![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Departments of Pathology,1 Biochemistry, University of Utah Health Sciences Center, Salt Lake City, Utah 841322
Received 9 March 2005/ Returned for modification 29 March 2005/ Accepted 19 April 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The yeast FACT complex (yFACT; facilitator of chromatin transactions) also changes chromatin structure, but its activity does not require ATP (20) and does not result in DNA movement relative to the nucleosomal histone core (43). Human FACT was first identified as a factor that stimulates RNA polymerase II elongation through chromatin templates (38). Human FACT promotes the displacement of one H2A-H2B dimer from a nucleosome, and the resulting partial nucleosome is less inhibitory to the elongating RNA polymerase (6). Genetic studies in Saccharomyces cerevisiae suggest that yFACT may be able to partially disrupt nucleosomes as well as restore the nucleosome to its normal state (21).
The human FACT complex is composed of two proteins, p140 and SSRP1 (39), whose yeast homologs are Spt16 (or Cdc68) and Pob3, respectively. SSRP1 contains a DNA-binding motif of the HMGB family, but this motif is absent in Pob3 and is instead provided by a separate small protein, Nhp6. Spt16 and Pob3 form a stable heterodimeric SP complex that weakly associates with Nhp6 (11, 20). A role for yFACT in transcriptional elongation is supported by biochemical studies showing that yFACT associates with known elongation factors (30, 50, 51), by chromatin immunoprecipitation (ChIP) and immunolocalization studies showing association of FACT with elongating RNA polymerase II (36, 45), as well as genetic interactions with mutations affecting elongation factors (21, 51). However, Drosophila FACT associates with the GAGA factor, stimulating chromatin remodeling at the promoter (49), and Spt16 inactivation in yeast results in reduced binding of TBP and TFIIB at promoters (36). These results suggest a role for FACT in transcription initiation in addition to the known role in elongation.
The Nhp6 subunit of yFACT has roles in both transcriptional initiation and elongation, and we recently identified TBP point mutants that are viable in a NHP6 strain but lethal in the nhp6a/b mutant (19). Many of these TBP mutants are also lethal when combined with mutations affecting the Swi/Snf ATP-dependent chromatin remodeling factor or the Gcn5 histone acetyltransferase (9). Additionally, mutations in TFIIA that affect its interaction with TBP are also lethal with nhp6a/b, swi2, and gcn5 (9). These results suggest that Nhp6, Swi/Snf, and Gcn5 enhance assembly of the TBP-TFIIA-DNA complex. In this report we present evidence suggesting that yFACT also facilitates interaction of TBP with TFIIA on nucleosomal DNA and therefore has a direct role in initiation of transcription.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids. The plasmids used are listed in Table S2 in the supplemental material. Plasmid M4806 was constructed by moving a 4.2-kb SalI fragment with TOA1 and TOA2 from pSH346, provided by Steve Hahn, into YEplac195 (23). Plasmid M4761 was constructed by moving a 937-bp BamHI-SacI fragment with NHP6A from plasmid M4221 (9) into YEplac195 (23).
In vitro binding experiments.
Spt16-Pob3 was overexpressed in yeast and purified to apparent homogeneity as described previously using standard chromatographic methods (63) or using a cleavable histidine tag/Ni affinity procedure that produces a similarly pure preparation. Both preparations produce identical results. No ATP is added to the reactions, and yFACT activity is unaffected by the addition of apyrase, ruling out a contribution to the activity from potential contamination with ATP-dependent factors such as remodelers. Recombinant Nhp6 with the native protein sequence was purified from bacteria as described previously (44). Plasmids PH-MLT(+3), PH-MLT(+3)-Mu, PH-MLT(0), and PH-MLT(+6) (24) were PCR amplified using oligonucleotides CCCGGATCCCCCGGGGTTACAAG and GGGCCCGGGTTCGTGATACGAGC, and the resulting PCR products were radiolabeled with polynucleotide kinase and [
-32P]ATP. Following restriction digestion with BamHI to remove the label at one end, the 157-nucleotide templates were assembled into mononucleosomes by slow dialysis from a high-salt solution in the presence of histone octamers (20). Partial DNase I digestion was performed as described previously (43). The purified Spt16-Pob3, Nhp6, TBP, and TFIIA proteins were used in binding reactions at the following concentrations: 58 nM Spt16-Pob3, 5 uM Nhp6, 3.1 uM TBP, and 0.85 uM TFIIA.
Chromatin immunoprecipitations. Chromatin immunoprecipitations were performed as described previously (3) using a polyclonal anti-TBP sera generously provided by Tony Weil, except that the wash buffers included 1% Sarkosyl and 0.1% sodium dodecyl sulfate (46). Real-time PCR and calculations were performed as described previously (19), using the Intergenic V primer set (29) as the internal control. The sequences of the PCR primers are as follows: ELP3, TGCCGCTTTCATTGTTTA and TGTTGTTCCCGAGGTTAAAG; SER3, GAGTAATTACTTTGTTGGAAGG and AGTAAAATCTTCATATCACCCG; and Intergenic V, GGCTGTCAGAATATGGGGCCGTAGTA and CACCCCGAAGCTGCTTTCACAATAC.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We tested 16 TBP mutants for synthetic lethality in combination with seven spt16 mutations. The various spt16 alleles showed subtle differences in the pattern of synthetic lethalities with TBP mutants (Table 1). The spt16-11 (T828I, P859S) allele shows the strongest effects, with eight TBP mutants showing synthetic lethality or a significant growth defect (Fig. 1A and Table 1). Four of the TBP mutants, E93G, K138T/Y139A, G147W, and G174E, showed very strong synthetic defects in most of the spt16 mutants. Our previous genetic analysis of these mutants showed some interesting common features among these same four mutants (9). These TBP mutants are lethal in a gcn5 strain, and the TBP gcn5 synthetic lethality for all four can be suppressed by overexpression of TFIIA. Similarly, these four TBP mutants are all lethal in a swi2 mutant, and TFIIA overexpression suppresses the TBP swi2 synthetic lethality for three of these TBP mutants. All four TBP mutants are lethal in a nhp6a/b strain, and for three of the TBP mutants, this synthetic lethality can be suppressed by a spt3 mutation. These TBP mutants that cannot be tolerated along with mutation of SPT16 are therefore generally sensitive to changes that lead to decreased probability of transcription initiation.
|
|
These TBP mutants could be defective in interacting with TFIIA, and the synthetic defects could reflect a role for yFACT in promoting assembly of the TBP-TFIIA-DNA complex. Overexpression of TFIIA might then allow these TBP mutants to interact with TFIIA despite the spt16 mutation. In fact, TFIIA overexpression did suppress the spt16 TBP lethality for 9 of 12 mutant combinations tested, and overexpressing TFIIB suppressed it in one instance (Fig. 1B and Table 2), strongly suggesting that the spt16 mutation exacerbates the defective TBP-TFIIA interaction. Nhp6 overexpression did not suppress any synthetic lethality, but it strongly inhibited growth of several mutant combinations (Fig. 1C and Table 2). Nhp6 may enhance TBP binding more globally (9), and thus excess Nhp6 could be inhibitory because it promotes formation of TBP-containing complexes at nonproductive sites. These results support a role for Spt16 in facilitating formation of the TBP-TFIIA complex in vivo.
|
|
) synthetic lethality is suppressed by YEp-NHP6A, while weaker suppression by YEp-TBP is seen. In contrast, the spt16-11 toa2(W76A) synthetic lethality is only suppressed by YEp-TBP (Fig. 2B). These results support the idea of a role for the yFACT complex in TBP-TFIIA-DNA complex formation.
Deletion of SPT3 suppresses spt16 phenotypes.
Spt3 and Spt8 are components of the SAGA transcriptional coactivator complex (54). Spt3 physically interacts with TBP, and Spt8 makes direct contact with TFIIA (18, 62). We have observed that disruption of either SPT3 or SPT8 suppresses synthetic lethalities along with transcriptional and growth defects associated with mutations affecting Nhp6, Gcn5, and TBP (9, 65). This suggests that Spt3 and Spt8 act in opposition to these transcription initiation factors at some genes important for growth. In support of this, SPT3 and SPT8 have been shown to negatively regulate expression of specific promoters (7, 65). Based on these observations, we constructed spt16-11 spt3 and spt16-11 spt8 double mutant strains and found that spt3 or spt8 suppress the temperature sensitivity of an spt16 mutant (Fig. 3A). This mutual suppression suggests that Spt16 and Spt3/8 oppose each other while regulating TBP binding to promoters in vivo.
|
mutation would also suppress these synthetic growth defects. The spt16-11 gcn5 double mutant grows poorly at 25°C and is lethal at 30°C, but both of these defects are suppressed by deletion of the SPT3 gene (Fig. 3B). The Gcn5 histone acetyltransferase and the Rpd3 histone deacetylase act in opposition, and thus it is surprising that spt16-11 shows synthetic growth defects with both gcn5 and rpd3. The spt16-11 rpd3 strain is lethal at 34°C, but a spt3 mutation suppresses this synthetic lethality (Fig. 3C). In interpreting these results, we note that the Gcn5 and Rpd3 factors have been implicated primarily as regulators acting at promoter regions. Moreover, histone acetylation promotes in vivo binding by TBP (47) and in vitro binding by TBP and TFIIA to nucleosomal templates (9). We propose that at some promoters both the yFACT complex and histone acetylation influence DNA binding by TBP and TFIIA and that either the proper level of acetylation or the ability to remove this modification at the appropriate time is an important component of the effect of acetylation.
The Nhp6 architectural transcription factor is required for the Spt16-Pob3 complex to bind to nucleosomes in vitro (20). An nhp6ab strain, with deletions of both of the genes that encode Nhp6, NHP6A and NHP6B, is viable, as is the spt16-11 mutant. However, combining these viable mutations in the spt16-11 nhp6ab strain results in synthetic lethality at 33°C (20). However, a spt3 mutation also suppresses the synthetic lethality of the spt16-11 nhp6ab double mutant (Fig. 3D). Nhp6 has been shown to stimulate formation of the TBP-TFIIA-DNA complex in vitro (9), and the suppression of spt16-11 nhp6ab synthetic lethality by spt3 supports the idea that yFACT is involved in regulating TBP-TFIIA-DNA complex formation.
The spt16 phenotype depends on a functional interaction between TBP and Spt3. The Spt3 component of the SAGA complex has been shown to interact with TBP, and the TBP(G174E) mutant shares phenotypes with spt3 mutations (18). Additionally, allele-specific suppression between TBP and Spt3 mutations suggests a direct interaction between TBP and Spt3 (18). TBP binding to the GAL1 promoter is lost in either a TBP(G174E) or a Spt3(E240K) mutant (32). However, TBP binding to GAL1 is restored in the TBP(G174E) Spt3(E240K) double mutant, demonstrating a functional interaction between TBP and Spt3. We have shown that Spt3 inhibits TBP binding to the HO promoter (66). Additionally, the reduced HO expression caused by a gcn5 mutation can be suppressed by either a TBP(G174E) or a Spt3(E240K) mutant. The presence of both TBP(G174E) and Spt3(E240K) reduces HO expression in the gcn5 mutant to the same level as observed with wild-type TBP and Spt3, again demonstrating the functional interaction between TBP(G174E) and Spt3(E240K), in this case to maintain repression of a hypoacetylated promoter.
Based on these results, we wanted to test whether the phenotypes of the spt16-11 strain are dependent on the functional interaction between Spt3 and TBP, using the TBP(G174E) and Spt3(E240K) mutants. Isogenic strains were constructed that differ at SPT16, TBP, and SPT3. However, we were unable to isolate a spt16-11 TBP(G174E) SPT3 strain in our crosses, suggesting that this combination was lethal. A plasmid shuffle experiment shows that spt16-11 and TBP(G174E) are synthetically lethal, showing no growth on 5-FOA (Fig. 3E), while the TBP(G174E) mutant grows well in an SPT16 strain (65). However, introduction of either a spt3 gene disruption or the spt3(E240K) mutation allows the spt16-11 TBP(G174E) strain to grow (Fig. 3F, lines 6 and 7). The spt16-11 strain grows poorly at a semipermissive temperature of 34°C. This defect is suppressed by a spt3 gene disruption, and the suppression is even stronger with the spt3(E240K) mutation (Fig. 3F, compare lines 3, 4, and 5). Importantly, when the allelic interaction is restored with Spt3(E240K) in the presence of TBP(G174E), the strain once again becomes sensitive to growth at a higher temperature (Fig. 3F, compare lines 5 and 7). We conclude that the ability of Spt3 to bind to TBP is required for Spt3 to perform the activity that opposes yFACT action with TBP.
spt16 and spt3 mutations affect TBP binding in vivo. ChIP experiments have shown that mutations in Spt16 and Spt3 both affect TBP binding to promoters in vivo. Inactivation of Spt16 results in reduced binding of TBP and TFIIB to promoters (36). Spt3 is required for TBP binding to some promoters (8, 17). In light of these results, and our results showing mutual suppression between spt16-11 and spt3 (Fig. 3A), we decided to examine whether this suppression is also seen in terms of TBP binding.
Four isogenic strains differing at the SPT16 and spt3 loci were grown at 25°C to early log phase and then shifted to 37°C for 3 h, and then TBP binding was analyzed by ChIP. Following cross-linking, immunoprecipitation with anti-TBP antibody, and reversal of cross-links, TBP binding to various promoters was measured by real-time PCR. After the shift to 37°C, TBP binding to the ELP3 and SER3 promoters was markedly reduced in both the spt16-11 and spt3 mutant strains (Fig. 4). Moreover, TBP binding in the spt16-11 spt3 double mutant is higher than in either single mutant, approaching that seen in the wild type. These results show that the improved growth in the spt16-11 spt3 double mutant compared to the single mutants (Fig. 3A) is reflected by changes in TBP binding to multiple promoters.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Support for a direct role of yFACT in initiation also derives from our experiments showing genetic interactions between spt16 and spt3 mutations. Unlike yFACT, which also has a role in transcriptional elongation, the available evidence indicates that Spt3 functions solely at promoters (4, 7, 8, 14, 32, 34, 60, 65), and Spt3 interacts with TBP physically and genetically (18). The suppression of spt16 defects by a spt3 gene deletion is consistent with the idea that yFACT stimulates TBP binding to certain promoters while Spt3 usually functions as a TBP inhibitor. In contrast, our ChIP experiments suggest Spt3 promotes TBP binding, as TBP occupancy at selected promoters is reduced in the spt3 mutant. These results are not inconsistent, as Spt3 can either stimulate or inhibit TBP binding, depending on the promoter (7, 8, 17, 65). In any case, we see mutual suppression in both experiments, with reduced growth at 35°C and reduced TBP binding in the spt16 and spt3 single mutants and suppression of both effects in the spt16 spt3 double mutant. Finally, ChIP experiments show that yFACT binds both to promoters and to coding regions (36), and Drosophila FACT associates with the GAGA factor, stimulating chromatin remodeling at promoters (49). This large set of interactions, many of which depend on allele-specific interactions among proteins known to interact directly, strongly implicates yFACT directly in promoting transcription initiation. The ability of yFACT to promote TBP binding in vitro using purified components demonstrates that this activity is direct.
Genetic analyses show many similarities in the relationships between yFACT and Swi/Snf with TBP-TFIIA, suggesting that each facilitates formation of TBP-TFIIA-TATA complexes. For example, we have shown that mutating yFACT causes synthetic lethality with both TBP and TFIIA mutants, and we previously showed that swi2 is also synthetically lethal with the same TBP and TFIIA mutants (9). Moreover, TFIIA overexpression suppresses the spt16 TBP and swi2 TBP synthetic lethalities, and TBP overexpression suppresses the spt16 TFIIA and swi2 TFIIA synthetic lethalities. Additionally, histone acetylation by Gcn5 is also important for TBP binding. Much like the results with Swi/Snf and yFACT, a gcn5 mutation is synthetically lethal with TBP and TFIIA mutants, and these lethal interactions were suppressed by overexpression of the other partner in the TBP-TFIIA complex (9). Further, acetylation of histones also promotes TBP-TFIIA binding to TATA sites within nucleosomes (9). Thus, chromatin remodeling by Swi/Snf, histone acetylation by Gcn5, and now nucleosome reorganization by yFACT have all been shown to contribute independently to formation of the TBP-TFIIA-DNA complex in a native chromatin context.
The mechanisms used by each of these factors to promote formation of the preinitiation complex are likely to be distinct. Swi/Snf is the archetypical ATP-dependent chromatin remodeling factor and appears to use ATP hydrolysis to translocate DNA relative to the histone octamer (5). This could either place the TATA site in an accessible linker location or on the surface of a repositioned nucleosome such that it is more available for binding. The strong dependence of TBP binding on rotational phasing in the presence of Swi/Snf is most consistent with the latter interpretation.
In contrast, reorganization of nucleosomes by yFACT alters chromatin structure without hydrolyzing ATP and does not involve movement of the histone octamer core relative to the DNA sequence (20, 43). Specific sites become more accessible to DNase I and to some restriction endonucleases in the reorganized nucleosomes, even though they can be recovered subsequently in a largely intact form (43). We have proposed that yFACT promotes an internal rearrangement of the nucleosomal components and that while this may lead to displacement of some components, it is instead normally a rapidly reversible process that leaves the nucleosome unaffected afterwards (21). We propose that this ability to reversibly reorganize nucleosome structure to an alternate form is important during both initiation and elongation by RNA polymerase II. One possibility is that reorganization assists the formation of TBP-TFIIA-TATA complexes required for initiation by making the binding site at least temporarily more accessible, and it also promotes elongation by making nucleosomes less inhibitory to polymerase passage.
yFACT contains Nhp6, Spt16, and Pob3. Mutations in NHP6 are also synthetically lethal with either TBP or TFIIA mutants (19), and thus one might think that spt16 mutants should show similar genetic interactions. However, there are important functional differences between Nhp6 and Spt16-Pob3. Strains with nhp6ab gene disruptions are viable, while SPT16 and POB3 are essential genes. Nhp6 does not bind tightly to Spt16-Pob3 (11, 20), and multiple Nhp6 molecules are needed to allow Spt16-Pob3 binding to a nucleosome (44). Nhp6 bends DNA sharply (42), and we believe that multiple Nhp6 molecules are needed to destabilize the nucleosome to promote binding by other factors such as Spt16-Pob3 (44). Nhp6 is a very abundant protein and has been shown to interact with a number of important chromatin proteins, including Spt16-Pob3, Swi/Snf, RSC, and Ssn6/Tup1 (9, 20, 22, 56). Nhp6 and other HMG proteins have been previously shown to interact with basal transcription factors like TBP (9, 16, 41, 55) but Spt16-Pob3 has not. Thus, while Nhp6 supports the function of Spt16-Pob3 in the context of yFACT, it is not simply a subunit of yFACT but instead has roles in other contexts. In this view, it is not surprising that phenotypes are not always shared among mutants in Nhp6, Spt16, and Pob3. However, Nhp6 and Spt16-Pob3 each function directly during initiation of transcription. Further work is needed to understand the mechanisms by which yFACT facilitates binding of factors to chromatin.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grants awarded to T.F. and D.J.S. from the National Institutes of Health.
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Arndt, K. M., S. L. Ricupero, D. M. Eisenmann, and F. Winston. 1992. Biochemical and genetic characterization of a yeast TFIID mutant that alters transcription in vivo and DNA binding in vitro. Mol. Cell. Biol. 12:2372-2382.
3. Ausubel, F. M., R. Brent, R. E. Kingston, D. E. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. Wiley and Sons, New York, N,Y.
4. Barbaric, S., H. Reinke, and W. Horz. 2003. Multiple mechanistically distinct functions of SAGA at the PHO5 promoter. Mol. Cell. Biol. 23:3468-3476.
5. Becker, P. B., and W. Horz. 2002. ATP-dependent nucleosome remodeling. Annu. Rev. Biochem. 71:247-273.[CrossRef][Medline]
6. Belotserkovskaya, R., S. Oh, V. A. Bondarenko, G. Orphanides, V. M. Studitsky, and D. Reinberg. 2003. FACT facilitates transcription-dependent nucleosome alteration. Science 301:1090-1093.
7. Belotserkovskaya, R., D. E. Sterner, M. Deng, M. H. Sayre, P. M. Lieberman, and S. L. Berger. 2000. Inhibition of TATA-binding protein function by SAGA subunits Spt3 and Spt8 at Gcn4-activated promoters. Mol. Cell. Biol. 20:634-647.
8. Bhaumik, S. R., and M. R. Green. 2002. Differential requirement of SAGA components for recruitment of TATA-box-binding protein to promoters in vivo. Mol. Cell. Biol. 22:7365-7371.
9. Biswas, D., A. N. Imbalzano, P. Eriksson, Y. Yu, and D. J. Stillman. 2004. Role for Nhp6, Gcn5, and the Swi/Snf complex in stimulating formation of the TATA-binding protein-TFIIA-DNA complex. Mol. Cell. Biol. 24:8312-8321.
10. Boeke, J. D., F. LaCroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346.[CrossRef][Medline]
11. Brewster, N. K., G. C. Johnston, and R. A. Singer. 2001. A bipartite yeast SSRP1 analog comprised of Pob3 and Nhp6 proteins modulates transcription. Mol. Cell. Biol. 21:3491-3502.
12. Buratowski, R. M., J. Downs, and S. Buratowski. 2002. Interdependent interactions between TFIIB, TATA binding protein, and DNA. Mol. Cell. Biol. 22:8735-8743.
13. Buratowski, S., and H. Zhou. 1992. Transcription factor IID mutants defective for interaction with transcription factor IIA. Science 255:1130-1132.
14. Collart, M. A. 1996. The NOT, SPT3, and MOT1 genes functionally interact to regulate transcription at core promoters. Mol. Cell. Biol. 16:6668-6676.[Abstract]
15. Côté, J., J. Quinn, J. L. Workman, and C. L. Peterson. 1994. Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science 265:53-60.
16. Das, D., and W. M. Scovell. 2001. The binding interaction of HMG-1 with the TATA-binding protein/TATA complex. J. Biol. Chem. 276:32597-32605.
17. Dudley, A. M., C. Rougeulle, and F. Winston. 1999. The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo. Genes Dev. 13:2940-2945.
18. Eisenmann, D. M., K. M. Arndt, S. L. Ricupero, J. W. Rooney, and F. Winston. 1992. SPT3 interacts with TFIID to allow normal transcription in Saccharomyces cerevisiae. Genes Dev. 6:1319-1331.
19. Eriksson, P., D. Biswas, Y. Yu, J. M. Stewart, and D. J. Stillman. 2004. TATA-binding protein mutants that are lethal in the absence of the Nhp6 high-mobility-group protein. Mol. Cell. Biol. 24:6419-6429.
20. Formosa, T., P. Eriksson, J. Wittmeyer, J. Ginn, Y. Yu, and D. J. Stillman. 2001. Spt16-Pob3 and the HMG protein Nhp6 combine to form the nucleosome-binding factor SPN. EMBO J. 20:3506-3517.[CrossRef][Medline]
21. Formosa, T., S. Ruone, M. D. Adams, A. E. Olsen, P. Eriksson, Y. Yu, A. R. Rhoades, P. D. Kaufman, and D. J. Stillman. 2002. Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevisiae cause dependence on the Hir/Hpc pathway. Polymerase passage may degrade chromatin structure. Genetics 162:1557-1571.
22. Fragiadakis, G. S., D. Tzamarias, and D. Alexandraki. 2004. Nhp6 facilitates Aft1 binding and Ssn6 recruitment, both essential for FRE2 transcriptional activation. EMBO J. 23:333-342.[CrossRef][Medline]
23. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
24. Imbalzano, A. N., H. Kwon, M. R. Green, and R. E. Kingston. 1994. Facilitated binding of TATA-binding protein to nucleosomal DNA. Nature 370:481-485.[CrossRef][Medline]
25. Kaplan, C. D., L. Laprade, and F. Winston. 2003. Transcription elongation factors repress transcription initiation from cryptic sites. Science 301:1096-1099.
26. Kim, M., S. H. Ahn, N. J. Krogan, J. F. Greenblatt, and S. Buratowski. 2004. Transitions in RNA polymerase II elongation complexes at the 3' ends of genes. EMBO J. 23:354-364.[CrossRef][Medline]
27. Kim, T. K., S. Hashimoto, R. J. Kelleher III, P. M. Flanagan, R. D. Kornberg, M. Horikoshi, and R. G. Roeder. 1994. Effects of activation-defective TBP mutations on transcription initiation in yeast. Nature 369:252-255.[CrossRef][Medline]
28. Kobayashi, A., T. Miyake, Y. Ohyama, M. Kawaichi, and T. Kokubo. 2001. Mutations in the TATA-binding protein, affecting transcriptional activation, show synthetic lethality with the TAF145 gene lacking the TAF N-terminal domain in Saccharomyces cerevisiae. J. Biol. Chem. 276:395-405.
29. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14:2452-2460.
30. Krogan, N. J., M. Kim, S. H. Ahn, G. Zhong, M. S. Kobor, G. Cagney, A. Emili, A. Shilatifard, S. Buratowski, and J. F. Greenblatt. 2002. RNA polymerase II elongation factors of Saccharomyces cerevisiae: a targeted proteomics approach. Mol. Cell. Biol. 22:6979-6992.
31. Kwon, H., A. N. Imbalzano, P. A. Khavari, R. E. Kingston, and M. R. Green. 1994. Nucleosome disruption and enhancement of activator binding by a human SW1/SNF complex. Nature 370:477-481.[CrossRef][Medline]
32. Larschan, E., and F. Winston. 2001. The S. cerevisiae SAGA complex functions in vivo as a coactivator for transcriptional activation by Gal4. Genes Dev. 15:1946-1956.
33. Lee, T. I., and R. A. Young. 2000. Transcription of eukaryotic protein-coding genes. Annu. Rev. Genet. 34:77-137.[CrossRef][Medline]
34. Madison, J. M., and F. Winston. 1997. Evidence that Spt3 functionally interacts with Mot1, TFIIA, and TATA-binding protein to confer promoter-specific transcriptional control in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:287-295.[Abstract]
35. Malone, E. A., C. D. Clark, A. Chiang, and F. Winston. 1991. Mutations in SPT68/CDC68 suppress cis- and trans-acting mutations that affect promoter function in Saccharomyces cerevisiae. Mol. Cell. Biol. 11:5710-5717.
36. Mason, P. B., and K. Struhl. 2003. The FACT complex travels with elongating RNA polymerase II and is important for the fidelity of transcriptional initiation in vivo. Mol. Cell. Biol. 23:8323-8333.
37. Moreira, J. M., and S. Holmberg. 1998. Nucleosome structure of the yeast CHA1 promoter: analysis of activation-dependent chromatin remodeling of an RNA-polymerase-II-transcribed gene in TBP and RNA pol II mutants defective in vivo in response to acidic activators. EMBO J. 17:6028-6038.[CrossRef][Medline]
38. Orphanides, G., G. LeRoy, C. H. Chang, D. S. Luse, and D. Reinberg. 1998. FACT, a factor that facilitates transcript elongation through nucleosomes. Cell 92:105-116.[CrossRef][Medline]
39. Orphanides, G., W. H. Wu, W. S. Lane, M. Hampsey, and D. Reinberg. 1999. The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature 400:284-288.[CrossRef][Medline]
40. Ozer, J., L. E. Lezina, J. Ewing, S. Audi, and P. M. Lieberman. 1998. Association of transcription factor IIA with TATA binding protein is required for transcriptional activation of a subset of promoters and cell cycle progression in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:2559-2570.
41. Paull, T. T., M. Carey, and R. C. Johnson. 1996. Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitiation complexes in vitro. Genes Dev. 10:2769-2781.
42. Paull, T. T., and R. C. Johnson. 1995. DNA looping by Saccharomyces cerevisiae high mobility group proteins NHP6A/B. Consequences for nucleoprotein complex assembly and chromatin condensation. J. Biol. Chem. 270:8744-8754.
43. Rhoades, A. R., S. Ruone, and T. Formosa. 2004. Structural features of nucleosomes reorganized by yeast FACT and its HMG box component, Nhp6. Mol. Cell. Biol. 24:3907-3917.
44. Ruone, S., A. R. Rhoades, and T. Formosa. 2003. Multiple Nhp6 molecules are required to recruit Spt16-Pob3 to form yFACT complexes and to reorganize nucleosomes. J. Biol. Chem. 278:45288-45295.
45. Saunders, A., J. Werner, E. D. Andrulis, T. Nakayama, S. Hirose, D. Reinberg, and J. T. Lis. 2003. Tracking FACT and the RNA polymerase II elongation complex through chromatin in vivo. Science 301:1094-1096.
46. Schroeder, S. C., B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 14:2435-2440.
47. Sewack, G. F., T. W. Ellis, and U. Hansen. 2001. Binding of TATA binding protein to a naturally positioned nucleosome is facilitated by histone acetylation. Mol. Cell. Biol. 21:1404-1415.
48. Sherman, F. 1991. Getting started with yeast. Methods Enzymol. 194:1-21.[Medline]
49. Shimojima, T., M. Okada, T. Nakayama, H. Ueda, K. Okawa, A. Iwamatsu, H. Handa, and S. Hirose. 2003. Drosophila FACT contributes to Hox gene expression through physical and functional interactions with GAGA factor. Genes Dev. 17:1605-1616.
50. Simic, R., D. L. Lindstrom, H. G. Tran, K. L. Roinick, P. J. Costa, A. D. Johnson, G. A. Hartzog, and K. M. Arndt. 2003. Chromatin remodeling protein Chd1 interacts with transcription elongation factors and localizes to transcribed genes. EMBO J. 22:1846-1856.[CrossRef][Medline]
51. Squazzo, S. L., P. J. Costa, D. L. Lindstrom, K. E. Kumer, R. Simic, J. L. Jennings, A. J. Link, K. M. Arndt, and G. A. Hartzog. 2002. The Paf1 complex physically and functionally associates with transcription elongation factors in vivo. EMBO J. 21:1764-1774.[CrossRef][Medline]
52. Stargell, L. A., and K. Struhl. 1996. A new class of activation-defective TATA-binding protein mutants: evidence for two steps of transcriptional activation in vivo. Mol. Cell. Biol. 16:4456-4464.[Abstract]
53. Stargell, L. A., and K. Struhl. 1995. The TBP-TFIIA interaction in the response to acidic activators in vivo. Science 269:75-78.
54. Sterner, D. E., P. A. Grant, S. M. Roberts, L. J. Duggan, R. Belotserkovskaya, L. A. Pacella, F. Winston, J. L. Workman, and S. L. Berger. 1999. Functional organization of the yeast SAGA complex: distinct components involved in structural integrity, nucleosome acetylation, and TATA-binding protein interaction. Mol. Cell. Biol. 19:86-98.
55. Sutrias-Grau, M., M. E. Bianchi, and J. Bernues. 1999. High mobility group protein 1 interacts specifically with the core domain of human TATA box-binding protein and interferes with transcription factor IIB within the pre-initiation complex. J. Biol. Chem. 274:1628-1634.
56. Szerlong, H., A. Saha, and B. R. Cairns. 2003. The nuclear actin-related proteins Arp7 and Arp9: a dimeric module that cooperates with architectural proteins for chromatin remodeling. EMBO J. 22:3175-3187.[CrossRef][Medline]
57. Tan, S., Y. Hunziker, D. F. Sargent, and T. J. Richmond. 1996. Crystal structure of a yeast TFIIA/TBP/DNA complex. Nature 381:127-151.[CrossRef][Medline]
58. Tansey, W. P., and W. Herr. 1997. Selective use of TBP and TFIIB revealed by a TATA-TBP-TFIIB array with altered specificity. Science 275:829-831.
59. Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630.[CrossRef][Medline]
60. Topalidou, I., M. Papamichos-Chronakis, G. Thireos, and D. Tzamarias. 2004. Spt3 and Mot1 cooperate in nucleosome remodeling independently of TBP recruitment. EMBO J. 23:1943-1948.[CrossRef][Medline]
61. Utley, R. T., J. Cote, T. Owen-Hughes, and J. L. Workman. 1997. SWI/SNF stimulates the formation of disparate activator-nucleosome complexes but is partially redundant with cooperative binding. J. Biol. Chem. 272:12642-12649.
62. Warfield, L., J. A. Ranish, and S. Hahn. 2004. Positive and negative functions of the SAGA complex mediated through interaction of Spt8 with TBP and the N-terminal domain of TFIIA. Genes Dev. 18:1022-1034.
63. Wittmeyer, J., L. Joss, and T. Formosa. 1999. Spt16 and Pob3 of Saccharomyces cerevisiae form an essential, abundant heterodimer that is nuclear, chromatin-associated, and copurifies with DNA polymerase alpha. Biochemistry 38:8961-8971.[CrossRef][Medline]
64. Yamamoto, T., M. Horikoshi, J. Wang, S. Hasegawa, P. A. Weil, and R. G. Roeder. 1992. A bipartite DNA binding domain composed of direct repeats in the TATA box binding factor TFIID. Proc. Natl. Acad. Sci. USA 89:2844-2848.
65. Yu, Y., P. Eriksson, L. T. Bhoite, and D. J. Stillman. 2003. Regulation of TATA-binding protein binding by the SAGA complex and the Nhp6 high-mobility group protein. Mol. Cell. Biol. 23:1910-1921.
66. Yu, Y., P. Eriksson, and D. J. Stillman. 2000. Architectural transcription factors and the SAGA complex function in parallel pathways to activate transcription. Mol. Cell. Biol. 20:2350-2357.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
