This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matthews, J.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matthews, J.
Right arrow Articles by Gustafsson, J.-A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, July 2005, p. 5317-5328, Vol. 25, No. 13
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.13.5317-5328.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Aryl Hydrocarbon Receptor-Mediated Transcription: Ligand-Dependent Recruitment of Estrogen Receptor {alpha} to 2,3,7,8-Tetrachlorodibenzo- p-Dioxin-Responsive Promoters

Jason Matthews,1*,{dagger} Björn Wihlén,1,{dagger} Jane Thomsen,1 and Jan-Åke Gustafsson1,2

Department of Biosciences at Novum, Karolinska Institutet, Novum S-14157,1 Department of Medical Nutrition, Karolinska Institutet, Novum S-14186, Huddinge Sweden2

Received 1 September 2004/ Returned for modification 30 November 2004/ Accepted 21 March 2005


arrow
ABSTRACT
 
Using chromatin immunoprecipitation assays, we studied the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-mediated recruitment of the aryl hydrocarbon receptor (AhR) and several coregulators to the CYP1A1 promoter. AhR displayed a time-dependent recruitment, reaching a peak at 75 min and maintaining promoter occupancy for the remainder of the time course. Recruitment of AhR was followed by TIF2/SRC2, which preceded CBP, histone H3 acetylation, and RNA polymerase II (RNAPII). Simultaneous recruitment to the enhancer and the TATA box region suggests the formation of a large multiprotein complex bridging the two promoter regions. Interestingly, estrogen receptor {alpha} (ER{alpha}) displayed a TCDD- and time-dependent recruitment to the CYP1A1 promoter, which was increased by cotreatment with estradiol. Transfection in HuH7 human liver cells confirmed previously reported ER{alpha} enhancement of AhR activity. In contrast, TCDD did not induce the recruitment of ER{alpha} to the estrogen-responsive pS2 promoter, and after 120 min of cotreatment with estradiol, ER{alpha} is still present on the CYP1A1 promoter but no longer at pS2. RNA interference studies with T47D cells support a role for ER{alpha} in TCDD-dependent CYP1A1 expression. Our data suggest that ER{alpha} acts as a coregulator of AhR-mediated transcriptional activation and that the recruitment of ER{alpha} by AhR represents a novel mechanism AhR-ER{alpha} cross talk.


arrow
INTRODUCTION
 
The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor and a member of the basic-helix-loop-helix Per (Period)-ARNT (aryl hydrocarbon nuclear translocator)-SIM (single-minded) (bHLH/PAS) family. Other members of this family include ARNT, hypoxia factor 1{alpha} (HIF1{alpha}), SIM, Clock, Per, and the p160 family of coactivators (13). The AhR mediates most of the toxic responses of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and polycyclic aromatic hydrocarbons (PAHs).

The nonactivated form of the receptor exists in the cytoplasm in a complex with chaperone proteins (5, 35). After binding ligand, the AhR translocates to the nucleus, where it binds its dimerization partner, ARNT. The activated AhR/ARNT heterodimer complex (AhRC) binds to its cognate DNA sequences, termed xenobiotic response elements (XREs) and activates expression of AhR target genes (57). The precise molecular details regarding the kinetics and the proteins involved in the AhRC-mediated transcriptional activation are not fully understood; the overall mechanism is thought to be similar to that of nuclear receptors (NRs) (15, 52). Several NR cofactors interact with AhR, including p300/CBP (21), the p160 family members (2), BRG1 (53), ERAP140 (30), TRAP220 (52), and RIP140 (24).

Cross talk between the estrogen receptor {alpha} (ER{alpha}) and AhR has been described in a number of different systems. Although TCDD does not bind to the ER{alpha}, TCDD inhibits ER{alpha} signaling, including the estradiol (E2)-dependent increase in uterine wet weight (38). Female rats chronically treated with TCDD are also less likely to develop mammary and uterine tumors (22). The molecular basis for this cross talk is unclear and may be a combination of several different mechanisms, such as rapid metabolism of estrogen, increased ER degradation (58), inhibitory XREs located in estrogen-responsive genes (7), squelching of common cofactors (4), and the induction of inhibitory factors (37).

The impact of ER{alpha} on AhR-mediated transcription is less clear; however, several lines of evidence suggest that the ER is an important mediator of AhR activity. The introduction of exogenous ER{alpha} into an ER-negative breast cancer cell line restores TCDD-dependent gene expression (46). The continued presence of E2 is required to maintain high levels of AhR expression and inducibility (43). The incidence of liver hyperplasia is significantly higher in female rats exposed to TCDD (22), and cotreatment of ovariectomized rats with E2 and TCDD resulted in a potentiation of CYP1A1 expression compared to rats given TCDD alone (40). Moreover, ovariectomized Sprague-Dawley female rats can be made sensitive to TCDD by administration of E2, whereas no effect was observed in male rats cotreated with E2 and TCDD (27, 59). Collectively, these data suggest that the cancer-promoting and transcriptional activities of TCDD and AhR may be closely linked to E2 and ER.

Estrogen action is mediated by binding to one of two specific ERs, ER{alpha} and ERß. The transactivation activities of ER{alpha} and ERß are mediated by two separate but not mutually exclusive transcription activation functions (AFs), an N-terminal ligand-independent activation function (AF-1) and a C-terminal ligand-dependent activation function (AF-2) (31). A comparison of the AF-1 domains of the two ERs has revealed that this domain is very active in ER{alpha}, but under identical conditions, the activity of AF-1 in ERß is minimal (1). The AF-2-mediated transcriptional activities of ERs are dependent on interactions with and recruitment of cofactor proteins. The respective contribution of each AF toward the activity of the ER{alpha} is both promoter and cell type specific (3). When coexpressed with ER{alpha}, ERß exhibits an inhibitory action on ER{alpha}-mediated gene expression (26, 33). Both ER subtypes regulate gene expression in two ways, via the classical pathway through direct DNA binding to estrogen response elements (EREs) or via the nonclassical pathway by protein-protein interactions with other transcription factors, such as activating protein 1 (AP-1) (33) and specificity protein 1 (Sp1) (41). Since ER{alpha} can directly interact with AhR and ARNT in a TCDD-dependent manner (4, 32) and several studies in vitro and in vivo have demonstrated that ER{alpha} expression is linked to AhR responsiveness, it is tempting to speculate that ER{alpha} may modulate AhR signaling via a nonclassical protein-protein interaction mechanism.

Using chromatin immunoprecipitation (ChIP) assays, we demonstrate the simultaneous recruitment of AhR and several associated proteins to the enhancer and TATA box regions of the CYP1A1 promoter, suggesting the formation of a multiprotein complex bridging these two promoter regions. To explore whether ER{alpha} is a coregulator of AhR-mediated transcription, we used ChIP to study the TCDD-mediated recruitment of AhR and ER{alpha} to CYP1A1 and CYP1B1 in the presence or absence of E2 in MCF-7 and T47D cells. Our results show that TCDD treatment resulted in the temporal recruitment of ER{alpha} to AhR target gene promoter regions. Cotreatment experiments with TCDD and E2 demonstrated a significant increase in the recruitment of ER{alpha} to AhR target gene promoters, whereas a time-dependent reduction in the recruitment of ER{alpha} to estrogen target gene promoters was observed. Transient-transfection experiments with HuH7 cells confirmed previously reported ER{alpha} enhancement of AhR transcriptional activation. Expression of ERß did not affect AhR activity, suggesting ER subtype selectivity. Collectively, these data suggest that ER{alpha} acts as a coregulator of AhR-mediated transcriptional activation, and the recruitment of ER{alpha} by AhRC represents a new mechanism of cross talk between the AhR and ER{alpha} pathways.


arrow
MATERIALS AND METHODS
 
Chemicals and plasmids. Antibodies used for ChIP include the following: for ER{alpha}, H-184 and HC-20; for AhR, H-211; for ARNT, H-172; for p300, N-15; for CBP, A-22 (all from Santa Cruz Biotechnology, Santa Cruz, CA); for RNAPII phosphorylated at serines 2 and 5, 8WG16 (Covance, Berkeley, CA); and for acetyl-histone H3, 06-599 (Upstate, Lake Placid, NY). Rabbit polyclonal antibodies against TRAP220 (49) and TIF2 (25) have been described previously. TCDD was provided by S. Safe (Texas A&M University, College Station, TX), and 17ß-estradiol was from Sigma (St. Louis, MO). The plasmids p1A1LUC, containing the –1612 to +292 region of the hCYP1A1 promoter (36); XRE-luc (45); pSG5-hER{alpha} (48); pSG5-hERß (51); pSG5-HEO; pSG5-HEO-S118A (55); and pSG5-hER{alpha}-{Delta}AF1 (pSG5-hER{alpha}-{Delta}182) (6) have been described previously.

Cell culture and transient transfection. MCF-7 human breast carcinoma cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen Corp.) supplemented with 5% fetal calf serum (FCS; Invitrogen Corp.). T47D breast carcinoma cells were cultured in a 1:1 mixture of DMEM and F12 media (Invitrogen Corp.) supplemented with 5% FCS (Invitrogen Corp.). HuH7 human liver carcinoma cells were also cultured in DMEM containing a high glucose concentration and supplemented with 10% FCS. All media were supplemented with 2 mM L-glutamine and 1% penicillin-streptomycin, and cells were maintained at 37°C in 5% CO2. For transient-transfection experiments, HuH7 cells were seeded in 24-well plates in phenol red-free DMEM supplemented with 5% dextran-coated charcoal (DCC)-treated FCS 24 h before transfections. Cells were transfected with Lipofectamine 2000 according to the manufacturer's recommendations (Invitrogen Corp.). All reaction mixtures included 10 ng of pCH110-ß-Gal (Pharmacia) to normalize for transfection efficiency. After transfection, cells were treated with ligands for 24 h before luciferase (Biothema, Dalarö, Sweden) and ß-galactosidase assays were performed (Tropix, Bedford, MA).

ChIP. MCF-7 and T47D cells were seeded in 150-mm dishes and grown for 3 days in phenol red-free medium supplemented with 5% DCC-treated FCS. Ligands dissolved in dimethyl sulfoxide (DMSO) were added for the indicated times, and protein-DNA complexes were cross-linked with 1% formaldehyde for 10 min. Cross-linking was quenched by adding 125 mM glycine, and cells were washed with phosphate-buffered saline, harvested, and resuspended in lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate) containing protease inhibitors (Roche, Mannheim, Germany) and sonicated 10 times for 10 s each time. The soluble chromatin was collected by centrifugation, and an aliquot of the chromatin was put aside and represented the input fraction. The supernatants were incubated with 30 µl of protein A/G Sepharose (50% slurry; Pharmacia) under gentle agitation for 2 h at 4°C. The supernatant was transferred to a new microcentrifuge tube, and 0.5 to 1 µg of antibody was added and incubated overnight at 4°C. Protein A/G-Sepharose (20 µl of a 50% slurry) was then added and incubated for 1.5 h. The pellets were successively washed for 10 min in 1 ml of buffer 1 (20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% sodium dodecyl sulfate [SDS]), 1 ml of buffer 2 (20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), 1 ml of LiCl buffer (20 mM Tris-HCl [pH 8.0], 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate), and 2 x 1 ml of TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA). Protein-DNA complexes were eluted in 120 µl of elution buffer (TE, 1% SDS) for 30 min, and the cross-links were reversed by overnight incubation at 65°C. DNA was purified using a PCR purification kit (QIAGEN) and eluted in 50 µl. ChIP DNA (5 µl) was amplified by PCR with primers 5'ACCCGCCACCCTTCGACAGTTC3' and 5'TGCCCAGGCGTTGCGTGAGAAG3' for the CYP1A1 enhancer region, 5'CTTGGAATTGGGACTTCCAGGTGT3' and 5'TTATAGGCGGGCTTGTACGTGTG3' for the CYP1A1 TATA box region, 5'CATGTCGGCCACGGAGTTTCTTC3' and 5'ACAGTGCCAGGTGCGGGTTCTTTC3' for the nonspecific primers in the CYP1A1 coding region, 5'GTGCGCACGGAGGTGGCGATA3' and 5'GCTCCTCCCGCGCTTCTCAC3' for CYP1B1, and 5'GGCCATCTCTCACTATGAATCACT3' and 5'GGATTTGCTGATAGACAGAGACGA3' for pS2. For real-time PCR, SYBR green qPCR supermix UDG (Invitrogen) was used to amplify a smaller fragment of the CYP1A1 promoter as described previously (15); 5'ATATGACTGGAGCCGACTTTCC3' and 5'GGCGAACTTTATCGGGTTGA3' for CYP1B1 and the same primer pairs as described above were also used for pS2.

RNA isolation, RNA interference (RNAi), and real-time PCR. MCF-7 and T47D cells were seeded in six-well plates and grown in phenol red-free DMEM supplemented with 5% DCC-treated FCS for 2 days prior to treatment with ligands. HuH7 cells were seeded in six-well plates 24 h before transfection with Lipofectamine 2000 (Invitrogen Corp.) and cotreated with 10 nM E2 and 10 nM TCDD for the indicated times. For the RNAi experiments, small interfering RNA (siRNA) oligonucleotides for ER{alpha} (5'TCAAGGACATAACGACTAT'3) and luciferase (5'ATAAGGCTATGAAGAGATA'3) were cloned into pSUPERIOR.puro according to the manufacturer's instructions (OligoEngine), creating pSPuro-iER{alpha} and pSPuro-iLuc, respectively. T47D cells were seeded in six-well plates and grown in phenol red-free DMEM supplemented with 5% DCC-treated FCS for 24 h before transfection with Lipofectamine 2000 (Invitrogen Corp.) and cotreated with ligands for 24 h. RNA was isolated using RNeasy spin columns (QIAGEN). One microgram of the extracted RNA was pretreated with DNase I for 15 min at room temperature and then reverse transcribed using random hexamer primers and SuperScriptII (Invitrogen). Real-time PCR was performed with 1 µl of the cDNA synthesis reaction using SYBR green (Invitrogen). For the CYP1A1 heteronuclear RNA (hnRNA), the primers were 5'TTGTGATCCCAGGCTCCAAGA3' and 5'GGAGGCACCAAAATGTTCCTTT3' (9), and for CYP1A1 mRNA, the primers were 5'TGGTCTCCCTTCTCTACACTCTTGT3' and 5'ATTTTCCCTATTACATTAAATCAATGGTTCT3'. All target gene transcripts were normalized to the 18S rRNA (PE Applied Biosystems) content and to the time zero sample.


arrow
RESULTS
 
Kinetic assembly of AhR and regulated promoters in the presence of TCDD. The regulation of the human CYP1A1 gene is mediated by AhR recruitment to multiple XREs in its promoter. We used ChIP to investigate the coregulator dynamics of AhR-mediated transcriptional activation to CYP1A1 in MCF-7 cells. Figure 1A shows the TCDD-induced recruitment of AhR and several associated factors to the enhancer and TATA box regions of CYP1A1. Occupancy of the promoter regions by AhR and ARNT was evident after 15 min, peaking at approximately 75 to 105 min and thereafter declining during the course of the treatment. Recruitment of AhR and ARNT was closely followed by NCoA2 (TIF2/SRC2), which preceded the accumulation of the histone acetyltransferase (HAT) CBP. The arrival of the HATs coincided with that of the TRAP/SMCC/mediator complex, which was followed by histone H3 acetylation and the phosphorylation of RNAPII. No apparent cycling was observed. Simultaneous recruitment of the AhRC to the XRE-rich enhancer region approximately 1,000 bp upstream from the start site and the TATA box region suggests the formation of a larger multiprotein complex that bridges the two promoter regions. To quantitate the results from the ChIP assays, and since conventional PCR followed by gel electrophoresis may not accurately depict small changes among the different samples, the ChIP samples were also analyzed by real-time PCR; their relative enrichment levels are shown in Fig. 1B. Overall, the real-time PCR results support the data from conventional PCR presented in Fig. 1A. A comparison of genomic DNA and sonicated input samples shows that following ChIP, the amplified promoter regions represent the enrichment of distinct regions and are not the result of precipitation and amplification of large chromatin fragments (Fig. 1C). Occupancy by AhR and ARNT of a region containing two additional XREs located between the enhancer and TATA box regions, at positions –499 and –396, was also observed; however, whether the recruitment of the AhRC represents the enrichment at a distinct region is beyond the resolution of our assay (data not shown). No recruitment of AhR or ARNT was observed to a region within the CYP1A1 coding sequence, demonstrating the specific recruitment of AhRC to the 5' regulatory region of CYP1A1 (Fig. 1D).



View larger version (38K):
[in this window]
[in a new window]
 
FIG.1. Temporal recruitment of AhR and associated factors to CYP1A1 regulatory regions. (A) MCF-7 human breast carcinoma cells were treated with 10 nM TCDD for the specified amounts of time (minutes). ChIP assays were performed as described in Materials and Methods with antibodies against the indicated proteins. PCRs of DNA from the input or immunoprecipitated fractions were performed using primer pairs that amplify the CYP1A1 promoter regions as indicated. (B) ChIP assay samples were analyzed by real-time PCR, and the results were normalized to time zero (no ligand). RNApol, RNA polymerase. (C) Genomic DNA and the sonicated input DNA were PCR amplified using the specified primer pairs. The sonicated input fraction was separated by 0.7% agarose gel electrophoresis and visualized by ethidium bromide staining. (D) ChIP assays with antibodies to the indicated proteins were analyzed by PCR using primer pairs covering the specified regions of CYP1A1. IgG, immunoglobulin G.

Cross talk between the AhR and ER{alpha} pathways has been well documented, and several reports have shown that ER{alpha} is important for AhR-mediated transcription; therefore, antibodies against ER{alpha} were also included into our ChIP analysis. Interestingly, we observed a TCDD-dependent recruitment of ER{alpha} to the CYP1A1 enhancer and TATA box regions (Fig. 1A and B). The temporal recruitment profile of ER{alpha} closely followed that of AhR and ARNT.

Ligand-dependent recruitment of ER{alpha} to CYP1A1 and CYP1B1 promoter regions. The influence of E2 on the TCDD-dependent recruitment of ER{alpha} to AhR-regulated target genes was investigated in MCF-7, T47D, and HuH7 cells treated with TCDD or E2 alone or in combination (TCDD+E2). The TCDD-induced ER{alpha} occupancy at the CYP1A1 enhancer was assessed using two different ER{alpha} antibodies (Fig. 2A). E2 alone had no effect, whereas together with TCDD, E2 increased the TCDD-induced ER{alpha} occupancy at CYP1A1. Real-time PCR analysis revealed that TCDD+E2 cotreatment resulted in a three- to fourfold increase in the recruitment of ER{alpha} to CYP1A1 compared with TCDD alone (Fig. 2B), whereas cotreatment had no effect on the recruitment profile of AhR. ER{alpha} was also recruited to the XRE-containing enhancer region of CYP1B1 (Fig. 2C and D), suggesting that ER{alpha} is recruited to multiple TCDD-responsive genes. The enhanced recruitment of ER{alpha} by TCDD+E2 cotreatment was greater to the CYP1B1 promoter than to CYP1A1, resulting in a sixfold increase after 60 min of treatment. The increased promoter occupancy of ER{alpha} at CYP1B1 may in part be due to the E2-dependent recruitment of ER{alpha} to an ERE located in the proximal promoter region of CYP1B1 (50). The effect of E2 on the TCDD-dependent recruitment of ER{alpha} to the CYP1A1 and CYP1B1 promoters was also investigated in T47D cells (Fig. 2E and F). Interestingly, AhR and ER{alpha} were recruited more rapidly to both CYP1A1 and CYP1B1 promoters compared to MCF-7 cells, reaching maximal promoter occupancy after 30 and 60 min. Although TCDD+E2 cotreatment had no effect on the recruitment pattern of AhR, a marked increase in the promoter occupancy by ER{alpha} at CYP1A1 and CYP1B1 was observed and was most evident at the CYP1B1 promoter (Fig. 2F). ChIP assays performed on ER{alpha}-negative HuH7 cells transiently transfected with ER{alpha} confirmed the TCDD-induced recruitment of ER{alpha} to CYP1A1, which was only observed in cells transfected with ER{alpha} (Fig. 2G and H). Similar to that observed in MCF-7 and T47D cells, E2 alone was not sufficient to increase the promoter occupancy of ER{alpha} at CYP1A1 but significantly (P < 0.05) enhanced the TCDD-dependent recruitment of ER{alpha} (Fig. 2H). These data demonstrate that TCDD induces the recruitment of ER{alpha} to AhR target genes and that the recruitment of ER{alpha} is enhanced by cotreatment with E2.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2. Ligand-dependent recruitment of ER{alpha} to AhR target genes. (A) MCF-7 cells were treated with 10 nM estradiol (E2), 10 nM TCDD, 10 nM TCDD plus 10 nM E2, or DMSO (0.1%) for the indicated amounts of time. ChIP assays were performed with primer pairs specific to the XRE enhancer regions of CYP1A1 using conventional PCR (A) and real-time PCR (B). ChIP analysis of the promoter occupancy of the CYP1B1 promoter by AhR and ER{alpha} was done using conventional PCR (C) and real-time PCR (D). T47D cells were treated with 10 nM TCDD or 10 nM TCDD plus 10 nM E2, followed by ChIP and real-time PCR amplification of the CYP1A1 (E) and CYP1B1 (F) enhancer regions. HuH7 human hepatoma cells were transfected with pSG5-ER{alpha} or a vector control and treated as described for panel A for the specified amounts of time. ChIP assays were performed with primer pairs specific to the XRE-containing enhancer region of CYP1A1 using conventional PCR (G) and real-time PCR (H). Results shown are representative of at least two independent experiments. ER{alpha} antibodies used were H-184 (ER{alpha}*) and HC-20 (ER{alpha}**). IgG, immunoglobulin G.

Effect of ER{alpha} on the transcriptional activity of AhR. In transiently transfected HuH7 cells cotransfected with a luciferase reporter under the regulation of the human CYP1A1 promoter/enhancer region (p1A1LUC) and with increasing amounts of ER{alpha} expression plasmid, increasing amounts of ER{alpha} resulted in a dose-dependent potentiation of the TCDD-induced reporter gene activity to 2.5-fold above vector controls (Fig. 3A). Cotreatment of 10 nM TCDD with either 1 nM or 10 nM E2 showed that the ER{alpha}-mediated potentiation of AhR-regulated transcription was also dependent on the concentration of E2 and resulted in an up to sevenfold increase in reporter gene activity. Transfection of greater amounts of ER{alpha} resulted in a reduction in the enhancement of reporter gene activity, suggesting that the level of ER{alpha} influences its ability to act as a coregulator of AhRC activity (data not shown). Similar results were observed with HuH7 cells transiently cotransfected with a minimal XRE luciferase reporter gene (p3xXRE-LUC) and increasing amounts of ER{alpha} (Fig. 3B).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. Effect of ER{alpha} on AhR-mediated transcription. HuH7 human hepatoma cells were transiently transfected as described in Materials and Methods. Following transfection, cells were treated with the indicated compounds for 24 h prior to assaying for luciferase and ß-galactosidase activities. Cells were transiently cotransfected with increasing amounts of pSG5-hER{alpha} and either p1A1LUC-containing the CYP1A1 promoter (A) or p3xXRE-LUC (B). Results are expressed as the means and standard deviations of four replicate determinations. Reporter gene activity significantly (P < 0.05) greater than the TCDD-treated vector control is indicated by an asterisk, reporter gene activity significantly (P < 0.05) greater than TCDD-treated samples transfected with the same amounts of ER{alpha} is indicated by a dagger, and reporter gene activity significantly (P < 0.01) greater than TCDD-1 nM E2-treated samples transfected with the same amounts of ER{alpha} is indicated by a double dagger. (C) Cells were cotransfected with p1A1-LUC and one of the following constructs: pSG5 (vector), pSG5-hER{alpha} (ER{alpha}), pSG5-hERß (ERß), pSG5-hER{alpha}-{Delta}AF1 (ER{alpha} {Delta}AF1), pSG5-HEO (ER{alpha} HEO), or pSG5-HEO S118A (HEO S118A). Reporter gene activity significantly (P < 0.05) different than the TCDD- or TCDD+E2-treated vector control is indicated by an asterisk, and reporter gene activity significantly (P < 0.05) greater than TCDD-treated samples transfected with the same ER plasmids is indicated by a number sign. (D) Cells were transiently cotransfected with p1A1LUC and either pSG5 or pSG5-hER{alpha} (ER{alpha}). Cells were treated for 24 h with a vehicle control or 10 nM TCDD or cotreated with 10 nM TCDD and 10 nM E2, 100 nM ICI 182,780, 100 nM 4-hydoxytamoxifen (TAM), or 100 nM raloxifene (RAL). Reporter gene activity significantly (P < 0.05) greater than the TCDD-treated vector control is indicated by an asterisk, and reporter gene activity significantly (P < 0.05) different than the TCDD-treated sample transfected with the ER{alpha} is indicated by a number sign. Results are representative of at least two independent experiments and are expressed as the means and standard deviations of four replicate determinations.

The ER{alpha} potentiation of AhR transcriptional activity is mediated through AF-1. ER{alpha} mediates transcription via protein-protein interactions with other transcription factors, such as AP-1 and Sp1 (33, 41). The N-terminal AF-1 domain has been shown to be an important mediator of these effects. Transfection of an ER{alpha} {Delta}AF-1 plasmid lacking amino acids residues 1 to 182 into HuH7 cells caused a significant reduction in reporter gene activity, and this mutant was unable to potentiate AhR-mediated transcription, even in the presence of E2, compared to wild-type ER{alpha} (Fig. 3C). ER{alpha} activity is strongly regulated by phosphorylation, in particular its AF-1 activity. Mutation of Ser 118 to Ala resulted in a substantial reduction, but not a complete inhibition, of the ability of ER{alpha} to enhance reporter gene activity, suggesting that phosphorylation of Ser 118 is important but not sufficient for ER{alpha} regulation of AhR transcriptional activity. Since some of the major functional differences between ER{alpha} and ERß have been mapped to their respective N-terminal or AF-1 regions, we examined whether ERß could also potentiate p1A1LUC reporter gene activity. Figure 3C shows that ERß exhibited properties similar to those of ER{alpha} {Delta}AF-1. Transfection of ERß caused a significant reduction in reporter gene activity and was unable to potentiate AhR-mediated reporter gene activity even in the presence of E2 compared to wild-type ER{alpha}, suggesting that the ER-mediated enhancement of AhR transcription exhibits ER subtype selectivity. Since the data presented in Fig. 3C demonstrated that the AF-1 region is important for mediating ER{alpha} activity at AhR-regulated promoters, we were interested in studying the effects of various selective ER modulators (SERMs) on AhR-mediated transcription (Fig. 3D). Cotreatment of HuH7 cells cotransfected with p1A1LUC and an ER{alpha} expression plasmid with TCDD and tamoxifen caused a fourfold increase over TCDD alone. Cotreatment with raloxifene resulted in a slight enhancement of reporter gene activity, whereas the ability of ER{alpha} to enhance TCDD-dependent reporter gene activity was inhibited by cotreatment with ICI 182,780. Since tamoxifen primarily inhibits AF-2 and not AF-1, while raloxifene inhibits AF-2 and also partially AF-1, and ICI 182,780 inhibits both AF-1 and AF-2 function, the data presented in Fig. 3D support the notion that the AF-1 region is important for ER{alpha} to enhance AhR signaling.

Estradiol and ER{alpha} enhance the transcription of CYP1A1 mRNA. Since transiently transfected reporter genes do not accurately represent the same complex regulation that occurs at endogenous promoters, the effect of E2 and ER{alpha} on TCDD-induced CYP1A1 transcription was assessed by real-time PCR in MCF-7, T47D, and HuH7 cells transiently transfected with ER{alpha} (Fig. 4A to E). The effect of E2 and ER{alpha} on the rate of CYP1A1 mRNA transcription, determined by reverse transcription-PCR of unprocessed hnRNA (9), and on CYP1A1 mRNA expression suggests that the recruitment of ER{alpha} to AhRC may play different roles in different cell types. In MCF-7 cells, cotreatment of TCDD+E2 did not significantly affect the transcription rate of CYP1A1 or the expression of CYP1A1 mRNA compared to TCDD treatment alone (Fig. 4A and B). In T47D cells cotreated with TCDD+E2, no significant increases (P < 0.05) in the transcription rate of CYP1A1 compared to TCDD were observed. A significant increase in CYP1A1 mRNA expression was also observed at 240 min (P < 0.05) but was not observed after 420 min (Fig. 4C and D). After 420 min of treatment, significant increases (P < 0.05) in both the transcription rate and expression of CYP1A1 mRNA were apparent in HuH7 cells transiently transfected with ER{alpha} compared with vector controls (Fig. 4E and F). In contrast to that observed in transient transfection of p1A1LUC (Fig. 3A), cotreatment of TCDD+E2 did not have a significantly different effect compared to that of TCDD alone (Fig. 4F). Collectively, these data support the notion that ER{alpha} acts as a modulator of AhRC activity in HuH7 cells.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 4. Real-time PCR results of the effect of ER{alpha} and estradiol on transcription at the CYP1A1 promoter. Total RNA isolated from MCF-7 cells (A, B), T47D cells (C, D), and HuH7 cells (E, F) transfected with or without ER{alpha}, treated with 10 nM TCDD or 10 nM TCDD-10 nM E2, DNase treated, and amplified with primers recognizing the hnRNA, unprocessed RNA, form of CYP1A1 or CYP1A1 mRNA. Results shown are the means and standard deviations of two independent experiments. For MCF-7 and T47D cells, RNA expression levels significantly (P < 0.05) greater than TCDD-treated time matched samples are indicated by an asterisk. For HuH7 samples RNA expression levels significantly (P < 0.05) different between the TCDD-treated time-matched vector control samples and those transfected with ER{alpha} are indicated by a asterisk, and RNA expression levels significantly (P < 0.05) different between the TCDD+E2-treated time-matched vector control samples those transfected with ER{alpha} are indicated by a number sign.

RIP140 is recruited to the pS2 but not to the CYP1A1 promoter. The coregulator composition and recruitment patterns of AhR-mediated transcription are similar to those reported for ER{alpha}, except that AhR recruits coregulators to chromatin with kinetic profiles different from those of NR coregulators (42, 52). Despite reports demonstrating that RIP140 modulates TCDD-mediated activity on an XRE-driven reporter gene (24), RIP140 was not detected on CYP1A1 enhancer or TATA box regions; however, the same antibody was able to detect recruitment of RIP140 to pS2 promoters after E2 treatment (Fig. 1A and 5A and B). In cells cotreated with E2+TCDD, recruitment of RIP140 was only observed to the pS2 and not to the CYP1A1 promoter (Fig. 5A and B). Since only one RIP140 antibody was used during these studies, one cannot exclude the possibility that the pertinent RIP140 epitope is masked in the potential AhR-RIP140 complex whereas it is available in the ER{alpha}-RIP140 complex. Nevertheless, these results suggest that the AhR and ER{alpha} signaling systems differ in their coregulator recruitment profiles during transcriptional activation.



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 5. Ligand-dependent recruitment of RIP140 to ER{alpha}- but not AhR-regulated target genes. MCF-7 cells were treated with 10 nM estradiol (E2), 10 nM TCDD, 10 nM TCDD-10 nM E2, or DMSO (0.1%) for the indicated amounts of time. ChIP assays were performed with primer pairs specific to the XRE enhancer regions of CYP1A1 or pS2. IgG, immunoglobulin G.

Role for ER{alpha} in AhR-mediated gene expression. To investigate the potential roles of ER{alpha} and E2 in AhR signaling, experiments using RNAi for ER{alpha} were performed on T47D cells treated with TCDD and TCDD+E2. The results illustrated in Fig. 6 show that in T47D cells transfected with the pSPURO-iER{alpha} plasmid containing an siRNA for ER{alpha} caused a decrease in AhR-dependent gene expression following treatment with TCDD and TCDD+E2 compared with siRNA for luciferase as a control. E2 cotreatment, however, did not further reduce the expressed of CYP1A1 mRNA. Similar results were seen in MCF-7 cells (data not shown). These data suggest and support a previously proposed role for ER{alpha} in AhR signaling (43, 46).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6. ER{alpha} plays a role in AhR-mediated activity. Effects of RNAi for ER{alpha} on AhR-dependent gene expression was assessed in T47D cells transfected with plasmids containing short hairpin RNA sequences for ER{alpha} or luciferase and treated with 10 nM TCDD or 10 nM TCDD-10 nM E2 for 24 h as described in Materials and Methods. RNA was isolated, and the CYP1A1 mRNA levels were determined using real-time PCR. The data are representative of two separate experiments. RNA expression levels significantly (P < 0.05) different between iER{alpha} (siRNA for ER{alpha}) and the iLuc (siRNA for luciferase) control are indicated by asterisks.

New mechanism of cross talk between ER{alpha} and AhR. The recruitment of ER{alpha} to AhR-regulated genes represents a new mechanism of cross talk between the two receptor paradigms. E2 treatment results in an increase in promoter occupancy of ER{alpha}, but not of AhR, at the pS2 promoter in T47D cells (Fig. 7A). Cotreatment with E2+TCDD also failed to induce the recruitment of AhR to the pS2 promoter and resulted in a reduction in the promoter occupancy of ER{alpha} after 120 min of treatment. The reduction in recruitment could reflect an increase in proteolysis of ER{alpha} (58). The same ChIP samples were then used to amplify the CYP1A1 promoter and study the time-dependent recruitment of ER{alpha} and AhR. As shown above, the recruitment of ER{alpha} parallels that of AhR and displays kinetics distinct from those of ER{alpha} recruitment at pS2. Indeed, ER{alpha} is recruited to pS2 after 5 min of treatment whereas the promoter occupancy of CYP1A1 by ER{alpha} was not evident until 15 to 30 min, suggesting that ER{alpha} has another role in the AhRC compared to its role in the activation of estrogen-responsive promoters. Of further interest is the finding that, after 120 min of cotreatment, ER{alpha} is still present on the CYP1A1 promoter but no longer at pS2. These findings were confirmed using real-time PCR of the precipitated DNA isolated from MCF-7 cells (Fig. 7B). The real-time PCR data demonstrate the distinct kinetics of ER{alpha} recruitment to the pS2 and CYP1A1 promoters. The maximum occupancy of ER{alpha} was at 30 min on pS2 (30-fold enrichment) but 60 min on CYP1A1 (14-fold enrichment). Cotreatment of TCDD+E2, however, did not alter the recruitment pattern for ER{alpha} at pS2. Nonetheless, as was observed in T47D cells, ER{alpha} is still present on the CYP1A1 promoter after 120 min of cotreatment but no longer at pS2. Collectively, these data show that TCDD induces ER{alpha} occupancy of AhR-responsive promoters, representing a new mechanism of cross talk between the ER and AhR receptor systems.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 7. Temporal recruitment of ER{alpha} to ER and AhR target genes. (A) T47D cells were treated with E2 (10 nM) or TCDD+E2 (10 nM each) for the indicated amounts of time. ChIP assays were performed, followed by PCR amplification of the isolated DNA using primer pairs specific for the enhancer region of CYP1A1 and the promoter of pS2. (B) MCF-7 cells were treated with E2 (10 nM) or TCDD+E2 (10 nM each) for the indicated amounts of time. ChIP assays were performed using anti-ER{alpha} antibodies, followed by real-time PCR of the isolated DNA using primer pairs specific for the CYP1A1 and pS2 promoters. The data are representative of an experiment that was repeated twice.


arrow
DISCUSSION
 
Several laboratories have shown that activation of the CYP1A1 promoter is via ligand-activated recruitment of AhRC to XRE elements located in what has been termed the enhancer region, centered ~1,000 bp upstream of the transcriptional start site. Transfection and protein-DNA interaction studies have further demonstrated that neither the enhancer nor the promoter alone is sufficient to mediate TCDD induction of CYP1A1 gene expression (8). Recent ChIP assays suggest that the AhRC complex is simultaneously recruited to both the enhancer and promoter regions of CYP1A1 (47, 56); however, other studies have not observed the recruitment of AhRC to the TATA box region of the mouse cyp1A1 promoter (52). Therefore, whether AhRC forms a multiprotein complex bridging the enhancer and TATA box regions of the CYP1A1 promoter is still unclear.

We used ChIP analysis of MCF-7 human breast cancer cells to study the temporal recruitment of AhR, ARNT, and several associated proteins to the XRE-containing enhancer and TATA box regions of the CYP1A1 promoter. Our data demonstrate the simultaneous recruitment of AhRC and its associated factors to both areas of the CYP1A1 promoter, supporting the notion of the existence of a loop structure that allows for the formation a large protein complex bridging the enhancer and promoter regions (47). No apparent kinetic differences were observed in the occupancy of the enhancer and TATA box regions by AhRC or any of the other associated factors under these conditions. However, in similar studies using {alpha}-amanitin pretreatment, which has been used as a means of synchronizing transcription (29), occupancy by AhR of the enhancer region precedes its recruitment to the TATA box (J. Matthews and J.-Å. Gustafsson, unpublished data).

Two AhR ligands, ß-naphthoflavone and 3,3'-diindolylmethane, have been shown to induce oscillatory cycling of AhR, as well as p160 coactivators and the HATs p300 and CBP on and off the promoter in a manner very similar to that reported for NRs (15, 42). However, neither AhRC nor any of the other proteins examined in our study were recruited in an oscillatory fashion with time-dependent cycles of protein binding and release. Our data agree with other ChIP studies of TCDD-treated Hepa cells, a mouse liver hepatoma cell line, that did not report any cyclical recruitment of AhR to the CYP1A1 promoter (47, 52). The presence or absence of oscillatory recruitment of transcription factors may reflect differences in cell culture methodologies in different laboratories (23, 42). It is equally possible that different AhR ligands induce distinct oscillatory recruitment patterns of AhRC and that prolonged treatment protocols are necessary to observe any oscillations in the transcription factor binding.

There are many reports showing that AhR agonists inhibit ER{alpha} signaling (39). The molecular basis for this cross talk is unclear and is most likely a combination of several different mechanisms (4, 7, 20, 58). The impact of ER{alpha} on AhR-mediated transcription is less clear and has been shown to exhibit cell-, species-, sex-, and age-related differences (39). However, the TCDD-dependent activation of AhR target genes in breast cancer cell lines and AhR expression and inducibility have been shown to correlate with ER{alpha} expression levels (43, 46). These data provide evidence of a role for ER{alpha} in AhR activity.

Using ChIP assays, we show in this study the TCDD-dependent recruitment of ER{alpha} to AhR target genes, enhanced by the presence of E2. Our results are supported by mammalian two-hybrid experiments demonstrating that AhR and ER{alpha} interact in a TCDD-dependent manner, where the interaction is enhanced by cotreatment with E2, whereas E2 alone has no effect (58), suggesting that recruitment of ER{alpha} to the AhRC is via direct protein-protein interactions. However, interactions between ER{alpha} and ARNT and a number of other transcriptional coregulators common to both ER{alpha} and AhR signaling pathways have also been reported (14). Therefore, the recruitment of ER{alpha} to the AhRC could also be indirect via interactions with shared coregulators.

There are confounding reports on the influence of E2 on TCDD-induced CYP1A1 activity (16, 19), and the effect of TCDD+E2 cotreatment on AhR activity is highly dependent on the dose used (17, 18). In this report, we show, using three different cell lines treated with 10 nM TCDD and cotreated with 10 nM TCDD plus 10 nM E2, a TCDD-dependent recruitment of ER{alpha} to the CYP1A1 promoter. The E2-mediated increase in promoter occupancy of ER{alpha} at CYP1A1 in HuH7 cells correlated with increases in transiently transfected CYP1A1-regulated reporter gene activity, though no E2 enhancement of endogenous CYP1A1 expression was observed. This discrepancy is most likely due to differences in chromatin structure and regulation between transiently transfected reporter plasmids and endogenous promoters. Endogenous CYP1A1 levels were, however, significantly increased in cells transiently transfected with ER{alpha}, and RNAi for ER{alpha} shows that endogenous ER{alpha} is important for maintaining AhR activity in T47D cells. These data suggest that ER{alpha} acts as a modulator of AhR activity and enhances AhR-mediated transcriptional activity, perhaps through a nonclassical ER{alpha} activation perhaps similar to that occurring at AP-1 (33) and Sp1 elements (41) and in a manner analogous to the glucocorticoid receptor coactivation of STAT5 signaling (44). In the absence of E2, the AF-1 domain of ER{alpha} is important for maintaining AhR activity, since loss of the AF-1 domain significantly lowered AhR-mediated transcription. An intact AF-1 domain is also necessary in mediating ER{alpha} enhancement of CYP1A1 expression by cotreatment with TCDD+E2. The AF-1 domain of ER{alpha} is necessary for physical interaction with the bHLH-PAS domain of AhR (32). A role for AF-1 function in mediating the enhancing effects of ER{alpha} on AhR activity at transiently transfected reporter genes is further supported by results from cotreatment with TCDD and various SERMs. Cotreatment with TCDD and tamoxifen or raloxifene, two SERMs that preferentially inhibit AF-2 activity, enhanced CYP1A1 promoter activity above the level induced by TCDD alone, whereas ICI 182,780, an inhibitor of both AF-1 and AF-2 functions, did not. It has been proposed that AF-1 is the major transactivation function for ER{alpha}, whereas AF-2 serves primarily as a docking site and structural switch-sensing ligand (28). The variability in AF-1 activity among different cell lines could contribute to the variability in the reported effects of ER{alpha} and E2 on the regulation of TCDD-induced CYP1A1 gene expression. The cofactor composition recruited by ER{alpha} may also exhibit cell type specificity, causing distinct changes in AhRC-mediated transcription depending on the cell line. Proteins that interact with the AF-1 region of ER{alpha} may be important targets since the AF-1 region of ER{alpha} is critical for mediating the enhancement of AhR activity in HuH7 cells. To date, however, relatively few proteins have been identified that interact with AF-1, such as TATA-binding protein and the RNA helicase p68/72, which bind to the AF-1 region of ER{alpha} (10, 54). Interestingly, the physical interaction between p68/72 and ER{alpha} requires the phosphorylation of Ser 118, and despite its ubiquitous expression, p68 enhances ER{alpha} activity in AF-1-sensitive HepG2 cells but not in strictly AF-2-permissive HeLa cells (12, 28).

AhR ligands such as 3-methylcholanthrene, a PAH, have been shown to recruit ER{alpha} to estrogen-responsive genes in the absence of estrogen, suggesting that ER signaling is modulated by coregulation-like functions of AhRC (32). This might give rise to adverse estrogen effects from exposure to dioxin-like environmental contaminants (32). However, it has been demonstrated that PAHs can easily be metabolized to potent estrogenic compounds that could readily elicit estrogenic responses (11). In addition, in this study TCDD treatment did not result in any increase in the promoter occupancy of ER{alpha} on pS2, and recruitment of ER{alpha} to pS2 was only observed in the presence of E2, suggesting that not all AhR ligands induce the recruitment of ER{alpha} to estrogen-responsive genes in the absence of estrogen. More recently, studies of 6-methyl-1,3,8-trichlorodibenzofuran indicate that the ability of this compound to induce ERE-mediated gene expression is independent of AhR, showing that the presence of a functional AhRC does not affect 6-methyl-1,3,8-trichlorodibenzofuran-ER-ERE complex formation (34). The authors reported similar results for 3-methylcholanthrene (34).

The widespread pollution of the environment by dioxins and compounds that mimic the activities of estrogen, known as environmental estrogens, poses a risk for human health. Despite many studies, the molecular mechanisms of AhR gene activation and repression, as well as cross talk between AhR and ER signaling pathways, are unclear. Here we demonstrate the TCDD-dependent recruitment of ER{alpha} to two AhR target genes, which is enhanced by the presence of E2 and represents a novel mechanism of cross talk between the two receptor systems (Fig. 8). In this model, unliganded ER{alpha} is recruited by the active AhRC to the target promoters. RNAi and transient-transfection data presented here and published by others (46) suggest that ER{alpha} integrity may be required for full AhR activity. The mechanism by which ER{alpha} modulates AhR transcription and whether ER{alpha} directly interacts with AhR/ARNT or another coregulator in the AhRC is unclear. Cotreatment with E2 increases the promoter occupancy of ER{alpha} at CYP1A1, which may be the result of the E2-induced homodimerization of ER{alpha}, thus doubling the amount of ER present in the AhRC. The homodimerization of ER{alpha} could result in a greater than twofold increase in the TCDD-induced promoter occupancy of ER{alpha}, by enhancing and/or exposing antibody-epitope interactions. The effect of cotreatment with E2 and increased promoter occupancy of ER{alpha} at AhR target promoters on AhR activity is uncertain, since only increases in transiently transfected reporter gene activity and not endogenous CYP1A1 expression were observed. However, it is possible that the increased promoter occupancy of ER{alpha} to CYP1A1 that is evident upon cotreatment with TCDD+E2 represents the mechanism by which AhR can regulate ER{alpha} activity. It is well established that cotreatment of TCDD+E2 inhibits ER{alpha} activity, and it has recently been shown that TCDD and TCDD+E2 increase the proteolytic degradation of ER{alpha} (58); thus, after ER{alpha} has been recruited to the AhRC, ER{alpha} may then be targeted for degradation, further reducing the pool of active receptor. Collectively, our data add new insight into the complex interplay between the ER{alpha} and AhR signaling pathways.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 8. New mechanism of cross talk between AhR and ER{alpha}. AhR agonists induce the recruitment of ER{alpha} to the active AhR, which is enhanced in the presence of E2. Once recruited, ER{alpha} can modulate AhR transcriptional activity. Ligand-activated or unliganded ER{alpha} can occupy AhR-responsive promoters, reducing the pool of receptors that regulate estrogen-responsive promoters. Recruitment of ER{alpha} to the active AhR complex may regulate ER{alpha} levels, serving as a mechanism for the proposed AhR-mediated degradation of ER{alpha}. E2, estradiol; Ub, ubiquination.


arrow
ACKNOWLEDGMENTS
 
We thank all members of the Receptor Biology Unit for assistance and helpful discussions during the course of this study.

This study was supported by a postdoctoral fellowship from the David and Astrid Hageléns Foundation (to J.M.) and by grants from the Swedish Cancer Fund and KaroBio AB.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biosciences at Novum, Karolinska Institutet, Huddinge 14157, Sweden. Phone: 46-8-6083339. Fax: 46-8-7745538. E-mail: jason.matthews{at}biosci.ki.se. Back

{dagger} J.M. and B.W. contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Barkhem, T., B. Carlsson, Y. Nilsson, E. Enmark, J.-Å. Gustafsson, and S. Nilsson. 1998. Differential response of estrogen receptor alpha and estrogen receptor beta to partial estrogen agonists/antagonists. Mol. Pharmacol. 54:105-112.[Abstract/Free Full Text]
  2. 2
  3. Beischlag, T. V., S. Wang, D. W. Rose, J. Torchia, S. Reisz-Porszasz, K. Muhammad, W. E. Nelson, M. R. Probst, M. G. Rosenfeld, and O. Hankinson. 2002. Recruitment of the NCoA/SRC-1/p160 family of transcriptional coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator complex. Mol. Cell. Biol. 22:4319-4333.[Abstract/Free Full Text]
  4. 3
  5. Berry, M., D. Metzger, and P. Chambon. 1990. Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J. 9:2811-2818.[Medline]
  6. 4
  7. Brunnberg, S., K. Pettersson, E. Rydin, J. Matthews, A. Hanberg, and I. Pongratz. 2003. The basic helix-loop-helix-PAS protein ARNT functions as a potent coactivator of estrogen receptor-dependent transcription. Proc. Natl. Acad. Sci. USA 100:6517-6522.[Abstract/Free Full Text]
  8. 5
  9. Carver, L. A., and C. A. Bradfield. 1997. Ligand-dependent interaction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J. Biol. Chem. 272:11452-11456.[Abstract/Free Full Text]
  10. 6
  11. Delaunay, F., K. Pettersson, M. Tujague, and J.-Å. Gustafsson. 2000. Functional differences between the amino-terminal domains of estrogen receptors alpha and beta. Mol. Pharmacol. 58:584-590.[Abstract/Free Full Text]
  12. 7
  13. Duan, R., W. Porter, I. Samudio, C. Vyhlidal, M. Kladde, and S. Safe. 1999. Transcriptional activation of c-fos protooncogene by 17ß-estradiol: mechanism of aryl hydrocarbon receptor-mediated inhibition. Mol. Endocrinol. 13:1511-1521.[Abstract/Free Full Text]
  14. 8
  15. Durrin, L. K., and J. P. Whitlock, Jr. 1989. 2,3,7,8-Tetrachlorodibenzo-p-dioxin-inducible aryl hydrocarbon receptor-mediated change in CYP1A1 chromatin structure occurs independently of transcription. Mol. Cell. Biol. 9:5733-5737.[Abstract/Free Full Text]
  16. 9
  17. Elferink, C. J., and J. J. Reiners, Jr. 1996. Quantitative RT-PCR on CYP1A1 heterogeneous nuclear RNA: a surrogate for the in vitro transcription run-on assay. BioTechniques 20:470-477.[Medline]
  18. 10
  19. Endoh, H., K. Maruyama, Y. Masuhiro, Y. Kobayashi, M. Goto, H. Tai, J. Yanagisawa, D. Metzger, S. Hashimoto, and S. Kato. 1999. Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol. Cell. Biol. 19:5363-5372.[Abstract/Free Full Text]
  20. 11
  21. Fertuck, K. C., J. B. Matthews, and T. R. Zacharewski. 2001. Hydroxylated benzo[a]pyrene metabolites are responsible for in vitro estrogen receptor-mediated gene expression induced by benzo[a]pyrene, but do not elicit uterotrophic effects in vivo. Toxicol. Sci. 59:231-240.[Abstract/Free Full Text]
  22. 12
  23. Flouriot, G., H. Brand, S. Denger, R. Metivier, M. Kos, G. Reid, V. Sonntag-Buck, and F. Gannon. 2000. Identification of a new isoform of the human estrogen receptor-alpha (hER-{alpha}) that is encoded by distinct transcripts and that is able to repress hER-{alpha} activation function 1. EMBO J. 19:4688-4700.[CrossRef][Medline]
  24. 13
  25. Hankinson, O. 1995. The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol. 35:307-340.[CrossRef][Medline]
  26. 14
  27. Hankinson, O. 2005. Role of coactivators in transcriptional activation by the aryl hydrocarbon receptor. Arch. Biochem. Biophys. 433:379-386.[CrossRef][Medline]
  28. 15
  29. Hestermann, E. V., and M. Brown. 2003. Agonist and chemopreventative ligands induce differential transcriptional cofactor recruitment by aryl hydrocarbon receptor. Mol. Cell. Biol. 23:7920-7925.[Abstract/Free Full Text]
  30. 16
  31. Hoivik, D., K. Willett, C. Wilson, and S. Safe. 1997. Estrogen does not inhibit 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated effects in MCF-7 and Hepa 1c1c7 cells. J. Biol. Chem. 272:30270-30274.[Abstract/Free Full Text]
  32. 17
  33. Jeong, H. G., and J. Y. Kim. 2002. Effects of o,p'-DDT on the 2,3,7,8-tetrachlorodibenzo-p-dioxin-inducible CYP1A1 expression in murine Hepa-1c1c7 cells. Food Chem. Toxicol. 40:1685-1692.[CrossRef][Medline]
  34. 18
  35. Jeong, H. G., and S. S. Lee. 1998. Suppressive effects of estradiol on 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated transcriptional activation of murine Cyp1a-1 in mouse hepatoma Hepa 1c1c7 cells. Cancer Lett. 133:177-184.[CrossRef][Medline]
  36. 19
  37. Kharat, I., and F. Saatcioglu. 1996. Antiestrogenic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin are mediated by direct transcriptional interference with the liganded estrogen receptor. Cross-talk between aryl hydrocarbon- and estrogen-mediated signaling. J. Biol. Chem. 271:10533-10537.[Abstract/Free Full Text]
  38. 20
  39. Klinge, C. M., J. L. Bowers, P. C. Kulakosky, K. K. Kamboj, and H. I. Swanson. 1999. The aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer interacts with naturally occurring estrogen response elements. Mol. Cell. Endocrinol. 157:105-119.[CrossRef][Medline]
  40. 21
  41. Kobayashi, A., K. Numayama-Tsuruta, K. Sogawa, and Y. Fujii-Kuriyama. 1997. CBP/p300 functions as a possible transcriptional coactivator of Ah receptor nuclear translocator (Arnt). J. Biochem. (Tokyo) 122:703-710.[Abstract/Free Full Text]
  42. 22
  43. Kociba, R. J., D. G. Keyes, J. E. Beyer, R. M. Carreon, C. E. Wade, D. A. Dittenber, R. P. Kalnins, L. E. Frauson, C. N. Park, S. D. Barnard, R. A. Hummel, and C. G. Humiston. 1978. Results of a two-year chronic toxicity and oncogenicity study of 2,3,7,8-tetrachlorodibenzo-p-dioxin in rats. Toxicol. Appl. Pharmacol. 46:279-303.[CrossRef][Medline]
  44. 23
  45. Krieg, A. J., S. A. Krieg, B. S. Ahn, and D. J. Shapiro. 2004. Interplay between estrogen response element sequence and ligands controls in vivo binding of estrogen receptor to regulated genes. J. Biol. Chem. 279:5025-5034.[Abstract/Free Full Text]
  46. 24
  47. Kumar, M. B., R. W. Tarpey, and G. H. Perdew. 1999. Differential recruitment of coactivator RIP140 by Ah and estrogen receptors. Absence of a role for LXXLL motifs. J. Biol. Chem. 274:22155-22164.[Abstract/Free Full Text]
  48. 25
  49. Leers, J., E. Treuter, and J.-Å. Gustafsson. 1998. Mechanistic principles in NR box-dependent interaction between nuclear hormone receptors and the coactivator TIF2. Mol. Cell. Biol. 18:6001-6013.[Abstract/Free Full Text]
  50. 26
  51. Lindberg, M. K., S. Moverare, S. Skrtic, H. Gao, K. Dahlman-Wright, J.-Å. Gustafsson, and C. Ohlsson. 2003. Estrogen receptor (ER)-ß reduces ER{alpha}-regulated gene transcription, supporting a "ying yang" relationship between ER{alpha} and ERß in mice. Mol. Endocrinol. 17:203-208.[Abstract/Free Full Text]
  52. 27
  53. Lucier, G. W., A. Tritscher, T. Goldsworthy, J. Foley, G. Clark, J. Goldstein, and R. Maronpot. 1991. Ovarian hormones enhance 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated increases in cell proliferation and preneoplastic foci in a two-stage model for rat hepatocarcinogenesis. Cancer Res. 51:1391-1397.[Abstract/Free Full Text]
  54. 28
  55. Merot, Y., R. Metivier, G. Penot, D. Manu, C. Saligaut, F. Gannon, F. Pakdel, O. Kah, and G. Flouriot. 2004. The relative contribution exerted by AF-1 and AF-2 transactivation functions in estrogen receptor alpha transcriptional activity depends upon the differentiation stage of the cell. J. Biol. Chem. 279:26184-26191.[Abstract/Free Full Text]
  56. 29
  57. Metivier, R., G. Penot, M. R. Hubner, G. Reid, H. Brand, M. Kos, and F. Gannon. 2003. Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751-763.[CrossRef][Medline]
  58. 30
  59. Nguyen, T. A., D. Hoivik, J. E. Lee, and S. Safe. 1999. Interactions of nuclear receptor coactivator/corepressor proteins with the aryl hydrocarbon receptor complex. Arch. Biochem. Biophys. 367:250-257.[CrossRef][Medline]
  60. 31
  61. Nilsson, S., and J.-Å. Gustafsson. 2000. Estrogen receptor transcription and transactivation: basic aspects of estrogen action. Breast Cancer Res. 2:360-366.[CrossRef][Medline]
  62. 32
  63. Ohtake, F., K. Takeyama, T. Matsumoto, H. Kitagawa, Y. Yamamoto, K. Nohara, C. Tohyama, A. Krust, J. Mimura, P. Chambon, J. Yanagisawa, Y. Fujii-Kuriyama, and S. Kato. 2003. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 423:545-550.[CrossRef][Medline]
  64. 33
  65. Paech, K., P. Webb, G. G. Kuiper, S. Nilsson, J.-Å. Gustafsson, P. J. Kushner, and T. S. Scanlan. 1997. Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508-1510.[Abstract/Free Full Text]
  66. 34
  67. Pearce, S. T., H. Liu, I. Radhakrishnan, M. Abdelrahim, S. Safe, and V. C. Jordan. 2004. Interaction of the aryl hydrocarbon receptor ligand 6-methyl-1,3,8-trichlorodibenzofuran with estrogen receptor alpha. Cancer Res. 64:2889-2897.[Abstract/Free Full Text]
  68. 35
  69. Perdew, G. H. 1988. Association of the Ah receptor with the 90-kDa heat shock protein. J. Biol. Chem. 263:13802-13805.[Abstract/Free Full Text]
  70. 36
  71. Postlind, H., T. P. Vu, R. H. Tukey, and L. C. Quattrochi. 1993. Response of human CYP1-luciferase plasmids to 2,3,7,8-tetrachlorodibenzo-p-dioxin and polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 118:255-262.[CrossRef][Medline]
  72. 37
  73. Rogers, J. M., and M. S. Denison. 2002. Analysis of the antiestrogenic activity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in human ovarian carcinoma BG-1 cells. Mol. Pharmacol. 61:1393-1403.[Abstract/Free Full Text]
  74. 38
  75. Romkes, M., and S. Safe. 1988. Comparative activities of 2,3,7,8-tetrachlorodibenzo-p-dioxin and progesterone as antiestrogens in the female rat uterus. Toxicol. Appl. Pharmacol. 92:368-380.[CrossRef][Medline]
  76. 39
  77. Safe, S., and M. Wormke. 2003. Inhibitory aryl hydrocarbon receptor-estrogen receptor alpha cross-talk and mechanisms of action. Chem. Res. Toxicol. 16:807-816.[Medline]
  78. 40
  79. Sarkar, S., N. R. Jana, J. Yonemoto, C. Tohyama, and H. Sone. 2000. Estrogen enhances induction of cytochrome P-4501A1 by 2,3,7, 8-tetrachlorodibenzo-p-dioxin in liver of female Long-Evans rats. Int. J. Oncol. 16:141-147.[Medline]
  80. 41
  81. Saville, B., M. Wormke, F. Wang, T. Nguyen, E. Enmark, G. Kuiper, J.-Å. Gustafsson, and S. Safe. 2000. Ligand-, cell-, and estrogen receptor subtype (alpha/beta)-dependent activation at GC-rich (Sp1) promoter elements. J. Biol. Chem. 275:5379-5387.[Abstract/Free Full Text]
  82. 42
  83. Shang, Y., X. Hu, J. DiRenzo, M. A. Lazar, and M. Brown. 2000. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843-852.[CrossRef][Medline]
  84. 43
  85. Spink, D. C., B. H. Katz, M. M. Hussain, B. T. Pentecost, Z. Cao, and B. C. Spink. 2003. Estrogen regulates Ah responsiveness in MCF-7 breast cancer cells. Carcinogenesis 24:1941-1950.[Abstract/Free Full Text]
  86. 44
  87. Stoecklin, E., M. Wissler, R. Moriggl, and B. Groner. 1997. Specific DNA binding of Stat5, but not of glucocorticoid receptor, is required for their functional cooperation in the regulation of gene transcription. Mol. Cell. Biol. 17:6708-6716.[Abstract]
  88. 45
  89. Thomsen, J. S., S. Kietz, A. Strom, and J.-Å. Gustafsson. 2004. HES-1, a novel target gene for the aryl hydrocarbon receptor. Mol. Pharmacol. 65:165-171.[Abstract/Free Full Text]
  90. 46
  91. Thomsen, J. S., X. Wang, R. N. Hines, and S. Safe. 1994. Restoration of aryl hydrocarbon (Ah) responsiveness in MDA-MB-231 human breast cancer cells by transient expression of the estrogen receptor. Carcinogenesis 15:933-937.[Abstract/Free Full Text]
  92. 47
  93. Tian, Y., S. Ke, M. Chen, and T. Sheng. 2003. Interactions between the aryl hydrocarbon receptor and P-TEFb. Sequential recruitment of transcription factors and differential phosphorylation of C-terminal domain of RNA polymerase II at cyp1a1 promoter. J. Biol. Chem. 278:44041-44048.[Abstract/Free Full Text]
  94. 48
  95. Tora, L., A. Mullick, D. Metzger, M. Ponglikitmongkol, I. Park, and P. Chambon. 1989. The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J. 8:1981-1986.[Medline]
  96. 49
  97. Treuter, E., L. Johansson, J. S. Thomsen, A. Warnmark, J. Leers, M. Pelto-Huikko, M. Sjoberg, A. P. Wright, G. Spyrou, and J.-Å. Gustafsson. 1999. Competition between thyroid hormone receptor-associated protein (TRAP) 220 and transcriptional intermediary factor (TIF) 2 for binding to nuclear receptors. Implications for the recruitment of TRAP and p160 coactivator complexes. J. Biol. Chem. 274:6667-6677.[Abstract/Free Full Text]
  98. 50
  99. Tsuchiya, Y., M. Nakajima, S. Kyo, T. Kanaya, M. Inoue, and T. Yokoi. 2004. Human CYP1B1 is regulated by estradiol via estrogen receptor. Cancer Res. 64:3119-3125.[Abstract/Free Full Text]
  100. 51
  101. Tujague, M., J. S. Thomsen, K. Mizuki, C. M. Sadek, and J.-Å. Gustafsson. 2004. The focal adhesion protein vinexin {alpha} regulates the phosphorylation and activity of estrogen receptor {alpha}. J. Biol. Chem. 279:9255-9263.[Abstract/Free Full Text]
  102. 52
  103. Wang, S., K. Ge, R. G. Roeder, and O. Hankinson. 2004. Role of mediator in transcriptional activation by the aryl hydrocarbon receptor. J. Biol. Chem. 279:13593-13600.[Abstract/Free Full Text]
  104. 53
  105. Wang, S., and O. Hankinson. 2002. Functional involvement of the Brahma/SWI2-related gene 1 protein in cytochrome P4501A1 transcription mediated by the aryl hydrocarbon receptor complex. J. Biol. Chem. 277:11821-11827.[Abstract/Free Full Text]
  106. 54
  107. Warnmark, A., A. Wikstrom, A. P. Wright, J.-Å. Gustafsson, and T. Hard. 2001. The N-terminal regions of estrogen receptor alpha and beta are unstructured in vitro and show different TBP binding properties. J. Biol. Chem. 276:45939-45944.[Abstract/Free Full Text]
  108. 55
  109. Webb, P., P. Nguyen, C. Valentine, G. N. Lopez, G. R. Kwok, E. McInerney, B. S. Katzenellenbogen, E. Enmark, J.-Å. Gustafsson, S. Nilsson, and P. J. Kushner. 1999. The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol. Endocrinol. 13:1672-1685.[Abstract/Free Full Text]
  110. 56
  111. Wei, Y. D., K. Tepperman, M. Y. Huang, M. A. Sartor, and A. Puga. 2004. Chromium inhibits transcription from polycyclic aromatic hydrocarbon-inducible promoters by blocking the release of histone deacetylase and preventing the binding of p300 to chromatin. J. Biol. Chem. 279:4110-4119.[Abstract/Free Full Text]
  112. 57
  113. Whitlock, J. P., Jr. 1999. Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol. 39:103-125.[CrossRef][Medline]
  114. 58
  115. Wormke, M., M. Stoner, B. Saville, K. Walker, M. Abdelrahim, R. Burghardt, and S. Safe. 2003. The aryl hydrocarbon receptor mediates degradation of estrogen receptor alpha through activation of proteasomes. Mol. Cell. Biol. 23:1843-1855.[Abstract/Free Full Text]
  116. 59
  117. Wyde, M. E., V. A. Wong, A. H. Kim, G. W. Lucier, and N. J. Walker. 2001. Induction of hepatic 8-oxo-deoxyguanosine adducts by 2,3,7,8-tetrachlorodibenzo-p-dioxin in Sprague-Dawley rats is female-specific and estrogen-dependent. Chem. Res. Toxicol. 14:849-855.[CrossRef][Medline]


Molecular and Cellular Biology, July 2005, p. 5317-5328, Vol. 25, No. 13
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.13.5317-5328.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Pandey, D. P., Picard, D. (2009). miR-22 Inhibits Estrogen Signaling by Directly Targeting the Estrogen Receptor {alpha} mRNA. Mol. Cell. Biol. 29: 3783-3790 [Abstract] [Full Text]  
  • Wihlen, B., Ahmed, S., Inzunza, J., Matthews, J. (2009). Estrogen Receptor Subtype- and Promoter-Specific Modulation of Aryl Hydrocarbon Receptor-Dependent Transcription. Mol Cancer Res 7: 977-986 [Abstract] [Full Text]  
  • Kekatpure, V. D., Dannenberg, A. J., Subbaramaiah, K. (2009). HDAC6 Modulates Hsp90 Chaperone Activity and Regulates Activation of Aryl Hydrocarbon Receptor Signaling. J. Biol. Chem. 284: 7436-7445 [Abstract] [Full Text]  
  • Taylor, R. T., Wang, F., Hsu, E. L., Hankinson, O. (2009). Roles of Coactivator Proteins in Dioxin Induction of CYP1A1 and CYP1B1 in Human Breast Cancer Cells. Toxicol Sci 107: 1-8 [Abstract] [Full Text]  
  • Celius, T., Roblin, S., Harper, P. A., Matthews, J., Boutros, P. C., Pohjanvirta, R., Okey, A. B. (2008). Aryl Hydrocarbon Receptor-Dependent Induction of Flavin-Containing Monooxygenase mRNAs in Mouse Liver. Drug Metab. Dispos. 36: 2499-2505 [Abstract] [Full Text]  
  • Hughes, D., Guttenplan, J. B., Marcus, C. B., Subbaramaiah, K., Dannenberg, A. J. (2008). Heat Shock Protein 90 Inhibitors Suppress Aryl Hydrocarbon Receptor-Mediated Activation of CYP1A1 and CYP1B1 Transcription and DNA Adduct Formation. Cancer Prevention Research 1: 485-493 [Abstract] [Full Text]  
  • Singh, M. N., Stringfellow, H. F., Taylor, S. E., Ashton, K. M., Ahmad, M., Abdo, K. R., El-Agnaf, O. M.A., Martin-Hirsch, P. L., Martin, F. L. (2008). Elevated expression of CYP1A1 and {gamma}-SYNUCLEIN in human ectopic (ovarian) endometriosis compared with eutopic endometrium. Mol Hum Reprod 14: 655-663 [Abstract] [Full Text]  
  • Singhal, R., Shankar, K., Badger, T. M., Ronis, M. J. (2008). Estrogenic status modulates aryl hydrocarbon receptor--mediated hepatic gene expression and carcinogenicity. Carcinogenesis 29: 227-236 [Abstract] [Full Text]  
  • Naves, L. A, Daly, A. F, Vanbellinghen, J.-F., Casulari, L. A, Spilioti, C., Magalhaes, A. V, Azevedo, M. F, Giacomini, L. A, Nascimento, P. P, Nunes, R. O, Rosa, J. W C, Jaffrain-Rea, M.-L., Bours, V., Beckers, A. (2007). Variable pathological and clinical features of a large Brazilian family harboring a mutation in the aryl hydrocarbon receptor-interacting protein gene. Eur J Endocrinol 157: 383-391 [Abstract] [Full Text]  
  • Suzuki, T., Nohara, K. (2007). Regulatory Factors Involved in Species-specific Modulation of Arylhydrocarbon Receptor (AhR)-dependent Gene Expression in Humans and Mice. J Biochem 142: 443-452 [Abstract] [Full Text]  
  • Jacobs, F. M. J., Smits, S. M., Noorlander, C. W., von Oerthel, L., van der Linden, A. J. A., Burbach, J. P. H., Smidt, M. P. (2007). Retinoic acid counteracts developmental defects in the substantia nigra caused by Pitx3 deficiency. Development 134: 2673-2684 [Abstract] [Full Text]  
  • Okey, A. B. (2007). An Aryl Hydrocarbon Receptor Odyssey to the Shores of Toxicology: The Deichmann Lecture, International Congress of Toxicology-XI. Toxicol Sci 98: 5-38 [Abstract] [Full Text]  
  • Sienkiewicz, P., Ciolino, H. P., Leslie, B. J., Hergenrother, P. J., Singletary, K., Yeh, G. C. (2007). A novel synthetic analogue of a constituent of Isodon excisus inhibits transcription of CYP1A1, -1A2 and -1B1 by preventing activation of the aryl hydrocarbon receptor. Carcinogenesis 28: 1052-1057 [Abstract] [Full Text]  
  • Eichenlaub-Ritter, U., Winterscheidt, U., Vogt, E., Shen, Y., Tinneberg, H.-R., Sorensen, R. (2007). 2-Methoxyestradiol Induces Spindle Aberrations, Chromosome Congression Failure, and Nondisjunction in Mouse Oocytes. Biol. Reprod. 76: 784-793 [Abstract] [Full Text]  
  • Puppala, D., Gairola, C.G., Swanson, H.I. (2007). Identification of kaempferol as an inhibitor of cigarette smoke-induced activation of the aryl hydrocarbon receptor and cell transformation. Carcinogenesis 28: 639-647 [Abstract] [Full Text]  
  • Khan, S., Barhoumi, R., Burghardt, R., Liu, S., Kim, K., Safe, S. (2006). Molecular Mechanism of Inhibitory Aryl Hydrocarbon Receptor--Estrogen Receptor/Sp1 Cross Talk in Breast Cancer Cells. Mol. Endocrinol. 20: 2199-2214 [Abstract] [Full Text]  
  • Okino, S. T., Pookot, D., Li, L.-C., Zhao, H., Urakami, S., Shiina, H., Igawa, M., Dahiya, R. (2006). Epigenetic Inactivation of the Dioxin-Responsive Cytochrome P4501A1 Gene in Human Prostate Cancer.. Cancer Res. 66: 7420-7428 [Abstract] [Full Text]  
  • Gao, H., Bryzgalova, G., Hedman, E., Khan, A., Efendic, S., Gustafsson, J.-A., Dahlman-Wright, K. (2006). Long-Term Administration of Estradiol Decreases Expression of Hepatic Lipogenic Genes and Improves Insulin Sensitivity in ob/ob Mice: A Possible Mechanism Is through Direct Regulation of Signal Transducer and Activator of Transcription 3. Mol. Endocrinol. 20: 1287-1299 [Abstract] [Full Text]  
  • Petersen, S. L., Krishnan, S., Hudgens, E. D. (2006). The Aryl Hydrocarbon Receptor Pathway and Sexual Differentiation of Neuroendocrine Functions. Endocrinology 147: s33-s42 [Abstract] [Full Text]  
  • Pastorelli, R., Carpi, D., Campagna, R., Airoldi, L., Pohjanvirta, R., Viluksela, M., Hakansson, H., Boutros, P. C., Moffat, I. D., Okey, A. B., Fanelli, R. (2006). Differential Expression Profiling of the Hepatic Proteome in a Rat Model of Dioxin Resistance: CORRELATION WITH GENOMIC AND TRANSCRIPTOMIC ANALYSES. Mol. Cell. Proteomics 5: 882-894 [Abstract] [Full Text]  
  • Boverhof, D. R., Kwekel, J. C., Humes, D. G., Burgoon, L. D., Zacharewski, T. R. (2006). Dioxin Induces an Estrogen-Like, Estrogen Receptor-Dependent Gene Expression Response in the Murine Uterus. Mol. Pharmacol. 69: 1599-1606 [Abstract] [Full Text]  
  • Abdelrahim, M., Ariazi, E., Kim, K., Khan, S., Barhoumi, R., Burghardt, R., Liu, S., Hill, D., Finnell, R., Wlodarczyk, B., Jordan, V. C., Safe, S. (2006). 3-Methylcholanthrene and Other Aryl Hydrocarbon Receptor Agonists Directly Activate Estrogen Receptor {alpha}. Cancer Res. 66: 2459-2467 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matthews, J.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matthews, J.
Right arrow Articles by Gustafsson, J.-A.