Department of Biochemistry and Institute for Genome Sciences and Policy, Duke University, Durham, North Carolina,1 Molecular and Cell Biology Department, University of California, Berkeley, Berkeley, California2
Received 3 March 2005/ Returned for modification 7 April 2005/ Accepted 20 April 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Repression mechanisms are often categorized as locus-specific or regional. Locus-specific repressors are typically DNA-binding proteins that associate with operator sequences near the promoters of target genes. These repressors recruit other corepressor complexes, such as histone deacetylases, and interact with core transcription factors to mediate repression. Regional silencing, in contrast, represses transcription throughout a chromosomal domain in a promoter-independent fashion. Silencing proteins typically associate with nucleosomes and propagate along chromosomes to form a specialized chromatin structure, known as heterochromatin or silenced chromatin, which is inhibitory to transcription. Although at first glance these two mechanisms of repression seem completely distinct, recent work reveals shared mechanistic features, as described below in more detail (7, 9, 37).
Sir protein-mediated silencing in Saccharomyces cerevisiae (reviewed in reference 35) provided the context for the discovery and subsequent investigations of mutant Sum1-1p. Sir-mediated silencing occurs at the donor cassettes for mating type switching, HMR and HML, and also at telomeres. Silencing is mediated by regulatory sites known as silencers, which consist of binding sites for three DNA-binding proteins, origin recognition complex (ORC), Rap1p, and Abf1p. The assembly of silenced chromatin at HM loci involves two distinguishable steps (18, 27, 36). First, the Sir proteins assemble at the silencer via interactions with silencer binding proteins. Then, Sir2p, Sir3p, and Sir4p spread from the silencer. The NAD+-dependent deacetylase activity of Sir2p is not required for assembly of Sir proteins at the silencer but is required for their spreading (18, 36). Sir3p and Sir4p bind the tails of histones H3 and H4, and at least Sir3p has a higher affinity for deacetylated tails (5, 16). These observations inspire a "sequential deacetylation" model for the propagation of silenced chromatin (36). In this model, Sir2p associated with a silencer deacetylates the neighboring nucleosome, creating new high-affinity binding sites for Sir3p and Sir4p. Since Sir2p is found in complex with Sir4p, the binding of Sir3p and Sir4p to the newly deacetylated nucleosome recruits additional Sir2p, which can then deacetylate the next nucleosome.
Sum1p is a locus-specific repressor of genes normally expressed at midsporulation (49) and of genes involved in NAD+ biosynthesis (2). Sum1p binds directly to a DNA sequence upstream of repressed genes (32, 49) and is implicated in the repression of at least 48 genes. For about half of these genes, repression also requires two corepressor proteins, Hst1p and Rfm1p (28), which are found in a complex with Sum1p (28, 33, 37). Hst1p is a deacetylase related to Sir2p (43). Rfm1p, a 35-kDa protein with coiled-coil motifs, is required for the association of Hst1p with Sum1p (28).
A mutant form of Sum1p, known as Sum1-1p, spreads and achieves regional silencing by a mechanism similar to that of Sir proteins (37, 43). The SUM1-1 mutation, T988I (6), restores silencing in strains lacking Sir proteins (23, 24) by redirecting Sum1-1p to HM loci, where it spreads to form repressive chromatin. Like the wild-type Sum1p, Sum1-1p associates with Hst1p and Rfm1p (28, 37, 43), and these proteins are required for deacetylation of nucleosomes in the silenced domain (37).
The single most striking effect of the SUM1-1 mutation is its ability to convert a site-specific repressor into a protein capable of spreading over multiple nucleosomes. There are at least two models to explain the ability of mutant Sum1-1p to spread (Fig. 1). In one model (Fig. 1A), the primary effect of the SUM1-1 mutation is to change the ability of Sum1p to spread, perhaps by increasing the stability of Sum1-1p-containing chromatin. In this scenario, the observed change in the location of Sum1-1p compared to that of Sum1p would be a secondary effect of the increased ability to spread. In the other model (Fig. 1B), the primary effect of the mutation is to change the location of Sum1p by altering the affinity of the protein for a DNA-associated protein or DNA itself. In this model, both wild-type Sum1p and mutant Sum1-1p are fully capable of spreading, but features at the loci where wild-type Sum1p normally acts, such as boundary elements, prevent spreading. Only when Sum1-1p fortuitously ends up at the silent mating type loci, where there are no such boundaries, can it spread. To test these models, we investigated the extent to which the SUM1-1 mutation alters the location of Sum1p and compared the spreading abilities of mutant and wild-type Sum1p.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
::KanMX, sum1
::LEU2, 7myc-SUM1-1, 3myc-SUM1, sir2
::HIS3, sir2
::TRP1, sir2
::LEU2 (37), SUM1-1 (6), hhf1
::HIS3, hhf2
4-19::TRP1 (20), orc2-1 (13), and orc5-1 alleles (26) were previously described. The rfm1
::LEU2 allele was generated by one-step gene conversion (34) with a PCR product amplified from plasmid pRS415 using primers 5'-AATTTATTAGACAAC AGGAAGGTGTTATAAGAAAGTGCGAGATTGTACTGAGAGTGCACC and 5'-TATTTCT CTCTATTTATATTTATTTACTTCTTCAAAGAAGCTGTGCGGTATTTCACACCG. The hst1-N291A and 7myc-SUM1 alleles were generated by a serial gene replacement approach, in which HST1 or SUM1 was first replaced with URA3, which was then replaced with the hst1-N291A allele from plasmid pLR100 or the 7myc-SUM1 allele from plasmid pLR39. The chromosomal TRP1::SUM1 and TRP1::SUM1-1 alleles were generated using plasmid pLR376 or pLR377 linearized within the TRP1 gene.
|
Chromatin IP. Chromatin immunoprecipitations (IP) were performed as previously described (37) using 10 optical density equivalents of cells and 3 µl anti-Myc tag (06-549; Upstate Biotechnology). Cells were treated with 1% formaldehyde for up to 3 h to cross-link proteins to DNA. The DNA was sheared by sonication to an average size of 600 to 700 bp in all experiments. For quantitative real-time PCR, a standard curve was prepared using input DNA. The standard curve and immunoprecipitated samples were amplified with primers for a control locus (ATS1) and the locus of interest in separate reactions, which enabled the relative amount of each locus in the IP sample to be determined. ATS1 was selected as a control locus because it is relatively far from ORC binding sites, which, as discovered here, are associated with Sum1-1p. Reported values represent averages of at least two independent IP experiments, each analyzed in two separate PCRs. Sequences of the oligonucleotides used for PCR are in Table 3.
|
Microarray expression studies. Total RNA was isolated from logarithmically growing cells as described previously (39). cDNA and then cRNA were generated, labeled, and hybridized to Affymetrix S98 yeast arrays, as recommended by the manufacturer.
RNA blots. RNA was separated on 1% agarose-formaldehyde gels and transferred to Zeta Probe membranes (Bio-Rad) (38). Probes were generated by PCR using total yeast genomic DNA. The probes were labeled using the RediPrime II kit (Amersham). The amount of mRNA was normalized to ACT1 mRNA using a Storm phosphorimager.
| RESULTS |
|---|
|
|
|---|
|
Wild-type Sum1p did not spread efficiently at HMR.
To determine whether wild-type Sum1p had an intrinsic ability to spread that was constrained at the sites where it normally binds (Fig. 1B), wild-type Sum1p was recruited to HMR. At this locus there should not be any factors that limit spreading, since mutant Sum1-1p and Sir proteins are able to spread. The binding site for Sum1p (32) was inserted into the HMR silencer in place of the Rap1p binding site, which is not required for Sum1-1p-mediated silencing (37). In addition, the Abf1p binding site was mutated to help prevent the silencer from initiating Sir-mediated silencing. Thus, a silencer was constructed that should bind wild-type Sum1p and which will no longer be silenced by Sir proteins due to the absence of the Rap1p and Abf1p binding sites (Fig. 3A, hmrSum1). The I silencer, which is still intact in this plasmid, cannot initiate Sir-mediated silencing on its own (4, 36). This modified HMR locus was transformed into sir2
yeast on a CEN plasmid, and the ability of Sum1p to spread was assessed by chromatin IP (Fig. 3B). As expected, Sum1p associated with the mutated silencer sequence but not the wild-type silencer, indicating that the inserted Sum1 binding site was functional. However, wild-type Sum1p associated only to a small degree with the a1 gene at hmrSum1. In contrast, the mutant Sum1-1p did spread to the a1 gene on this same plasmid. Thus, within the limits of this assay, wild-type Sum1p did not spread as well at HMR as mutant Sum1-1p.
|
cells, expression of a1 mRNA from HMR prevents mating. However, if HMR were silenced in a very small fraction of cells, these cells would mate and be detected as individual colonies on medium that selects for diploids. When the modified hmrSum1 locus was transformed into yeast bearing wild-type Sum1p, mating was not detected (Fig. 3C, first row, second column). In addition, quantitative mating assays revealed that the fraction of SUM1 cells that mated was not significantly different from the fraction of sum1
cells that mated (2 x 106 for SUM1 and 3 x 106 for sum1
). In contrast, mutant Sum1-1p was much more successful at silencing this same plasmid (second row), and the fraction of mating-competent cells was roughly 104 times greater (4.3 x 102) with mutant Sum1-1p than with wild-type Sum1p in a quantitative mating assay. Thus, mutant Sum1-1p had an enhanced ability to spread compared to wild-type Sum1p.
Both the E and I silencers that flank HMR are bound by ORC, and Sum1-1p acts through ORC (37, 43). Thus, two sites of recruitment flanking the silenced locus may be necessary for stable spreading, and the single wild-type Sum1p binding site in the hmrSum1 allele may not be sufficient. To determine whether recruitment of Sum1p to two sites flanking HMR could promote spreading, a second Sum1p binding site was inserted at the HMR-I silencer (hmrSum1X2) (Fig. 3A). Silencing of this hmrSum1X2 plasmid was not detected in a patch mating assay (Fig. 3C, third column), and the quantitative mating assay revealed that the fraction of cells that mated in the presence of Sum1p (1 x 105) was just slightly greater than the fraction that mated in a sum1
strain (2.5 x 106). Chromatin IP analysis verified that Sum1p did associate robustly with the second binding site (data not shown). In contrast, mutant Sum1-1p successfully silenced hmrSum1X2 (Fig. 3C). Furthermore, since the fraction of SUM1-1 cells that mated was essentially the same on all three HMR alleles (4.5 x 102 for hmrSum1X2, 4.3 x 102 for hmrSum1, and 3.8 x 102 for HMR), the insertion of the two Sum1p binding sites did not alter any features of the plasmid necessary for silencing. Thus, wild-type Sum1p did not spread as efficiently as mutant Sum1-1p at HMR.
It was possible that wild-type Sum1p had the ability to spread but was recruited to HMR in a way that limited its ability to initiate the formation of silenced chromatin. Therefore, an experiment was designed which eliminated the requirement for Sum1p to initiate silenced chromatin yet would still allow an evaluation of its ability to spread. The mutant and wild-type proteins were coexpressed, and the ability of wild-type Sum1p to be incorporated into Sum1-1p-silenced chromatin was examined. If wild-type Sum1p had the ability to spread in the same way as mutant Sum1-1p, then both wild-type and mutant proteins should make up the silenced chromatin. However, when tagged wild-type Sum1p was coexpressed with untagged mutant Sum1-1p, wild-type Sum1p did not associate with the E silencer or the a1 gene significantly more than it did when expressed alone (Fig. 4A). Therefore, wild-type Sum1p was not incorporated into the Sum1-1p-silenced chromatin to a significant extent. The Sum1-1p-silenced chromatin was functional in these cells, since they were able to mate (Fig. 4B, fourth patch). Interestingly, the ability of Sum1-1p to silence HMR was diminished when wild-type Sum1p was coexpressed (Fig. 4B), and this effect was greater when mutant Sum1-1p was tagged than when wild-type Sum1p was tagged. Immunoblots revealed that tagged wild-type and mutant Sum1p were expressed at roughly equivalent levels (data not shown). These observations suggested that wild-type Sum1p, rather than participating in the formation of silenced chromatin, actually disrupted the spreading of mutant Sum1-1p. It also appeared that the myc tag partially compromised the function of the protein. Taken together, these experiments demonstrated that mutant Sum1-1p had a much greater ability to spread than wild-type Sum1p, consistent with model A and not model B (Fig. 1).
|
To test the first prediction, that deacetylation by Hst1p is required for the spreading of Sum1-1p, HST1 was deleted and the distribution of Sum1-1p at HMR was assessed by chromatin immunoprecipitation (Fig. 5A). Sum1-1p still associated with the E silencer at HMR in the absence of Hst1p, indicating that Hst1p was not required for the stability of Sum1-1p or its recruitment to the silencer. However, Sum1-1p did not spread to internal sites at HMR in the absence of Hst1p. The distribution of mutant Sum1-1p was also examined in the absence of Rfm1p, a protein that is required for the association of Hst1p with wild-type Sum1p and for Sum1-1p-mediated silencing (28). In the absence of Rfm1p, Hst1p should not be recruited to HMR, and hence, Sum1-1p should not spread. Consistent with this prediction, Sum1-1p did not spread in the absence of Rfm1p (Fig. 5A). Immunoblot analysis demonstrated that the amount of Sum1-1p did not change in the absence of Hst1p or Rfm1p (data not shown).
|
, and hst1-N291A strains. In the presence of mutant Hst1p-N291A, Sum1-1p did associate with the E silencer but not the a1 gene at HMR, indicating that spreading did not occur (Fig. 5B). In contrast, in the presence of wild-type Hst1p, Sum1-1p associated with both the E silencer and the a1 gene. Consistent with the chromatin immunoprecipitation results, mating did not occur in the presence of the hst1-N291A mutation, suggesting that HMR was no longer silenced (Fig. 5C). Thus, the deacetylase activity of Hst1p was required for the spreading of Sum1-1p.
A second prediction of the sequential deacetylation model is that the hst1-N291A allele should have a dominant-negative phenotype, since incorporation of enzymatically inactive Hst1p into a growing chromatin structure should prevent further spreading of the chromatin. To test this prediction, plasmids bearing either wild-type or mutant HST1 were transformed into a SUM1-1 HST1 sir2
strain, and mating was tested under conditions that required retention of the plasmid. Robust mating occurred in the presence of the wild-type HST1 plasmid, but mating did not occur in the presence of the hst1-N291A plasmid (Fig. 5D, second column). Thus, enzymatically inactive Hst1p had a dominant-negative effect on Sum1-1p-mediated silencing, as predicted by the sequential deacetylation model. The ability of Hst1p-N291A to disrupt Sum1-1p-mediated silencing also demonstrates that this mutant protein was stably expressed.
A third prediction of the sequential deacetylation model is that histone tails should be required for the spreading of Sum1-1p. To test this prediction, a SUM1-1 sir2
strain was constructed in which amino acids 4 to 19 of histone H4 were deleted. This truncation of histone H4 was previously shown to reduce silencing by Sir proteins (20). To determine whether the histone H4 tail deletion affected the spreading of Sum1-1p, chromatin immunoprecipitation was conducted (Fig. 6A). The association of Sum1-1p with the a1 gene was reduced in the absence of the histone H4 tail, consistent with the tail of histone H4 being required for spreading of Sum1-1p. In addition, mating did not occur in the presence of the histone H4 tail deletion (Fig. 6B), indicating that HMR was no longer silenced. In conclusion, all three predictions of the sequential deacetylation model were met for the spreading of Sum1-1p. It was therefore highly likely that Sum1-1p spread by this mechanism.
|
|
If mutant Sum1-1p is recruited to origins throughout the genome, then it would be expected to repress nearby genes. Indeed, SUM1-1 cells grow slowly compared to wild-type cells, whereas sum1
cells grow at the same rate as wild-type cells, suggesting that other genes, perhaps near ORC binding sites, may be silenced by Sum1-1p. To determine whether Sum1-1p-mediated silencing is initiated at other ORC binding sites, we identified additional genes repressed by Sum1-1p and then asked whether those genes were near ORC binding sites. Microarray expression analysis was used to compare the expression profiles of SUM1, SUM1-1, and sum1
cells. In two separate experiments, 16 genes were repressed at least threefold in SUM1-1 cells compared to SUM1 cells and were not also repressed in sum1
cells, indicating that repression was not an effect of the loss of wild-type SUM1. Four of these repressed genes, LSM2, PAM16, KAR1, and VAS1, are essential for life in S. cerevisiae (1), and their reduced expression may explain, in part, the slow growth of SUM1-1 strains. Only 1 of the 16 genes, YGL230C, was derepressed in sum1
cells, whereas the expression of the others was unchanged. None of these genes showed significant association with wild-type Sum1p in a genome-wide localization of Sum1p (25), although three of them were significantly associated with Sum1p when examined individually (Table 4). Since there were no genes that were both associated with Sum1p and derepressed in sum1
cells, we conclude that these genes were not normal targets of wild-type Sum1p. RNA hybridization experiments confirmed that these genes were repressed in SUM1-1 cells compared to expression in wild-type cells (Fig. 7C, lanes 1 and 2; also data not shown). Furthermore, these genes were silenced by a mechanism similar to that operating at HMR, since repression of these genes was reduced in hst1
and orc5-1 strains (Fig. 7C, lanes 4 and 5).
|
Truncation of histone H4 caused Sum1-1p to associate with midsporulation promoters. To resolve the puzzle of how a single amino acid change in Sum1p alters both the localization of the protein and its spreading ability, we considered whether an increased affinity for any of the proteins known to act with Sum1-1p could affect both localization and spreading of Sum1-1p. If mutant Sum1-1p has an increased affinity for another protein and is consequently drawn away from midsporulation promoters, then the absence of that binding partner might allow the mutant Sum1-1p to return to the midsporulation genes. Therefore, the association of Sum1-1p with the midsporulation genes SMK1 and SPR3 was tested in strains bearing mutations in genes known to be important for Sum1-1p-mediated silencing (Fig. 8A). Deletion of the N-terminal tail of histone H4 increased the association of mutant Sum1-1p with midsporulation promoters, suggesting that the Sum1-1p mutation may result in an increased affinity for histone H4 tails. In contrast, mutation of HST1, ORC5 (Fig. 8A), or RFM1 (data not shown) did not increase the association. This observation suggests that although mutant Sum1-1p accumulates at and near ORC binding sites to a greater extent than does wild-type Sum1p, this accumulation is not due to an increased affinity for ORC.
|
If Sum1p and ORC do interact, their binding sites might colocalize in the genome. To quantify the extent of colocalization between ORC and Sum1p, we identified 406 intergenic regions that both were found to contain probable ARS elements (based on genome-wide ORC and MCM binding measurements (48) and were included as microarray probes in a genome-wide protein localization survey of 113 transcription factors (including Sum1p) (25). Of these 406, 66 (16.3%) were found to also bind Sum1p at the level of P values of <0.05. This is a 3.3-fold enrichment over what would be expected by chance, which is a significant (Fisher's exact test; P < 1018) departure from randomness. In fact, Sum1p is the most highly enriched for colocalization with ARS elements among all 113 transcription factors tested, being more than five orders of magnitude more significantly enriched than even the next most enriched factor. Similar, though slightly weaker, enrichments were found when using only ORC binding data instead of both ORC and MCM; this suggests that Sum1p may have the greatest affinity for ORC in the context of ARS elements, as opposed to other sites of ORC binding.
There are two ways in which ORC and Sum1p could interact functionally. ORC could play a role in the Sum1p-mediated repression of some genes, or Sum1p could affect replication at some origins. To determine whether ORC plays a role in Sum1p-mediated repression, RNA was isolated from orc5-1 and orc2-1 yeast and analyzed for the expression of nine Sum1p-repressed genes near ORC binding sites. One of these genes, YJL038C, was clearly induced in both orc5-1 and orc2-1 strains (Fig. 8B), consistent with ORC participating in Sum1p-mediated repression.
To determine whether Sum1p plays a role in replication, we compared the stability of plasmids bearing one of two ARS elements as the sole origin of replication (48). ARS1015 is not associated with a Sum1p binding site, whereas ARS1013, which is located near YJL038C, is associated with a Sum1p binding site. Transformation of ARS1015 into wild-type or sum1
cells yielded robust colonies. In contrast, colonies were slightly smaller when ARS1013 was transformed into wild-type yeast and extremely small in sum1
yeast (Fig. 8C). These results are consistent with Sum1p facilitating replication at ARS1013 but not ARS1015. Thus, the clustering of ORC and Sum1p binding sites, the derepression of YJL038C in orc mutant strains, and the reduced stability of ARS1013 in the absence of Sum1p all suggest a functional interaction between wild-type Sum1p and ORC.
The proposed contribution of Sum1p to replication, at least at a subset of origins, suggests that the lower growth rate of SUM1-1 strains may be due to replication defects rather than repression of essential genes, as proposed above. To test this idea, we compared the growth rates of a double orc5-1 SUM1-1 mutant strain with orc5-1 and SUM1-1 single-mutant strains. If SUM1-1 caused a defect in replication, the double orc5-1 SUM1-1 mutant should have even more severely compromised replication and grow poorly if at all. In contrast, if the slow growth of SUM1-1 strains were due to decreased expression of an essential gene, the orc5-1 mutation should relieve this repression and result in an increased growth rate. The double orc5-1 SUM1-1 mutant strain grew at roughly the same rate as an orc5-1 single-mutant strain and faster than a SUM1-1 strain, and the same result was seen with orc2-1 mutant strains (data not shown). Thus, it is more likely that the poor growth of SUM1-1 strains is due to the reduced expression of essential genes rather than a replication defect.
| DISCUSSION |
|---|
|
|
|---|
A difference in spreading ability between wild-type and mutant Sum1p is also supported by increased telomeric silencing in a SUM1-1 strain (6). This increase in silencing occurs in the presence, but not the absence, of Sir proteins and is probably due to mutant Sum1-1p becoming incorporated into Sir-silenced chromatin, thereby enhancing silencing. In this case, silencing is initiated by the Sir proteins, and therefore the enhanced silencing seen in a SUM1-1 strain compared to a SUM1 strain must be due to an increased ability of the protein to spread.
Having determined that the SUM1-1 mutation affects both the location and spreading ability of the protein, we considered how a single amino acid substitution could alter these two properties. Often, a single amino acid change affects a single function of a protein, for example, the affinity of the protein for another protein or catalysis in the active site. In this case, since no enzymatic activity is known for Sum1p, it is probable that the mutation alters the affinity of the protein for a binding partner, and this alteration causes the observed changes in spreading and location. To identify the particular binding partner for which mutant Sum1-1p had higher affinity, the association of mutant Sum1-1p with midsporulation genes was assessed in various mutant backgrounds. Sum1-1p returned to the midsporulation genes when the N-terminal tail of histone H4 was truncated but not when ORC5, HST1, or RFM1 was mutated (Fig. 8A). The most parsimonious interpretation of this data is that the changes in location and spreading ability resulted from an increased affinity for the N-terminal tail of histone H4, although an indirect effect of the histone H4 truncation cannot be ruled out. An increased interaction between mutant Sum1-1p and histone tails is consistent with our observations that in chromatin IP experiments, more nonspecific DNA precipitates with mutant Sum1-1p than with wild-type Sum1p (data not shown). Since histones are found throughout the genome, mutant Sum1-1p might be at virtually any position in the genome in a fraction of cells in the population. Furthermore, the dependence of Sum1-1p on the Hst1p deacetylase for spreading suggests that Sum1-1p has a higher affinity for deacetylated than acetylated histone tails, perhaps explaining why a slight enrichment for Sum1-1p was observed at repressed genes that are not close to ORC binding sites (Table 4).
The spreading of mutant Sum1-1p. Three important conclusions emerged regarding the mechanism by which Sum1-1p spreads: the deacetylase activity of Hst1p was required for the spreading of Sum1-1p, enzymatically inactive Hst1p had a dominant-negative effect on Sum1-1p-mediated silencing, and the tail of histone H4 was required for Sum1-1p-mediated silencing. These results are all consistent with Sum1-1p spreading by a sequential deacetylation mechanism, much as the Sir proteins do. It is interesting that other types of repressive chromatin, such as silenced chromatin at the mating type locus in Schizosaccharomyces pombe, also propagate through the sequential modification of, and specific binding to, histones (15). It is therefore likely that this is a general mechanism by which specialized chromatin propagates.
The requirement for the N-terminal tail of histone H4 for Sum1-1p to spread (Fig. 6) implied that alterations in the affinity of the protein for the tail of histone H4 could modulate the extent of spreading of the Sum1 protein. Furthermore, since the SUM1-1 mutation appeared to increase the affinity of Sum1-1p for this histone tail (Fig. 8A), this change in affinity was the probable mechanism by which the SUM1-1 mutation increased the ability of the protein to spread. Therefore, one way in which the extent of spreading can be regulated is through the modulation of interactions between chromatin proteins and histone tails. In this view, amino acid substitution, as occurs in the SUM1-1 mutation, is a genetic surrogate for modulating the affinity of a protein for histone tails by posttranslational modifications, such as acetylation, methylation, and phosphorylation, all of which occur frequently on histone tails. Thus, these posttranslational modifications probably play a key role in regulating the spreading of chromatin proteins by impacting the affinity of chromatin proteins for nucleosomes. Indeed, changes in the modification status of histones in the vicinity of silenced domains do alter the extent to which Sir proteins spread (11, 22, 29, 42).
Some chromatin-associated proteins that do not spread also have the ability to modify histones and specifically bind to those modified histones. For example, the yeast Ssn6-Tup1 and mammalian SMRT/N-CoR corepressor complexes both associate with histone deacetylases and bind to unacetylated histone tails, yet neither spreads extensively (8, 9, 12, 47, 50). In these cases, the ability to generate and bind to a specific histone modification is thought to stabilize the association of these protein complexes with chromatin. It is possible that wild-type Sum1p has a similar ability to bind to histones and that the affinity of this interaction is not sufficient to allow spreading. Thus, the ability to modify histones and specifically bind to those modified histones serves at least two purposesstabilizing the association of a protein complex with a promoter or facilitating the spreading of proteins along the chromosome. The strength of the interaction with histone tails is important in determining which of these modes of action predominates. Thus, promoter-specific repressor complexes and silencing complexes that spread are mechanistically related.
Recruitment of mutant Sum1-1p to chromatin.
This study also investigated the mechanism by which mutant Sum1-1p is recruited to particular sites in the genome. Three observations indicate that Sum1-1p accumulated near ORC binding sites. First, quantitative PCR analysis of chromatin IP samples revealed that the association of Sum1-1p with silencers was significantly reduced in an orc5-1 temperature-sensitive strain (Fig. 7A). Second, mutant Sum1-1p associated with two generic ORC binding sites, ARS1 and ARS309 (Fig. 7B). Finally, genes that were repressed in a Sum1-1p-dependent manner were near ORC binding sites (Fig. 7D). Thus, Sum1-1p joins a growing list of repressive proteins, including yeast Sir1p (14, 45) and Drosophila HP1 (31, 40), that are recruited to chromatin at least in part through ORC. In addition, the apparent functional interaction between wild-type Sum1p and ORC, as suggested by the higher-than-expected frequency of Sum1p binding sites near ORC binding sites, the derepression of YJL038C in orc mutant strains (Fig. 8B), and the decreased function of ARS1013 in sum1
cells (Fig. 8C), implies a fundamental link between DNA replication, chromatin structure, and transcriptional repression.
What causes Sum1-1p to accumulate near ORC binding sites? One possibility is that the SUM1-1 mutation increases the affinity of the protein for ORC, as suggested by an observed two-hybrid interaction between ORC5 and mutant SUM1-1 but not wild-type SUM1 (43). However, the orc5-1 mutation did not increase the association of mutant Sum1-1p with midsporulation promoters, whereas deletion of the N-terminal tail of histone H4 did (Fig. 8A). Therefore, it was more likely that Sum1-1p was drawn away from midsporulation genes by an increased affinity for histone tails rather than for ORC. In addition, an increased affinity for ORC would not change the spreading ability of the protein and hence cannot be the sole effect of the SUM1-1 mutation. An alternative model is that both wild-type and mutant Sum1p have a low affinity for ORC. The additional interaction that mutant Sum1-1p is able to make with histone tails in the vicinity of ORC binding sites would provide an additional attachment point, leading to the accumulation of Sum1-1p but not Sum1p near ORC binding sites. It is curious that the proposed increased affinity of Sum1-1p for histone tails does not also strengthen the association of Sum1-1p with midsporulation promoters. Perhaps Sum1-1p has a higher affinity for the particular histone tail modification pattern found near ORC binding sites compared to the pattern found near midsporulation genes. Alternatively, the same Sum1-1p molecule may not be able to bind to histone tails and DNA simultaneously.
Evolution of silencing complexes. The SUM1-1 mutation provides a fascinating opportunity to explore the evolution of repressive chromatin. In essence, Sum1-1p represents the de novo evolution of a new type of silencing protein. A single nucleotide change in the SUM1 gene has given rise to a protein that can form silenced chromatin, whereas the wild-type gene cannot. It is not hard to imagine that similar types of mutations have occurred during the course of evolution, giving rise to novel expression patterns and phenotypes. In fact, Sir-mediated silencing itself is evolutionarily related to Sum1p-mediated repression and could have arisen from a promoter-specific repression complex. The deacetylases Sir2p and Hst1p are paralogs that arose in a genome duplication which occurred in the evolution of Saccharomyces (10, 21, 46). Hence, in an ancestor of Saccharomyces, there was only one Sir2p/Hst1p protein, and the two distinct functions that exist today most likely evolved after the genome duplication. In addition, Sir3p and Orc1p are paralogs (10), suggesting that the silencing-specific function of Sir3p could also have arisen after the genome duplication. Finally, the apparent functional interaction between Sum1p and ORC suggests that an ancestral interaction between a Sum1-like complex and ORC could have been elaborated in the development of the Sir silencing apparatus.
| ACKNOWLEDGMENTS |
|---|
This research was supported by a postdoctoral fellowship from the American Cancer Society (PF-01-116-01-GMC) to L.N.R. and grants from the National Institutes of Health to J.R. (GM31105) and L.R. (GM073991).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Bedalov, A., M. Hirao, J. Posakony, M. Nelson, and J. A. Simon. 2003. NAD+-dependent deacetylase Hst1p controls biosynthesis and cellular NAD+ levels in Saccharomyces cerevisiae. Mol. Cell. Biol. 23:7044-7054.
3. Brachmann, C. B., J. M. Sherman, S. E. Devine, E. E. Cameron, L. Pillus, and J. D. Boeke. 1995. The SIR2 gene family, conserved from bacteria to humans, functions in silencing, cell cycle progression, and chromosome stability. Genes Dev. 9:2888-2902.
4. Brand, A. H., L. Breeden, J. Abraham, R. Sternglanz, and K. Nasmyth. 1985. Characterization of a "silencer" in yeast: a DNA sequence with properties opposite to those of a transcriptional enhancer. Cell 41:41-48.[CrossRef][Medline]
5. Carmen, A. A., L. Milne, and M. Grunstein. 2002. Acetylation of the yeast histone H4 N terminus regulates its binding to heterochromatin protein SIR3. J. Biol. Chem. 277:4778-4781.
6. Chi, M. H., and D. Shore. 1996. SUM1-1, a dominant suppressor of SIR mutations in Saccharomyces cerevisiae, increases transcriptional silencing at telomeres and HM mating-type loci and decreases chromosome stability. Mol. Cell. Biol. 16:4281-4294.[Abstract]
7. Courey, A. J., and S. Jia. 2001. Transcriptional repression: the long and the short of it. Genes Dev. 15:2786-2796.
8. Davie, J. K., D. G. Edmondson, C. B. Coco, and S. Y. Dent. 2003. Tup1-Ssn6 interacts with multiple class I histone deacetylases in vivo. J. Biol. Chem. 278:50158-50162.
9. Davie, J. K., R. J. Trumbly, and S. Y. Dent. 2002. Histone-dependent association of Tup1-Ssn6 with repressed genes in vivo. Mol. Cell. Biol. 22:693-703.
10. Dietrich, F. S., S. Voegeli, S. Brachat, A. Lerch, K. Gates, S. Steiner, C. Mohr, R. Pohlmann, P. Luedi, S. Choi, R. A. Wing, A. Flavier, T. D. Gaffney, and P. Philippsen. 2004. The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science 304:304-307.
11. Donze, D., and R. T. Kamakaka. 2001. RNA polymerase III and RNA polymerase II promoter complexes are heterochromatin barriers in Saccharomyces cerevisiae. EMBO J. 20:520-531.[CrossRef][Medline]
12. Edmondson, D. G., M. M. Smith, and S. Y. Roth. 1996. Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10:1247-1259.
13. Foss, M., F. J. McNally, P. Laurenson, and J. Rine. 1993. Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae. Science 262:1838-1844.
14. Gardner, K. A., J. Rine, and C. A. Fox. 1999. A region of the Sir1 protein dedicated to recognition of a silencer and required for interaction with the Orc1 protein in Saccharomyces cerevisiae. Genetics 151:31-44.
15. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.
16. Hecht, A., T. Laroche, S. Strahl-Bolsinger, S. M. Gasser, and M. Grunstein. 1995. Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: a molecular model for the formation of heterochromatin in yeast. Cell 80:583-592.[CrossRef][Medline]
17. Hill, J. E., A. M. Myers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167.[CrossRef][Medline]
18. Hoppe, G. J., J. C. Tanny, A. D. Rudner, S. A. Gerber, S. Danaie, S. P. Gygi, and D. Moazed. 2002. Steps in assembly of silent chromatin in yeast: Sir3-independent binding of a Sir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation. Mol. Cell. Biol. 22:4167-4180.
19. Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795-800.[CrossRef][Medline]
20. Kayne, P. S., U.-J. Kim, M. Han, J. R. Mullen, F. Yoshizaki, and M. Grunstein. 1988. Extremely conserved histone H4 N terminus is dispensable for growth but essential for repressing the silent mating loci in yeast. Cell 55:27-39.[CrossRef][Medline]
21. Kellis, M., B. W. Birren, and E. S. Lander. 2004. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428:617-624.[CrossRef][Medline]
22. Kimura, A., T. Umehara, and M. Horikoshi. 2002. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat. Genet. 32:370-377.[CrossRef][Medline]
23. Klar, A. J., S. N. Kakar, J. M. Ivy, J. B. Hicks, G. P. Livi, and L. M. Miglio. 1985. SUM1, an apparent positive regulator of the cryptic mating-type loci in Saccharomyces cerevisiae. Genetics 111:745-758.
24. Laurenson, P., and J. Rine. 1991. SUM1-1: a suppressor of silencing defects in Saccharomyces cerevisiae. Genetics 129:685-696.[Abstract]
25. Lee, T. I., N. J. Rinaldi, F. Robert, D. T. Odom, Z. Bar-Joseph, G. K. Gerber, N. M. Hannett, C. T. Harbison, C. M. Thompson, I. Simon, J. Zeitlinger, E. G. Jennings, H. L. Murray, D. B. Gordon, B. Ren, J. J. Wyrick, J. B. Tagne, T. L. Volkert, E. Fraenkel, D. K. Gifford, and R. A. Young. 2002. Transcriptional regulatory networks in Saccharomyces cerevisiae. Science 298:799-804.
26. Loo, S., C. A. Fox, J. Rine, R. Kobayashi, B. Stillman, and S. Bell. 1995. The origin recognition complex in silencing, cell cycle progression, and DNA replication. Mol. Biol. Cell. 6:741-756.[Abstract]
27. Luo, K., M. A. Vega-Palas, and M. Grunstein. 2002. Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast. Genes Dev. 16:1528-1539.
28. McCord, R., M. Pierce, J. Xie, S. Wonkatal, C. Mickel, and A. K. Vershon. 2003. Rfm1, a novel tethering factor required to recruit the Hst1 histone deacetylase for repression of middle sporulation genes. Mol. Cell. Biol. 23:2009-2016.
29. Meneghini, M. D., M. Wu, and H. D. Madhani. 2003. Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112:725-736.[CrossRef][Medline]
30. Min, J., J. Landry, R. Sternglanz, and R. M. Xu. 2001. Crystal structure of a SIR2 homolog-NAD complex. Cell 105:269-279.[CrossRef][Medline]
31. Pak, D. T., M. Pflumm, I. Chesnokov, D. W. Huang, R. Kellum, J. Marr, P. Romanowski, and M. R. Botchan. 1997. Association of the origin recognition complex with heterochromatin and HP1 in higher eukaryotes. Cell 91:311-323.[CrossRef][Medline]
32. Pierce, M., K. R. Benjamin, S. P. Montano, M. M. Georgiadis, E. Winter, and A. K. Vershon. 2003. Sum1 and Ndt80 proteins compete for binding to middle sporulation element sequences that control meiotic gene expression. Mol. Cell. Biol. 23:4814-4825.
33. Pijnappel, W. W., D. Schaft, A. Roguev, A. Shevchenko, H. Tekotte, M. Wilm, G. Rigaut, B. Seraphin, R. Aasland, and A. F. Stewart. 2001. The S. cerevisiae SET3 complex includes two histone deacetylases, Hos2 and Hst1, and is a meiotic-specific repressor of the sporulation gene program. Genes Dev. 15:2991-3004.
34. Rothstein, R. 1991. Targeting, disruption, replacement and allele rescue: integrative DNA transformation in yeast, p. 281-301. In C. Guthrie and G. R. Fink (ed.), Guide to yeast genetics and molecular biology, vol. 194. Academic Press, Inc., San Diego, Calif.
35. Rusche, L. N., A. L. Kirchmaier, and J. Rine. 2003. The establishment, inheritance, and function of silenced chromatin in Saccharomyces cerevisiae. Annu. Rev. Biochem. 72:481-516.[CrossRef][Medline]
36. Rusche, L. N., A. L. Kirchmaier, and J. Rine. 2002. Ordered nucleation and spreading of silenced chromatin in Saccharomyces cerevisiae. Mol. Biol. Cell 13:2207-2222.
37. Rusche, L. N., and J. Rine. 2001. Conversion of a gene-specific repressor to a regional silencer. Genes Dev. 15:955-967.
38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
39. Schmitt, M. E., T. A. Brown, and B. L. Trumpower. 1990. A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18:3091-3092.
40. Shareef, M. M., R. Badugu, and R. Kellum. 2003. HP1/ORC complex