![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Regina Tzirkin,
Anya Bakhrat,
Nitzan Shabek,
Yelena Ivantsiv, and
Dina Raveh*
Department of Life Sciences, Ben Gurion University of the Negev, Beersheba 84105, Israel
Received 9 January 2005/ Returned for modification 10 February 2005/ Accepted 23 March 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ufo1 mutants that do not support its degradation. Ddi1 binds the proteasome via its N-terminal ubiquitinlike domain (UbL) and interacts with ubiquitylated Ho via its ubiquitin-associated domain (UbA); both domains of Ddi1 are required for association of ubiquitylated Ho with the proteasome. Despite being a nuclear protein, Ho is exported to the cytoplasm for degradation. In the absence of Ddi1, ubiquitylated Ho is stabilized and accumulates in the cytoplasm. These results establish a role for Ddi1 in the degradation of a natural ubiquitylated substrate. The specific interaction between Ho and Ddi1 identifies an additional function associated with DNA damage involved in its degradation. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Functions of the DNA damage response (DDR), MEC1, RAD9, and CHK1, are responsible for phosphorylation of Ho that targets it for degradation via the ubiquitin-26S proteasome system (30). The DDR is a cellular response that coordinates cell cycle progression with repair of lesions in DNA and with DNA replication (66). Ubiquitin conjugation involves an E1 ubiquitin activating enzyme, an E2 ubiquitin conjugating enzyme, and an E3 ubiquitin ligase (22). In most cases substrate ubiquitylation occurs in multiprotein complexes (11). Ho is ubiquitylated by the SCF (Skp1-Cdc53-F-box protein) ubiquitin ligase (E3) complex. The SCF consists of a Cdc53/Cullin scaffold complexed at one end with the Skp1 adaptor protein and at the other with the RING protein, Rbx1. A series of F-box proteins recruit degradation substrates to the SCF by forming a complex with the Skp1 adaptor (54, 55). F-box proteins recruit substrate molecules that are marked by phosphorylation, usually at multiple sites (29, 41). The novel F-box protein Ufo1 recruits Ho to the SCF for ubiquitylation (29, 30). Transcription of UFO1 is induced by the DDR in response to DNA damage, and this involves the Mec1 pathway (24). Deletion of UFO1 affects maintenance of genome stability; however the mechanism underlying this observation has not been elucidated (56).
Despite being a nuclear protein, Ho degradation occurs in the cytoplasm, and if Ho is trapped within the nucleus either by a point mutation that eliminates a critical phosphorylation site, or by deletion of its nuclear exportin, Msn5, the protein is stabilized. The MEC1 pathway leads to phosphorylation of residue HoT225, which facilitates its nuclear export, and of additional residues necessary for binding the F-box protein, Ufo1. Stabilization of Ho expressed from its native promoter, e.g., by deletion of its nuclear exportin, leads to genome instability (29).
The 26S proteasome consists of a 20S catalytic core complexed at one or both ends to a 19S regulatory particle (RP) that functions in substrate recognition, binding, deubiquitylation, unfolding, and in gating of the 20S (45). Substrates are marked for proteasomal degradation by covalent attachment of a chain comprising at least four ubiquitins linked via ubiquitinK48 (15). Initially the C-terminal glycine, G76, of ubiquitin is linked to a substrate lysine and a chain is formed by addition of successive ubiquitin molecules to the K48 residue of the preceding ubiquitin. Ubiquitin has seven lysine residues and besides K48-linked chains, K29- and K63-linked chains are formed in vivo. However, modification with these chains does not target a substrate for degradation (46).
There is growing evidence that additional functions subsequent to ubiquitylation determine whether a given substrate will indeed be degraded by the proteasome. These include the ubiquitin chain binding proteins. Originally it was proposed that the Rpn10 (mammalian S5a) subunit of the 19S RP binds polyubiquitylated substrates as its C-terminal ubiquitin interacting motif binds polyubiquitin chains (12, 52, 62). However, deletion of Rpn10 is not lethal (59). Cross-linking experiments indicate that Rpt5, an ATPase subunit of the base of the 19S, interacts with polyubiquitin chains (33). A further class of polyubiquitin-binding proteins is the UbL-UbA protein family exemplified by Rad23, Dsk2, and Ddi1 (7, 17, 65). The UbA domain (23) is a degenerate motif of 40 to 50 residues that folds into a compact three-helix bundle with a hydrophobic surface patch for protein-protein interactions (13, 40, 64). The UbA domain shows a high affinity for K48-linked polyubiquitin chains (48, 65). In a recent detailed study of the proximal UbA domain of human Rad23A (HHR23A) Raasi and colleagues have shown that the UbA domain binds ubiquitin chains with a 1:1 molar stoichiometry. Binding affinity increases with chain length and is optimal at 4 to 6 ubiquitin residues. Experiments employing chimeric K48-Ub4 tetramers mutated in a critical residue (UbL8A) show that all the L8 side chains in Ub4 contribute to the interaction with HHR23A-UbA (48).
UbL-UbA proteins have an N-terminal ubiquitinlike (UbL) domain of about 70 residues with primary sequence similarity to ubiquitin that adopts a ubiquitin fold (6, 23, 26, 31). The Dsk2 and Rad23 UbLs bind the 19S RP (14, 63). Degradation of certain artificial substrates is dependent on UbL-UbA proteins (17, 34, 50), and a number of natural substrates stabilized in the absence of Rad23 and Dsk2 and their Schizosaccharomyces pombe, frog, and human orthologs have been identified (see, e.g., references 3, 16, 32, 43, 50, and 62). These include misfolded endoplasmic reticulum (ER) substrates degraded via the ER-associated protein degradation pathway (39). These findings have led to the proposal that UbL-UbA proteins serve as adaptors that deliver ubiquitin-conjugated substrates to the proteasome (20, 65). However, in some instances the UbL-UbA proteins protect substrates from degradation in vivo (4, 36, 42) and in vitro (49). This has been suggested to be due to their preventing an interaction of the substrate ubiquitin chain with the proteasome perhaps by capping the chain and preventing access to both E3s and deubiquitylating enzymes (DUBs) (43, 49).
The least-studied UbL-UbA protein is Ddi1 (DNA damage inducible). Transcription of DDI1 is induced in response to DNA damage (25, 68); however, no role for Ddi1 in the DDR has been defined. ddi1 and rad23 mutants are partially defective in a subset of Pds1/securin-mediated functions involved in S-phase checkpoint signaling (8). In addition Ddi1 (alias Vsm1) may have a role in intracellular membrane transport as it binds v- and t-SNARES that mediate docking and fusion of intracellular vesicles (37, 38). Ddi1 binds the proteasome and polyubiquitylated conjugates (52); however, these interactions have not been mapped to specific domains of the protein. Deletion of DDI1 leads to accumulation of polyubiquitylated conjugates (52); however, Ddi1 has not been reported to be involved in the degradation of any physiological substrate. Recently an engineered version of Ddi1 was shown to mediate degradation of an artificial substrate (31). Here we show that Ddi1 is necessary for degradation of Ho endonuclease. Our results indicate a physiological role for Ddi1 as a proteasome receptor and identify ubiquitylated Ho endonuclease as its first natural substrate.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ddi1, rad23, and dsk2 strains and their isogenic wild type, BY4741, are from Euroscarf. The ufo1 wild type and ufo1 mutants are Research Genetics BY4730 and #142, respectively. The mec1 mutant (his3 leu2 ura3 sml1-1 mec1::TRP1) was obtained from B. Garvick; ufo1 rad6 mutants are in DF5 (58). NSY1 has DDI1 with a C-terminal TAP tag (47) in DF5 integrated using primers (F-CAGACTAACGGAAATGCAGAATTTGCTGCATCCCTCCTTTTCCAATCCATGGAAAAGAGAAG and R-GGGCTACATACGTAGAGGCCGATCACAATATCAGTGGTTGCTCATACGACTCACTATAGGG) to make a PCR product consisting of the tag and the TRP1 marker. Plasmid construction and expression. pTET-HO-LACZ and pTET-LACZ are HoLZ and LacZ expressed from the TET promoter of plasmid pCM190, respectively (30). Construction of pGFP-UFO1 and pGFP-HO is described in references 29 and 2, respectively. DDI1 was expressed from the ADH1 promoter in plasmid pAD6 (37). Subclones of Ddi1 with the UbL or UbA domain deleted were LexA fusions expressed from the GAL promoter (4). pYES3 (Invitrogen) was used for expressing high levels of FLAG-tagged RPN1 (FRPN1), FRAD23, FDSK2, and FDDI1 from the GAL promoter (52). Wild-type and (K48R,G76A) mutant ubiquitins (15) were expressed from the CUP1 promoter. Transformation of yeast cells was performed by lithium acetate (1).
Metabolic labeling, immunoprecipitation (IP), and pulse-chase are based on reference 18 and described in reference 30. Coimmunoprecipitation (co-IP)-immunoblotting was based on the method described in reference 37. These experiments were done either by (i) coexpression of both the potential interacting partners in yeast or (ii) mixing two cell lysates, each with one of the potential interacting partners. In both cases the lysates were incubated with the appropriate antibody directed against one of the interacting partners; after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) the presence of the second protein was detected by Western analysis.
Yeast cells were grown overnight to late logarithmic phase (optical density at 600 nm = 0.8) in 50 ml of the appropriate inductive synthetic minimal medium with 2% galactose for expression of the GAL-regulated genes; for induction of the TET-regulated constructs, HO-LACZ and LACZ, cells were incubated for 40 min in medium without doxycycline. The chase was performed by addition of 10 mM cycloheximide and methionine in radioactive experiments or 3% glucose for galactose-induced genes. For experiments in which Ho protein was made in cells expressing native or mutant (K48R,G76A) ubiquitin, we cotransformed W303 cells with pTET-HO-LACZ and with the vector or native- or mutant-ubiquitin-expressing plasmids. The cotransformed yeast cells were grown overnight without doxycycline to induce HO-LACZ, and with 0.2 mM CuSO4 to induce ubiquitin. In these experiments the specific activity of HoLZ in each cotransformant was determined by the o-nitrophenyl-ß-D-galactopyranoside (ONPG) reaction and equal aliquots of ONPG units were taken for each co-IP.
The cells were harvested by centrifugation, washed in 50 ml of Tris-EDTA, and resuspended in 400 µl co-IP buffer (0.1% NP-40, 250 mM NaCl, 5 mM EDTA, 50 mM Tris-Cl [pH 7.5], 1:25 of Boehringer protease inhibitor cocktail). Glass beads (0.5 to 0.6 g) were added, and cells were broken with a glass beater (Biospec Products) using five 1-min cycles at 4°C. The lysate was clarified by centrifugation at 13,000 rpm for 15 min at 4°C, and protein concentration was measured with the Bio-Rad protein reagent. Protein lysate (5 to 15 mg) was used for IP with the appropriate antibodies in co-IP buffer at 4°C for 1 to 2 h with mild shaking. Thirty microliters of 50% protein A-Sepharose (Amersham) was added to each sample, and incubation was continued under the same conditions for 0.5 to 1 h. The samples were washed 6 times with co-IP buffer with 1% of Triton and centrifuged. The pellet was resuspended in 30 µl 2x Laemmli sample buffer, boiled for 10 min, and electrophoresed on a 10% polyacrylamide SDS gel (PAGE) with protein size standards. The gel was transferred to nitrocellulose membrane (Protran BA 85; Schleicher & Schuell), and Western blotting was performed with the appropriate antisera. One milligram of crude protein was used to determine input by IP-Western blot, and 30 µg was taken for direct Western blotting. For Ddi1-TAP pulldowns, immunoglobulin G (IgG) was covalently coupled to M-280 tosyl-activated Dynabeads (DYNAL) according to the manufacturer's instructions. The beads were incubated with crude yeast lysate for 2 h at 4°C. The bead pellet was washed three times with co-IP buffer as above with increasing NaCl concentrations up to 250 mM. A Dynal magnetic particle concentrator (Dynal Biotech) was used to separate the beads from the lysate supernatant.
Anti-green fluorescent protein (anti-GFP) antibody purchased from Roche Molecular Biochemicals was used at dilutions of 1:200 for IP and 1:1,000 for Western blotting; anti-LacZ from Santa Cruz Biotechnology was used at 1:600 for IP and 1:1,000 for Western blotting; anti-Flag was purchased from Sigma and used at 1:250 for IP and 1:3,000 for Western blotting; anti-Ddi1 antiserum was a gift from Jeff Gerst and was used at 1:1,000 for IP and 1:5,000 for Western blotting; anti-Rpn12 antiserum was a gift from Dorota Skowyra and used at 1:10,000 for Western blotting; antiubiquitin antiserum from Affiniti Research Products was used at 1:5,000. Goat anti-rabbit antiserum, used at 1:1,000, and goat anti-mouse antiserum, used at 1:1,000, were purchased from Santa Cruz Biotechnology. Detection was by enhanced chemiluminescence (ECL) using an Amersham Pharmacia Biotech ECL Western blotting kit.
Microscopy. Cells expressing GFP-tagged proteins were observed with a Nikon fluorescence microscope as described previously (2).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
ddi1 cells or from ddi1cells that produced LexA fusions of Ddi1UbL or Ddi1UbA (4). Full-length and truncated Ddi1 proteins were immunoprecipitated with anti-Ddi1 antiserum and protein A, and the pellet was separated by PAGE and blotted. The Western blot was analyzed for the presence of HoLZ with anti-LacZ antiserum. We observed HoLZ in co-IPs with Ddi1 and Ddi1UbL, but not with Ddi1UbA indicating that Ho interacts with the UbA domain of Ddi1. The complex is between the Ho moiety and Ddi1 as the control LacZ protein did not interact with Ddi1 (Fig. 2A).
|
UbA coimmunoprecipitate with FRpn1; however, FRpn1 did not coimmunoprecipitate with Ddi1UbL (Fig. 2B). To exclude the possibility that Ddi1 could be interacting with Rpn1 that is not part of a 19S RP, we performed a pull-down experiment in which a lysate from cells producing TAP-tagged Ddi1 was incubated with magnetic beads coated with IgG. After stringent washing the proteins were separated by PAGE and blotted with anti-Rpn12 antiserum. A band corresponding to the size of Rpn12 was detected in the bead fraction of cells that produced Ddi1-TAP and was absent from the IgG beads incubated with a control DF5 lysate (Fig. 2C). Taken together these results indicate that Ddi1 binds the 19S RP via its UbL domain and interacts with ubiquitylated Ho via its UbA as reported for Rad23 and Dsk2 (14, 52).
We next tested whether Ddi1 is essential for formation of a complex between HoLZ and the 19S RP. HoLZ was produced in isogenic wild type and ddi1 mutants and immunoprecipitated with anti-LacZ antiserum, and the washed protein A-HoLZ beads were then incubated with equal aliquots of FRpn1 lysates for 4 h and washed thoroughly in co-IP buffer for separation by PAGE and Western blotting. Anti-FLAG was used to detect FRpn1 on the Western blots. We found that only HoLZ produced in wild-type cells in the presence of Ddi1 coimmunoprecipitated with FRpn1; when produced in ddi1 mutants it did not coimmunoprecipitate with FRpn1 (Fig. 3A). Similar experiments were next performed in which HoLZ was made in ddi1 mutants cotransformed with the LexA-DdiUbL and LexA-DdiUbA plasmids. In the absence of either the UbL or the UbA domain of Ddi1 no complex was formed that included HoLZ and FRpn1 (Fig. 3B).
|
|
ufo1, and in combination with the Rad6 E2 that has a role in Ho degradation (30), rad6 ufo1 double mutants. Ddi1 was immunoprecipitated with anti-Ddi1 antibodies, the pellet was separated by PAGE, and detection of HoLZ on the Western blot was with anti-LacZ. To ensure that Ho was produced in all cell types, we performed control anti-LacZ IPs that were blotted with anti-LacZ antibodies. The results of these experiments show that only HoLZ produced in wild-type cells interacted with Ddi1; HoLZ made in mutants in which it could not be ubiquitylated did not coimmunoprecipitate with Ddi1 (Fig. 5A and B).
|
ddi1 cells by pulse-chase with radioactive methionine and anti-LacZ IP. In wild-type cells Ho was rapidly degraded, whereas in ddi1 cells there was no observable degradation during the 30 min of the experiment (Fig. 6).
|
ddi1 mutants.
Ho must exit the nucleus to be degraded and in mutants that affect early stages of the pathway, e.g., in mec1 mutants, or in mutants of the nuclear exportin Msn5, stabilized Ho accumulates within the nucleus (29). The present results suggest that it is ubiquitylated Ho that interacts with Ddi1. This leads to the prediction that Ho stabilized due to the absence of Ddi1 should accumulate in the cytoplasm. We therefore followed the degradation of GFPHo in isogenic wild-type and ddi1 cells by inducing pGFP-HO and following the GFP signal by microscopy. Cycloheximide was added at the zero time point to inhibit protein synthesis. In wild-type cells a strong nuclear GFPHo signal was seen at the zero time point and the GFP signal became less strong at 15 min and disappeared altogether by 30 min. In contrast, in ddi1 cells the GFPHo signal disappeared from the nuclei of some cells by 15 min and was visible within the cytoplasm at both the 30- and 60-min time points (Fig. 7A). Stabilization of GFPHo in ddi1 cells was confirmed in a parallel pulse-chase IP experiment. In contrast to ddi1 cells there was no stabilization of HoLZ in rad23 or dsk2 mutants (Fig. 7B).
|
ddi1 mutants could be the result of its being deubiquitylated in the absence of Ddi1. In this event it would no longer be recognized as a substrate for the proteasome. We therefore attempted to assay the ubiquitylation status of Ho directly. Using anti-GFP antiserum we immunoprecipitated GFPHo from wild type and ddi1 mutants, and GFP from wild-type cells. The three immunoprecipitates were run in duplicate on the same gel followed by Western blotting with either anti-GFP or antiubiquitin antibodies. The lanes blotted with anti-GFP show the position of GFPHo and a small number of faster migrating bands that may be degradation intermediates of GFPHo; they do not appear in the GFP IP. The duplicate lanes blotted with antiubiquitin antibodies show high-molecular-weight (MW) bands in GFPHo IPs from both wild type and ddi1 mutants; these antibodies do not detect any bands in the GFP IP. We interpret the high-MW bands to be ubiquitin conjugates of GFPHo that are detectable with the antiubiquitin antiserum, but given the ratio of GFP/ubiquitin moiety of each ubiquitin-conjugated GFPHo molecule would be below the level of detection by the anti-GFP antibodies (Fig. 7C). Thus Ho does not loose its ubiquitin tag in the absence of Ddi1. |
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the case of Ho we observe a strong requirement for Ddi1 and not for either Rad23 or Dsk2. This is shown in co-IP experiments where Ho is found in a complex only with Ddi1 and not with either Rad23 or Dsk2. Furthermore it is supported by evidence showing stabilization of Ho in vivo in ddi1 mutants despite the presence in these cells of functional Rad23 and Dsk2 and additional polyubiquitin chain binding proteins (21). Given that all three UbL-UbA family proteins have a UbA domain and that this domain binds tetraubiquitin chains with high affinity, it is clear that the ubiquitin chain can be responsible for only part of the binding affinity and that residues of the substrate itself must be the predominant determinant of complex formation.
This raises the question of whether a substrate protein can interact with a UbL-UbA protein prior to its ubiquitylation. In this context it is interesting to note the presence of an integral UbL-UbA subunit in the recently discovered SCF complex responsible for degradation of p27 in G1 cells in the cytoplasm (27). Here we used two experimental approaches to address this question: (i) mutant ubiquitin that leads to premature chain termination and (ii) production of Ho in mutants that do not support its degradation. In mec1 mutants Ho is not phosphorylated and does not bind the F-box protein Ufo1 and is therefore not recruited for ubiquitylation by the SCF. In fact lack of phosphorylation leads to trapping of Ho in the nucleus and to its total stabilization (29). In addition we produced Ho in mutants that act downstream of Mec1—an E3 mutant ufo1 and a ufo1 mutant in which we also deleted the E2, Rad6. (We used the double ufo1 rad6 mutant as previously we found that Ho is stable in rad6 mutants [30] and we do not know whether the Rad6 pathway acts upstream or in parallel with the SCF pathway of ubiquitylation). In all instances in which we produced Ho in cells that cannot support its degradation we did not observe any interaction with Ddi1. Thus the initial interaction must be between an ubiquitin chain and a UbL-UbA protein. This is probably a dynamic interaction that would be stabilized by complex formation between additional residues of both the substrate and the specific UbL-UbA protein.
We observe stabilized Ho that accumulates in the cytoplasm of ddi1 cells. One explanation for this stabilization could be deubiquitylation of Ho by cellular DUBs. Ho without its ubiquitin chains would be rescued from degradation. Rad23Rhp23 and Dsk2Dph1 of fission yeast bind tetraubiquitin-conjugated substrates, and this protects the chains from the activity of DUBs. Protection is conferred by isolated UbA domains of these proteins (20). Furthermore Rad23 inhibits proteasomal degradation of the nucleotide excision repair protein Rad4/XPC in both yeast and mammals (36, 42). In vitro Rad23 inhibits both K48-polyubiquitin chain extension and chain disassembly (49). However, in our experiments we found that Ho retains its ubiquitin chains in ddi1 mutants. This result indicates that ubiquitylated Ho is protected from the activity of cellular DUBs in the absence of Ddi1. We suggest a number of alternative hypotheses to explain this finding. (i) The DUBs are strictly compartmentalized. At least two DUBs are associated with the proteasome, the Rpn11 subunit of the 19S RP (60) and Ubp6 (19, 35). A facet of UbL-UbA protein activity may be to orient the substrate polyubiquitin chains so that they can be processed by the proteasomal DUBs. (ii) UbL-UbA protein activity may be necessary to extract the ubiquitylated substrate from the E3 complex and/or to terminate ubiquitin chain elongation. This could possibly involve the chaperone activity of the ATPase subunits of the 19S RP (5). Subunits of both the SCF and the UbL-UbA proteins, Rad23 and Dsk2, have been identified as components of complexes that copurify with affinity-purified 26S proteasomes (61). Therefore it is possible that the role of Ddi1 is to release Ho from the SCFUfo1 and to make it available to the subunits of the 19S RP for deubiquitylation and unfolding. In the absence of Ddi1 ubiquitylated Ho may be retained within the SCFUfo1 complex. We do indeed find Ho in a co-IP complex with Ufo1 in ddi1 cells (not shown). This result indicates that recruitment of Ho to SCFUfo1 and its ubiquitylation do not require Ddi1. Experiments in which Ho ubiquitylation and degradation are reconstituted in vitro are necessary to determine the exact function performed by Ddi1.
In addition to the DDR functions Mec1, Rad9, and Chk1, which target Ho for degradation, we have now identified a further two functions associated with DNA damage that have a role in Ho degradation. These are the F-box protein Ufo1 described previously (29, 30) and the UbL-UbA protein, Ddi1. Both UFO1 and DDI1 are transcribed in response to DNA damage (25), and this is regulated by Mec1 although different effector kinases are involved (L. Kaplun, unpublished data; 67). Mating type switching is a very slow process, and the Ho-cleaved MAT allele is very stable (9, 51). However, the DDR checkpoint response is only evoked if DSB repair does not occur within 4 h (44). Ho degradation is very rapid, and the half-life of Ho does not exceed 10 min (30). We therefore conclude that it is the normal basal levels of the DDR functions, Ufo1 and Ddi1, that function in degradation of Ho.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by the Israel Cancer Association, the Israel Cancer Research Fund, the Association for International Cancer Research, and the German-Israel Research Fund (GIF). L. Kaplun is a postdoctoral fellow supported by GIF, A. Bakhrat is a Kreitman Fellow of the Ben Gurion University Graduate School.
|
FOOTNOTES |
|---|
Both authors contributed equally.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bakhrat, A., M. S. Jurica, B. L. Stoddard, and D. Raveh. 2004. Homology modeling and mutational analysis of Ho endonuclease of yeast. Genetics 166:721-728.
3. Bedford, F. K., J. T. Kittler, E. Muller, P. Thomas, J. M. Uren, D. Merlo, W. Wisden, A. Triller, T. G. Smart, and S. J. Moss. 2001. GABA(A) receptor cell surface number and subunit stability are regulated by the ubiquitin-like protein Plic-1. Nat. Neurosci. 4:908-916.[CrossRef][Medline]
4. Bertolaet, B. L., D. J. Clarke, M. Wolff, M. H. Watson, M. Henze, G. Divita, and S. I. Reed. 2001. UBA domains of DNA damage-inducible proteins interact with ubiquitin. Nat. Struct. Biol. 8:417-422.[CrossRef][Medline]
5. Braun, B. C., M. Glickman, R. Kraft, B. Dahlmann, P. M. Kloetzel, D. Finley, and M. Schmidt. 1999. The base of the proteasome regulatory particle exhibits chaperone-like activity. Nat. Cell. Biol. 1:221-226.[CrossRef][Medline]
6. Buchberger, A. 2002. From UBA to UBX: new words in the ubiquitin vocabulary. Trends Cell Biol. 12:216-221.[CrossRef][Medline]
7. Chen, L., and K. Madura. 2002. Rad23 promotes the targeting of proteolytic substrates to the proteasome. Mol. Cell. Biol. 22:4902-4913.
8. Clarke, D. J., G. Mondesert, M. Segal, B. L. Bertolaet, S. Jensen, M. Wolff, M. Henze, and S. I. Reed. 2001. Dosage suppressors of Pds1 implicate ubiquitin-associated domains in checkpoint control. Mol. Cell. Biol. 21:1997-2007.
9. Connolly, B., C. I. White, and J. E. Haber. 1988. Physical monitoring of mating type switching in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:2342-2349.
10. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97:299-311.[CrossRef][Medline]
11. Deshaies, R. J. 1999. SCF and Cullin/Ring H2-based ubiquitin ligases. Annu. Rev. Cell Dev. Biol. 15:435-467.[CrossRef][Medline]
12. Deveraux, Q., V. Ustrell, C. Pickart, and M. Rechsteiner. 1994. A 26 S protease subunit that binds ubiquitin conjugates. J. Biol. Chem. 269:7059-7061.
13. Dieckmann, T., E. S. Withers-Ward, M. A. Jarosinski, C. F. Liu, I. S. Chen, and J. Feigon. 1998. Structure of a human DNA repair protein UBA domain that interacts with HIV-1 Vpr. Nat. Struct. Biol. 5:1042-1047.[CrossRef][Medline]
14. Elsasser, S., R. R. Gali, M. Schwickart, C. N. Larsen, D. S. Leggett, B. Muller, M. T. Feng, F. Tubing, G. A. Dittmar, and D. Finley. 2002. Proteasome subunit Rpn1 binds ubiquitin-like protein domains. Nat. Cell Biol. 4:725-730.[CrossRef][Medline]
15. Finley, D., S. Sadis, B. P. Monia, P. Boucher, D. J. Ecker, S. T. Crooke, and V. Chau. 1994. Inhibition of proteolysis and cell cycle progression in a multiubiquitination-deficient yeast mutant. Mol. Cell. Biol. 14:5501-5509.
16. Funakoshi, M., S. Geley, T. Hunt, T. Nishimoto, and H. Kobayashi. 1999. Identification of XDRP1; a Xenopus protein related to yeast Dsk2p binds to the N-terminus of cyclin A and inhibits its degradation. EMBO J. 18:5009-5018.[CrossRef][Medline]
17. Funakoshi, M., T. Sasaki, T. Nishimoto, and H. Kobayashi. 2002. Budding yeast Dsk2p is a polyubiquitin-binding protein that can interact with the proteasome. Proc. Natl. Acad. Sci. USA 99:745-750.
18. Gilon, T., O. Chomsky, and R. G. Kulka. 1998. Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae. EMBO J. 17:2759-2766.[CrossRef][Medline]
19. Guterman, A., and M. H. Glickman. 2004. Complementary roles for Rpn11 and Ubp6 in deubiquitination and proteolysis by the proteasome. J. Biol. Chem. 279:1729-1738.
20. Hartmann-Petersen, R., K. B. Hendil, and C. Gordon. 2003. Ubiquitin binding proteins protect ubiquitin conjugates from disassembly. FEBS Lett. 535:77-81.[CrossRef][Medline]
21. Hartmann-Petersen, R., M. Wallace, K. Hofmann, G. Koch, A. H. Johnsen, K. B. Hendil, and C. Gordon. 2004. The Ubx2 and Ubx3 cofactors direct Cdc48 activity to proteolytic and nonproteolytic ubiquitin-dependent processes. Curr. Biol. 14:824-828.[CrossRef][Medline]
22. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu. Rev. Biochem. 67:425-479.[CrossRef][Medline]
23. Hofmann, K., and P. Bucher. 1996. The UBA domain: a sequence motif present in multiple enzyme classes of the ubiquitination pathway. Trends Biochem. Sci. 21:172-173.[CrossRef][Medline]
24. Jelinsky, S. A., P. Estep, G. M. Church, and L. D. Samson. 2000. Regulatory networks revealed by transcriptional profiling of damaged Saccharomyces cerevisiae cells: Rpn4 links base excision repair with proteasomes. Mol. Cell. Biol. 20:8157-8167.
25. Jelinsky, S. A., and L. D. Samson. 1999. Global response of Saccharomyces cerevisiae to an alkylating agent. Proc. Natl. Acad. Sci. USA 96:1486-1491.
26. Jentsch, S., and G. Pyrowolakis. 2000. Ubiquitin and its kin: how close are the family ties? Trends Cell Biol. 10:335-342.[CrossRef][Medline]
27. Kamura, T., T. Hara, M. Matsumoto, N. Ishida, F. Okumura, S. Hatakeyama, M. Yoshida, K. Nakayama, and K. I. Nakayama. 2004. Cytoplasmic ubiquitin ligase KPC regulates proteolysis of p27(Kip1) at G1 phase. Nat. Cell Biol. 6:1229-1235.[CrossRef][Medline]
28. Kaplun, L. 2002. Ph.D. thesis. Ben Gurion University of the Negev, Beersheba, Israel.
29. Kaplun, L., Y. Ivantsiv, A. Bakhrat, and D. Raveh. 2003. DNA damage response-mediated degradation of Ho endonuclease via the ubiquitin system involves its nuclear export. J. Biol. Chem. 278:48727-48734.
30. Kaplun, L., Y. Ivantsiv, D. Kornitzer, and D. Raveh. 2000. Functions of the DNA damage response pathway target Ho endonuclease of yeast for degradation via the ubiquitin-26S proteasome system. Proc. Natl. Acad. Sci. USA 97:10077-10082.
31. Kim, I., K. Mi, and H. Rao. 2004. Multiple interactions of Rad23 suggest a mechanism for ubiquitylated substrate delivery important in proteolysis. Mol. Biol. Cell 15:3357-3365.
32. Kleijnen, M. F., A. H. Shih, P. Zhou, S. Kumar, R. E. Soccio, N. L. Kedersha, G. Gill, and P. M. Howley. 2000. The hPLIC proteins may provide a link between the ubiquitination machinery and the proteasome. Mol. Cell 6:409-419.[CrossRef][Medline]
33. Lam, Y. A., T. G. Lawson, M. Velayutham, J. L. Zweier, and C. M. Pickart. 2002. A proteasomal ATPase subunit recognizes the polyubiquitin degradation signal. Nature 416:763-767.[CrossRef][Medline]
34. Lambertson, D., L. Chen, and K. Madura. 1999. Pleiotropic defects caused by loss of the proteasome-interacting factors Rad23 and Rpn10 of Saccharomyces cerevisiae. Genetics 153:69-79.
35. Leggett, D. S., J. Hanna, A. Borodovsky, B. Crosas, M. Schmidt, R. T. Baker, T. Walz, H. Ploegh, and D. Finley. 2002. Multiple associated proteins regulate proteasome structure and function. Mol. Cell 10:495-507.[CrossRef][Medline]
36. Lommel, L., T. Ortolan, L. Chen, K. Madura, and K. S. Sweder. 2002. Proteolysis of a nucleotide excision repair protein by the 26S proteasome. Curr. Genet. 42:9-20.[CrossRef][Medline]
37. Lustgarten, V., and J. E. Gerst. 1999. Yeast VSM1 encodes a v-SNARE binding protein that may act as a negative regulator of constitutive exocytosis. Mol. Cell. Biol. 19:4480-4494.
38. Marash, M., and J. E. Gerst. 2003. Phosphorylation of the autoinhibitory domain of the Sso t-SNAREs promotes binding of the Vsm1 SNARE regulator in yeast. Mol. Biol. Cell. 14:3114-3125.
39. Medicherla, B., Z. Kostova, A. Schaefer, and D. H. Wolf. 2004. A genomic screen identifies Dsk2p and Rad23p as essential components of ER-associated degradation. EMBO Rep. 5:692-697.[CrossRef][Medline]
40. Mueller, T. D., M. Kamionka, and J. Feigon. 2004. Specificity of the interaction between ubiquitin-associated domains and ubiquitin. J. Biol. Chem. 279:11926-11936.
41. Nash, P., X. Tang, S. Orlicky, Q. Chen, F. B. Gertler, M. D. Mendenhall, F. Sicheri, T. Pawson, and M. Tyers. 2001. Multisite phosphorylation of a CDK inhibitor sets a threshold for the onset of DNA replication. Nature 414:514-521.[CrossRef][Medline]
42. Ng, J. M., W. Vermeulen, G. T. van der Horst, S. Bergink, K. Sugasawa, H. Vrieling, and J. H. Hoeijmakers. 2003. A novel regulation mechanism of DNA repair by damage-induced and RAD23-dependent stabilization of xeroderma pigmentosum group C protein. Genes Dev. 17:1630-1645.
43. Ortolan, T. G., P. Tongaonkar, D. Lambertson, L. Chen, C. Schauber, and K. Madura. 2000. The DNA repair protein Rad23 is a negative regulator of multi-ubiquitin chain assembly. Nat. Cell Biol. 2:601-608.[CrossRef][Medline]
44. Pellicioli, A., S. E. Lee, C. Lucca, M. Foiani, and J. E. Haber. 2001. Regulation of Saccharomyces Rad53 checkpoint kinase during adaptation from DNA damage-induced G2/M arrest. Mol. Cell 7:293-300.[CrossRef][Medline]
45. Pickart, C. M., and R. E. Cohen. 2004. Proteasomes and their kin: proteases in the machine age. Nat. Rev. Mol. Cell Biol. 5:177-187.[CrossRef][Medline]
46. Pickart, C. M., and D. Fushman. 2004. Polyubiquitin chains: polymeric protein signals. Curr. Opin. Chem. Biol. 8:610-616.[CrossRef][Medline]
47. Puig, O., F. Caspary, G. Rigaut, B. Rutz, E. Bouveret, E. Bragado-Nilsson, M. Wilm, and B. Seraphin. 2001. The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24:218-229.[CrossRef][Medline]
48. Raasi, S., I. Orlov, K. G. Fleming, and C. M. Pickart. 2004. Binding of polyubiquitin chains to ubiquitin-associated (UBA) domains of HHR23A. J. Mol. Biol. 341:1367-1379.[CrossRef][Medline]
49. Raasi, S., and C. M. Pickart. 2003. Rad23 ubiquitin-associated domains (UBA) inhibit 26S proteasome-catalyzed proteolysis by sequestering lysine 48-linked polyubiquitin chains. J. Biol. Chem. 278:8951-8959.
50. Rao, H., and A. Sastry. 2002. Recognition of specific ubiquitin conjugates is important for the proteolytic functions of the ubiquitin-associated domain proteins Dsk2 and Rad23. J. Biol. Chem. 277:11691-11695.
51. Raveh, D., S. H. Hughes, B. K. Shafer, and J. N. Strathern. 1989. Analysis of the Ho-cleaved MAT DNA intermediate generated during the mating type switch in the yeast Saccharomyces cerevisiae. Mol. Gen. Genet. 220:33-42.[CrossRef][Medline]
52. Saeki, Y., A. Saitoh, A. Toh-e, and H. Yokosawa. 2002. Ubiquitin-like proteins and Rpn10 play cooperative roles in ubiquitin-dependent proteolysis. Biochem. Biophys. Res. Commun. 293:986-992.[CrossRef][Medline]
53. Saeki, Y., T. Sone, A. Toh-e, and H. Yokosawa. 2002. Identification of ubiquitin-like protein-binding subunits of the 26S proteasome. Biochem. Biophys. Res. Commun. 296:813-819.[CrossRef][Medline]
54. Skowyra, D., K. L. Craig, M. Tyers, S. J. Elledge, and J. W. Harper. 1997. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91:209-219.[CrossRef][Medline]
55. Skowyra, D., D. M. Koepp, T. Kamura, M. N. Conrad, R. C. Conaway, J. W. Conaway, S. J. Elledge, and J. W. Harper. 1999. Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284:662-665.
56. Smith, S., J. Y. Hwang, S. Banerjee, A. Majeed, A. Gupta, and K. Myung. 2004. Mutator genes for suppression of gross chromosomal rearrangements identified by a genome-wide screening in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 101:9039-9044.
57. Strathern, J. N., A. J. Klar, J. B. Hicks, J. A. Abraham, J. M. Ivy, K. A. Nasmyth, and C. McGill. 1982. Homothallic switching of yeast mating type cassettes is initiated by a double-stranded cut in the MAT locus. Cell 31:183-192.[CrossRef][Medline]
58. Ulrich, H. D., and S. Jentsch. 2000. Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair. EMBO J. 19:3388-3397.[CrossRef][Medline]
59. van Nocker, S., S. Sadis, D. M. Rubin, M. Glickman, H. Fu, O. Coux, I. Wefes, D. Finley, and R. D. Vierstra. 1996. The multiubiquitin-chain-binding protein Mcb1 is a component of the 26S proteasome in Saccharomyces cerevisiae and plays a nonessential, substrate-specific role in protein turnover. Mol. Cell. Biol. 16:6020-6028.[Abstract]
60. Verma, R., L. Aravind, R. Oania, W. H. McDonald, J. R. Yates III, E. V. Koonin, and R. J. Deshaies. 2002. Role of Rpn11 metalloprotease in deubiquitination and degradation by the 26S proteasome. Science 298:611-615.
61. Verma, R., S. Chen, R. Feldman, D. Schieltz, J. Yates, J. Dohmen, and R. J. Deshaies. 2000. Proteasomal proteomics: identification of nucleotide-sensitive proteasome-interacting proteins by mass spectrometric analysis of affinity-purified proteasomes. Mol. Biol. Cell 11:3425-3439.
62. Verma, R., R. Oania, J. Graumann, and R. J. Deshaies. 2004. Multiubiquitin chain receptors define a layer of substrate selectivity in the ubiquitin-proteasome system. Cell 118:99-110.[CrossRef][Medline]
63. Walters, K. J., M. F. Kleijnen, A. M. Goh, G. Wagner, and P. M. Howley. 2002. Structural studies of the interaction between ubiquitin family proteins and proteasome subunit S5a. Biochemistry 41:1767-1777.[CrossRef][Medline]
64. Wang, Q., A. M. Goh, P. M. Howley, and K. J. Walters. 2003. Ubiquitin recognition by the DNA repair protein hHR23a. Biochemistry 42:13529-13535.[CrossRef][Medline]
65. Wilkinson, C. R., M. Seeger, R. Hartmann-Petersen, M. Stone, M. Wallace, C. Semple, and C. Gordon. 2001. Proteins containing the UBA domain are able to bind to multi-ubiquitin chains. Nat. Cell Biol. 3:939-943.[CrossRef][Medline]
66. Zhou, B. B., and S. J. Elledge. 2000. The DNA damage response: putting checkpoints in perspective. Nature 408:433-439.[CrossRef][Medline]
67. Zhu, Y., and W. Xiao. 2004. Pdr3 is required for DNA damage induction of MAG1 and DDI1 via a bi-directional promoter element. Nucleic Acids Res. 32:5066-5075.
68. Zhu, Y., and W. Xiao. 2001. Two alternative cell cycle checkpoint pathways differentially control DNA damage-dependent induction of MAG1 and DDI1 expression in yeast. Mol. Genet. Genomics 266:436-444.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
-FLAG), blotted, and subjected to Western analysis using anti-LacZ antibodies to detect HoLZ. Left lane shows HoLZ by IP-Western. (B) Western blots of total cell lysates (TCL) from cells expressing FRAD23, FDSK2, or FDDI1 were reacted with anti-FLAG antibodies. FUDP represents FLAGUbL-UbA proteins as indicated above each lane.
