, and A. Pichler. 2003. SUMO: ligases, isopeptidases and nuclear pores. Trends Biochem. Sci. 28:612-618.[CrossRef][Medline]
33. Miller, A. D., and G. J. Rosman. 1989. Improved retroviral vectors for gene transfer and expression. BioTechniques 7:980-982, 984-986, 989-990.[Medline]
34. Moorman, A. F., A. C. Houweling, P. A. de Boer, and V. M. Christoffels. 2001. Sensitive nonradioactive detection of mRNA in tissue sections: novel application of the whole-mount in situ hybridization protocol. J. Histochem. Cytochem. 49:1-8.
35. Muller, S., M. J. Matunis, and A. Dejean. 1998. Conjugation with the ubiquitin-related modifier SUMO-1 regulates the partitioning of PML within the nucleus. EMBO J. 17:61-70.[CrossRef][Medline]
36. Nishida, T., F. Kaneko, M. Kitagawa, and H. Yasuda. 2001. Characterization of a novel mammalian SUMO-1/Smt3-specific isopeptidase, a homologue of rat Axam, which is an Axin-binding protein promoting ß-catenin degradation. J. Biol. Chem. 276:39060-39066.
37. Nishida, T., H. Tanaka, and H. Yasuda. 2000. A novel mammalian Smt3-specific isopeptidase 1 (SMT3IP1) localized in the nucleolus at interphase. Eur. J. Biochem. 267:6423-6427.[Medline]
38. Parrinello, S., E. Samper, A. Krtolica, J. Goldstein, S. Melov, and J. Campisi. 2003. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 5:741-747.[CrossRef][Medline]
39. Pichler, A., and F. Melchior. 2002. Ubiquitin-related modifier SUMO1 and nucleocytoplasmic transport. Traffic 3:381-387.[CrossRef][Medline]
40. Saitoh, H., and J. Hinchey. 2000. Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J. Biol. Chem. 275:6252-6258.
41. Schwartz, D. C., and M. Hochstrasser. 2003. A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem. Sci. 28:321-328.[CrossRef][Medline]
42. Schwienhorst, I., E. S. Johnson, and R. J. Dohmen. 2000. SUMO conjugation and deconjugation. Mol. Gen. Genet. 263:771-786.[CrossRef][Medline]
43. Seeler, J. S., and A. Dejean. 2003. Nuclear and unclear functions of SUMO. Nat. Rev. Mol. Cell Biol. 4:690-699.[CrossRef][Medline]
44. Shao, R., F. P. Zhang, F. Tian, P. Anders Friberg, X. Wang, H. Sjoland, and H. Billig. 2004. Increase of SUMO-1 expression in response to hypoxia: direct interaction with HIF-1 in adult mouse brain and heart in vivo. FEBS Lett. 569:293-300.[CrossRef][Medline]
45. Sternsdorf, T., K. Jensen, and H. Will. 1997. Evidence for covalent modification of the nuclear dot-associated proteins PML and Sp100 by PIC1/SUMO-1. J. Cell Biol. 139:1621-1634.
46. Tojo, M., K. Matsuzaki, T. Minami, Y. Honda, H. Yasuda, T. Chiba, H. Saya, Y. Fujii-Kuriyama, and M. Nakao. 2002. The aryl hydrocarbon receptor nuclear transporter is modulated by the SUMO-1 conjugation system. J. Biol. Chem. 277:46576-46585.
47. Verger, A., J. Perdomo, and M. Crossley. 2003. Modification with SUMO. A role in transcriptional regulation. EMBO Rep. 4:137-142.[CrossRef][Medline]
48. Weissman, A. M. 2001. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell Biol. 2:169-178.[CrossRef][Medline]
49. Yamada, S., H. Nakajima, and M. R. Kuehn. 2004. Novel testis- and embryo-specific isoforms of the phosphofructokinase-1 muscle type gene. Biochem. Biophys. Res. Commun. 316:580-587.[CrossRef][Medline]
50. Zambrowicz, B. P., A. Imamoto, S. Fiering, L. A. Herzenberg, W. G. Kerr, and P. Soriano. 1997. Disruption of overlapping transcripts in the ROSA ßgeo 26 gene trap strain leads to widespread expression of ß-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci. USA 94:3789-3794.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
<
