This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morales, V.
Right arrow Articles by Becker, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morales, V.
Right arrow Articles by Becker, P. B.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, July 2005, p. 5947-5954, Vol. 25, No. 14
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.14.5947-5954.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The MRG Domain Mediates the Functional Integration of MSL3 into the Dosage Compensation Complex

Violette Morales,{dagger} Catherine Regnard, Annalisa Izzo, Irene Vetter, and Peter B. Becker*

Adolf-Butenandt-Institut, Molekularbiologie, Schillerstr. 44, 80336 München, Germany

Received 23 January 2004/ Returned for modification 13 January 2005/ Accepted 29 April 2005


arrow
ABSTRACT
 
The male-specific-lethal (MSL) proteins in Drosophila melanogaster serve to adjust gene expression levels in male flies containing a single X chromosome to equal those in females with a double dose of X-linked genes. Together with noncoding roX RNA, MSL proteins form the "dosage compensation complex" (DCC), which interacts selectively with the X chromosome to restrict the transcription-activating histone H4 acetyltransferase MOF (males-absent-on-the-first) to that chromosome. We showed previously that MSL3 is essential for the activation of MOF's nucleosomal histone acetyltransferase activity within an MSL1-MOF complex. By characterizing the MSL3 domain structure and its associated functions, we now found that the nucleic acid binding determinants reside in the N terminus of MSL3, well separable from the C-terminal MRG signatures that form an integrated domain required for MSL1 interaction. Interaction with MSL1 mediates the activation of MOF in vitro and the targeting of MSL3 to the X-chromosomal territory in vivo. An N-terminal truncation that lacks the chromo-related domain and all nucleic acid binding activity is able to trigger de novo assembly of the DCC and establishment of an acetylated X-chromosome territory.


arrow
INTRODUCTION
 
Male-specific lethality in fruit flies results from loss of function of a few genes involved in dosage compensation. Dosage compensation is a process that serves to adjust the expression levels of genes residing on the single male X chromosome to meet the expression originating from the two female X chromosomes. The five male-specific lethal proteins known to be critically involved in dosage compensation, MSL1, MSL2, and MSL3 (male-specific-lethal 1, 2, and 3, respectively), MOF (males-absent-on-the-first), and MLE (maleless) associate with the noncoding RNA roX to form the dosage compensation complex (DCC; also referred to as the MSL complex or compensasome) (4, 14, 18, 21). Due to the male-specific expression of MSL2, the complex only assembles in males, where it selectively associates with many sites on the X chromosome. This association effectively concentrates MOF, a histone acetyltransferase (HAT) with specificity for lysine 16 of histone H4 (H4K16), on the X chromosome (16, 33). According to the prevailing model, the DCC is involved in a twofold increase of transcription of X-linked genes in males (20, 34). Acetylation of H4K16 (H4K16ac) can reverse chromatin-mediated repression of transcription, and targeting MOF to a heterologous promoter in yeast leads to activation of transcription (1). The H4 N terminus is involved in folding of the nucleosomal fiber (11), and acetylation may thus modulate chromatin organization. In mammals, H4K16 acetylation also correlates with less-repressive chromatin (35). Sequestration of MOF to the X chromosome may also affect the level of autosomal gene expression globally (6). Whatever the mechanisms by which gene expression levels are adjusted in a twofold range, it is likely that essential feedback regulations are involved in fine-tuning.

Our knowledge of the molecular functions of the MSL proteins is rather limited. Each of them is required for faithful association of the DCC with the X chromosome. MSL2 is exclusively expressed in males and required for accumulation of roX RNA, an essential component of DCC (29). Interaction of MSL2 with MSL1 is a mutual requirement for interaction of the two proteins with the X chromosome and for formation of the complete DCC (9, 10, 22). MSL1 appears to be a scaffolding protein since it is able to associate not only with MSL2 but also with MOF and MSL3 (27, 32). MLE, the homolog of human RNA helicase A, appears responsible for stabilizing roX RNA and for its incorporation into DCC (26). A core complex will form in the absence of roX RNA or of any of the three RNA binding subunits MLE, MOF, or MSL3, but its association with only a subset of X-chromosomal sites does not lead to faithful dosage compensation (for review, see reference 14). Histone H4 acetylation by MOF is likely to play a crucial role in the modification of chromatin structure that regulates transcription. In addition, its acetylase activity is important for the distribution of the DCC over the X chromosome (17). The fact that MOF can acetylate MSL1 and MSL3 suggests possible involvement of nonhistone targets as well (8, 27).

MSL3 (15) contains an MRG domain, a domain found throughout eukaryotes from yeasts to humans, with as yet unknown function (5, 25). Interestingly, several members of this "MRG family" are associated with HATs in complexes known or suspected to be involved in transcriptional regulation. Prominent examples are the MSL3-relative Eaf3p, which interacts with the acetyltransferase Esa1 in the yeast NuA4 complex (13), and human MRG15, which can be found associated with the HAT Tip60 in a human complex highly related to the yeast NuA4 (12).

MSL3 interacts with roX RNA, and its association with the X chromosome is sensitive to RNase treatment (8). It can also bind DNA and chromatin and forms a salt-resistant complex with MSL1 in vitro (27). The reconstitution of a four-subunit MSL complex recently led to insight into functional interactions of MSL3 (27). Remarkably, the association of MSL3 with the C terminus of MSL1 in complex with MOF resulted in a dramatic activation of acetyltransferase activity on nucleosome substrates. At the same time, binding of MSL3 led to a refinement of substrate specificity: in the absence of MSL3, the rudimentary acetylation activity of MOF was entirely directed towards MSL1 and did not modify nucleosomes. However, in contact with MSL3, MSL1 was no longer subject to modification, but robust acetylation of nucleosomal H4 was observed. This finding led us to hypothesize the existence of a molecular "checkpoint" that serves to restrict the H4K16ac mark to the X chromosome. According to this model, association of MOF with MSL1 (27) leads to its sequestration on the X chromosome, but only completion of the DCC by incorporation of MSL3 unleashes its H4 acetylase activity. Whether the MOF that is expressed in female cells in the absence of a functional DCC has a lower activity toward histone H4 or profits from an equally forthcoming molecular environment remains to be explored.

The direct interaction of MSL3 with MOF in vitro is comparably weak and does not result in an activation of its HAT activity. Rather, the stimulatory effect of MSL3 on MOF requires simultaneous contact of MSL3 and MOF with the C terminus of MSL1 (27). Since MSL3 can bind DNA and chromatin in vitro (27), its presence in a complex with MOF may stabilize the interaction of the enzyme with the chromatin substrate. It is also possible that contact of MSL3 with MSL1 indirectly affects acetyltransferase activity through conformational changes. In order to address these possibilities, we explored the functional interactions of MSL3’s domains. Using a set of mutants that are no longer able to bind nucleic acids or MSL1, we found that the stimulation of MDF’s HAT activity, as well as targeting to the X-chromosomal territory, depends on interactions with MSL1 via the MRG signature of MSL3. In contrast, the nucleic acid binding N terminus including the chromo-related domain (CRD) was not a primary determinant of targeting MSL3 to the X-chromosome territory, nor did it contribute to stimulation of MOF's HAT activity in vitro or establishment of the accumulation of the H4K16 acetylation mark on the X chromosome in vivo.


arrow
MATERIALS AND METHODS
 
Cloning of MSL3 deletion mutants. msl3 coding sequence (amino acids 1 to 512) (fragment NdeI-HindIII) was cloned with a flag tag coding sequence fused to its 5' end (fragment BamHI-NdeI) into BamHI and HindIII sites of pFastBac1 (Invitrogen) or pGEM7z (Promega), respectively. The following deletions from the msl3 coding sequence: NdeI-NarI, NdeI-AseI, StuI-StuI, XhoI-XhoI, XhoI-StuI, and SspI-NcoI yielded the 141-512, 366-512, 1-395, 1-259, {Delta}260-393, and {Delta}328-433 constructs, respectively. Construct 270-512 was created by insertion of the msl3 XhoI-HindIII fragment into pGEM7z. Subcloning of the BamHI-BclI and BamHI-NarI inserts from Flag-MSL3-pFastBac into pFastBac1 yielded the 1-219 and 1-140 constructs, respectively. The 91-512 construct was obtained by replacement of wild-type coding sequence of msl3 (fragment NdeI-HindIII) with a PCR product bearing NdeI and HindIII sites at its 5' and 3' ends, respectively, and encompassing the msl3 sequence from codon 91 to codon 512.

Enhanced green fluorescent protein (EGFP) fusion proteins were obtained by inserting PCR products coding for full-length MSL3 or MSL3181-512 bearing 5' KpnI and 3' AgeI sites in frame with EGFP into pEGFP-1 (Clonetech) downstream of an HSP70 promoter. The sequences coding for MSL3{Delta}260-393 and MSL3{Delta}328-433 were introduced into the same vector by replacement of an NarI-HincII fragment in the wild-type construct by a NarI-HincII fragment from pGEM-(MSL3{Delta}260-393) and pGEM-(MSL3{Delta}328-433). All clones were sequenced.

Expression, purification, and functional analysis of MSL3 proteins. Baculovirus-mediated expression and the purification of flag-tagged MSL3 or mutant derivatives, as well as acetyltransferase assays on reconstituted nucleosome arrays, were performed as described previously (27).

Nucleic acid binding assay. (i) Production of DNA affinity beads. RoX2 cDNA (1,061 bp; clone 78.2.2 obtained from M. Kuroda [3]) was linearized by XbaI and BanII and immobilized on paramagnetic beads (Dynal) according to reference 31. After immobilization, part of the DNA beads was heated at 95°C for 5 min according to the manufacturer's instructions to obtain single-stranded DNA (ssDNA) on beads. The complementary strand released in the supernatant was analyzed by agarose gel electrophoresis to estimate the efficiency of the denaturation.

(ii) Production of RNA affinity beads. Sense or antisense roX2 RNAs were transcribed from either strand of the roX2 cDNA in vitro with T3 or T7 RNA polymerase (Promega) in the presence of 2.5 mM rNTPs (but 2.2 mM of UTP), 0.25 mM biotin-UTP, and 40 units of RNasin (Promega). This reaction yields RNAs that are biotinylated throughout the sequence. After 3 h of incubation at 37°C, the sample was treated with DNase (RQ1 at 10 units; Promega) and precipitated. The RNA pellet was dissolved in water. Hsp26 RNA (30) was transcribed following the same procedure.

RNA and DNA were quantified spectrophotometrically and immobilized on paramagnetic beads (Dynal) at a concentration of 10 pmol of nucleic acid for 1D mg of Dynabeads according to Sandaltzopoulos and Becker (31).

(iii) MSL3 binding assay. DNA or RNA beads were suspended at 10 ng of nucleic acids per µl in 20 mM Tris-HCl (pH 7.6), 100 mM NaCl, 0.1 mM EDTA, 1 mM MgCl2, 0.1 mg/ml bovine serum albumin, 0.05% NP-40, and 1 mM dithiothreitol. Fifty to 100 ng of immobilized nucleic acids was incubated for 10 min on ice with various MSL3 derivatives (30 to 100 ng) in a 10-µl final volume of reaction buffer, diluted to 60 µl in the same buffer, and incubated for 1 h at 4°C on a rotating wheel. For competition experiments, 150 to 500 ng of competitor DNA (unbiotinylated roX2 cDNA) or RNA (transcribed from roX2 cDNA without biotin-UTP) was added to the immobilized nucleic acids before the MSL3 proteins. The beads were then processed as described previously (27), and bound MSL3 was detected by Western blotting with an antibody obtained from M. Kuroda. Quantification of chemoluminescence (ECLplus; Amersham) was done with the Fluorchem 8900 system (Alpha Innotech).

Transfections and RNA interference. SF4 and SL2 cells were transfected with Effectene (Qiagene) according to the manufacturer's instructions. MSL3 derivatives were expressed as C-terminal EGFP fusions after transfection of Drosophila SF4 or SL2 cells, and their localization was determined as described before (27). For RNA interference (RNAi), SL2 cells were used. Double-stranded RNA (dsRNA) was prepared as described previously (23). The following gene-specific primers were used: TTAATACGACTCACTATAGGGAGAATGACGGAGCTAAGGGACGA and TTAATACGACTCACTATAGGGAGAGTTTGTCTGCCCCGGTTTC in order to obtain dsRNA corresponding to the first 500 nucleotides of MSL3. Primers TTAATACGACTCACTATAGGGAGAATGTCCCCTATACTAGGTTA and TTAATACGACTCACTATAGGGAGAACGCATCCAGGCACATTG served to produce dsRNA for glutathione S-transferase (GST). A total of 2 x 106 cells were incubated with 10 µg of dsRNA for 1 h in serum-free medium and then supplemented with serum-containing medium. After 2 days of incubation at 26°C, cells were treated for 15 min with 5 µg dsRNA and then transfected with 0.5 to 1 µg of expression vectors coding for MSL3-GFP fusion proteins. After 2 more days, the cells were immunostained with anti-MSL3 antibody (a gift of M. Kuroda) for the GST-treated cells or mouse anti-GFP antibody (Molecular Probes) for cells expressing fusion proteins. The X territory was counterstained with anti-acetyl-H4K16 (Upstate), and anti-Mof (a gift of J. Lucchesi). DNA was stained using Hoechst 33258.


arrow
RESULTS
 
Clarification of the mechanism by which Drosophila melanogaster MSL3 activates the histone acetyltransferase activity of MOF (27) requires knowledge about potential interactions of MSL3 with the nucleic acids as well as with the components of the DCC. The sequence analysis of MSL3 reveals two prominent features (Fig. 1). A CRD resides within the first 90 amino acids (7, 19). This domain deviates significantly from the canonical chromodomains known to interact with methylated histone H3 N termini and rather resembles the CRD of MOF, which is involved in RNA binding (7). In the C-terminal half of MSL3, sequences are present that relate MSL3 to the MRG protein family (5). However, whereas the MRG domain appears as a contiguous stretch of similarity in MRG15 and its closer relatives, it is fragmented by insertions in MSL3 (5). The functional significance of either the CRD or the MRG signature has not been explored so far. We therefore generated a set of MSL3 deletion mutants (Fig. 1) and tested their ability to bind nucleic acids and MSL1.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1. Schematic representation of known features of MSL3 and of the deletion mutants used in this study. The N-terminal CRD is indicated in dark gray shading; similarities to the MRG domain in the C-terminal half are shaded with lighter gray. These similarities extend approximately between MSL3 amino acids 200 and 240, 280 and 315, and 430 and 480 (5). N-terminal flag tags have been added to most derivatives, as indicated by the black bars. A summary of the observed functions is given below the constructs.

Nucleic acid binding determinants reside in the N terminus of MSL3. Previously we showed that MSL3 is able to bind DNA and RNA (2, 27), but the domains involved in this interaction were not defined. A C-terminal fragment with limited similarity to chromo-related domains was shown to bind RNA, but the affinity appeared far too low to explain the RNA binding potential of the intact protein (2). In order to analyze the interactions of MSL3 with nucleic acids, we immobilized linear double-stranded or single-stranded roX cDNA, roX sense or antisense RNA, as well as the unrelated Hsp26 RNA on paramagnetic beads. These beads were incubated with baculovirus-expressed MSL3, and bound protein was separated from unbound protein and detected by Western blotting (Fig. 2). The experiment revealed that MSL3 was able to bind to all nucleic acids, but binding to RNA and single-stranded DNA was consistently better than binding to double-stranded DNA of the same sequence and concentration (Fig. 2A). It is possible that the binding of MSL3 to RNA in comparison with ssDNA is underestimated in this experiment due to different immobilization strategies: ssDNA was immobilized by a terminal biotin group, whereas the RNA contains biotin groups throughout, which may interfere with MSL3 binding. The assay monitors only nonspecific RNA binding, since MSL3 bound different RNAs equally well. Since it is known that MSL3 binds RNA in vivo (8), we compared binding to RNA and dsDNA in a competition assay (Fig. 2B). Bound roX RNA or dsDNA was mixed with excess RNA or DNA, and the partitioning of MSL3 between bead-bound or soluble nucleic acid was monitored as before. The experiment confirms the conclusion that MSL3 binds significantly better to RNA than to dsDNA.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2. MSL3 binds to nucleic acids via its N terminus. (A) MSL3 binding to nucleic acids. Interaction of MSL3 with double-stranded roX2 cDNA (lanes 1 and 2), single-stranded roX2 DNA (lanes 3 and 4 and 15 and 16), roX2 sense or antisense (antis.) RNA (lanes 5 to 8, 11, and 12) and hsp26 RNA (lanes 9 and 10) were assayed. Thirty nanograms (odd lanes) or 90 ng (even lanes) of MSL3 was assayed for interaction with 50 ng of nucleic acids immobilized on paramagnetic beads. A control reaction with unloaded beads (ctrl. beads) reveals the level of nonspecific "sticking" of MSL3 proteins (lanes 13 and 14). After washes, 50% of bound MSL3 was analyzed by SDS-PAGE and Western blotting. The left panel (lanes 1 to 10) and right panel (lanes 11 to 16) represent two independent experiments. (B) MSL3 binds RNA preferentially over dsDNA. One hundred nanograms of MSL3 was incubated with 50 ng of either dsDNA (lanes 1 to 5) or roX sense RNA (lanes 6 to 10) immobilized on paramagnetic beads in the absence (lanes 1 and 6) or presence of 150 (lanes 2 and 7) or 500 ng of free DNA (lanes 3 and 8) or 150 (lanes 4 and 9) and 500 ng free RNA (lanes 5 and 10) and processed as described for panel A. Unloaded bead background was determined in the presence or absence of 500 ng of soluble nucleic acids and was shown to be low under our experimental conditions (data not shown). (C) MSL3 binds to RNA via its N terminus. The binding efficiencies of 90 ng of the indicated MSL3 derivatives (see Fig. 1) to 50 ng immobilized RNA are compared. Five percent of input protein and 50% of RNA-bound MSL3 derivatives were analyzed by Western blotting and the ECLplus kit (Amersham). The chemoluminescence signals were quantified with the Fluorchem 8900 system (Alpha Innotech), and the fraction of input protein bound to RNA was calculated. For the figure, the binding activity of intact MSL3 was set to 1 and all other values were normalized to this value. The bar represents the mean of two independent experiments.

In order to map the part of MSL3 that mediates binding to nucleic acids, we tested various MSL3 derivatives lacking parts of the protein (see Fig. 1) for RNA binding. The purity and integrity of these proteins were confirmed, and binding was assayed with carefully matched input concentrations (data not shown). Deletion of the N-terminal 140 amino acids (MSL3141-512), including the CRD, largely abolished the RNA binding potential of MSL3. In contrast, deletion of the C-terminal MRG sequences only slightly affected the RNA binding (Fig. 2C) (data not shown). However, an N-terminal MSL3 fragment consisting of only the first 140 amino acids, and therefore including the CRD, did not bind RNA, demonstrating that the CRD was not sufficient for RNA binding but that sequences included in the first 259 amino acids of MSL3 are critical.

In summary, the binding analysis documents that the nucleic acid binding surfaces of MSL3 reside in the N terminus of the protein and do not involve MRG sequences.

MSL3 interacts with MSL1 via the MRG domain. We previously showed that MSL3 directly interacts with the 66 C-terminal amino acids of MSL1 (27). We next investigated which part of MSL3 is involved in this interaction. We coexpressed a panel of flag-tagged MSL3 derivatives (see Fig. 3) with full-length, untagged MSL1 in Sf9 cells using the baculovirus system. The MSL3 proteins were purified from total cell extracts by flag-mediated pull-down and washed stringently. Associated MSL1 was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining (Fig. 3). Intact MSL3 and MSL3 derivatives lacking the N-terminal 140 amino acids interacted efficiently with MSL1, which was readily detected on the gel (Fig. 3, lanes 1, 4, and 5). However, deletion of any part of the MRG similarity essentially abolished MSL1. Complementary experiments monitoring the interaction of immobilized MSL1 with in vitro-translated MSL3 fragments confirmed these results (data not shown). Additional experiments also revealed that deletion of MSL3-specific sequences between the MRG similarities ({Delta}328-433) also destroyed the interaction of MSL3 with MSL1 (data not shown). In summary, the deletion analysis failed to identify a small MSL1 interaction surface in MSL3 and suggests that the three separate regions of similarity to the MRG domain contribute to folding the MSL3 C terminus into a single, large domain.



View larger version (60K):
[in this window]
[in a new window]
  		FIG. 3. Integrity of the MRG domain is required for interaction of MSL3 with MSL1. Sf9 cells were coinfected with baculoviruses encoding untagged MSL1 and flag-tagged MSL3 as indicated. After flag-mediated pull-down of MSL3 from total cell extracts and stringent washes, bound protein was eluted with competing flag peptide and analyzed by SDS-PAGE (12% polyacrylamide gel) and Coomassie blue staining. The amounts of MSL3 pulled down are a direct reflection of the levels of input protein (not shown). As a control (ctrl), an extract from Sf9 cells solely expressing MSL1 was incubated with anti-flag beads (lane 11). The migration of MSL1 is indicated to the left. The bands corresponding to the tagged MSL3 fragments are marked by asterisks. The white arrowhead to the left indicates an Sf9-derived contaminant. Size standards from bottom: 15, 20, 25, 30, 40, 50, 60, 70, 90, 100, 120, 150, and 200 kDa (lane 1).

Activation of MOF by MSL3 depends on contacts with MSL1 but not on DNA interactions. The interaction studies above led to clear separation of the structures in MSL3 required for interaction with nucleic acids and for MSL1 and allowed the design of MSL3 derivatives that lacked one function without affecting the other. Different MSL3 deletion mutants were thus tested for their potential to activate the histone H4-directed HAT activity of MOF (Fig. 4). HAT reaction mixtures contained recombinant MOF, radiolabeled acetyl coenzyme A (acetyl-CoA), nucleosome substrate, GST-tagged MSL1, and flag-tagged full-length or truncated MSL3. In the absence of MSL3, MOF activity was poor and acetylation of the proper H4 substrate was not detected (27; data not shown), whereas in the presence of intact MSL3, robust acetylation of H4 was observed (Fig. 4, lane 3). A faint band at the position of GST-MSL1 demonstrates acetylation of MSL1 in this reaction, as previously shown (27). Deletion of the CRD had no effect on MOF activity (Fig. 4, lane 6). In contrast, two independent deletions in the C terminus of MSL3 that abolish interaction with MSL1 rendered MSL3 inactive as a modulator of MOF function (Fig. 4, lanes 4 and 5). Nucleosomal H4 was no longer recognized as a substrate, and the remaining acetylase activity of MOF was directed toward MSL1. Taken together, the data suggest that MSL3 affects MOF's activity indirectly through its association with the common interaction partner and that the N-terminal CRD is not required for this activation in vitro.



View larger version (63K):
[in this window]
[in a new window]
  		FIG. 4. MSL3 has to interact with MSL1 to stimulate the HAT activity of MOF. The HAT activity of recombinant MOF (expressed in E. coli) on nucleosome substrates was analyzed in the presence of [3H]acetyl-coenzyme A alone (lane 2), or in presence of GST-MSL1 and the indicated MSL3 derivatives (lanes 3 to 6). Lane 1 shows a reaction where [3H]acetyl-coenzyme A was present, but MOF was absent. Samples were analyzed by 15% SDS-PAGE and autoradiography of the dried gel. The bands corresponding to histone H4 and GST-MSL1 are indicated.

Recruitment of MSL3 to the X chromosome depends on interaction with MSL1. Having documented separate interaction domains within MSL3 for nucleic acids and MSL1, we wished to evaluate the relevance of these interactions in vivo. In the first series of experiments, we asked whether these interactions contributed to targeting of MSL3 to the X-chromosomal territory. Male Drosophila SF4 cells were transiently transfected with vectors encoding MSL3-GFP fusion proteins, which were detected by immunofluorescence using antibodies directed against GFP. The faithful localization of MSL3-GFP to the X chromosome was concluded from the colocalization with endogenous MSL1 (Fig. 5). MSL3 still colocalized if the N-terminal 180 amino acids containing the nucleic acid binding determinant were absent, although slightly higher background staining in the nucleoplasm was observed (Fig. 5, 181-512). In contrast, proteins suffering from two internal deletions that abolish MSL1 binding did not localize at all to the X-chromosome territory. We conclude that neither interaction of MSL3 with DNA nor that with RNA is a primary determinant of MSL3 recruitment to the X chromosome. The data are consistent with the idea that MSL3 associates with the DCC mainly through a direct interaction between its MRG domain and the C terminus of MSL1.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 5. MSL3 is recruited to the X chromosome through interaction with MSL1. Drosophila SF4 cells were transiently transfected with either MSL3 or the indicated deletion mutants of MSL3, all as fusions with C-terminal GFP. Localization of the fusion proteins to the X-chromosomal territory was visualized by immunoflourescence staining for GFP (anti-GFP [{alpha}-GFP]) and MSL1 (anti-MSL1 [{alpha}-MSL1]). DNA was counterstained with Hoechst 33258 (DNA).

MSL3181-512-GFP functionally rescues a depletion of endogenous MSL3. Deletion of the N terminus of MSL3, including its CRD, does not abolish targeting to the X-chromosomal territory. This truncated MSL3 is also still able to stimulate the HAT activity of MOF in vitro. In order to assess its functionality in vivo in the absence of endogenous MSL3, we depleted SL2 cells of endogenous MSL3 by RNAi. The dsRNA we chose corresponded to the first 500 nucleotides of msl3. Because these sequences are absent from the RNA encoding the N-terminally truncated MSL3181-512, the dsRNA does not interfere with transient expression of this protein. We verified that the MSL3181-512 was able to interact with MSL1 as well as the longer MSL3141-512 derivative by pull-down experiments with in vitro-translated proteins (data not shown). As a control for nonspecific effects of dsRNA, we treated cells in parallel with dsRNA corresponding to GST, an alien protein to these cells. After 4 days of RNAi against GST, 75% of the cells exhibited a nice X-territory staining for MSL3 and the acetylated lysine 16 of histone H4 (H4K16ac) (see Table 1 and Fig. 6A and B, for example). In contrast, 4 days of RNAi against MSL3 led to loss of an X-territory staining for MSL3 and H4K16ac in 77% of the cells (Table 1 and example in Fig. 6A and B). Only 12.5% of the cells in the culture escaped from RNAi. The fact that 9.5% of the cells still show localized H4K16 acetylation although MSL3 is not detectable by immunofluorescence (Table 1) may be due to low levels of MOF and MSL3 that suffice to maintain the territory or to variability in the turnover of the modification. To test for the ability of the MSL3 derivatives to rescue the depletion of the endogenous MSL3, cells were transfected with vectors expressing MSL3, MSL3181-512, or MSL3{Delta}260-393 after 2 days of RNAi. Two days later, we monitored the X-territory staining of GFP-positive cells as before (Fig. 6C and D). All GFP-fused proteins were expressed properly after RNAi of GST (data not shown) with a transfection efficiency of about 15%. In contrast, only the MSL3181-512-GFP fusion protein was expressed after RNAi of MSL3, showing that the ds RNA corresponding to the 5' end of msl3 interfered only with expression of MSL3-GFP and MSL3{Delta}260-393-GFP.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Quantitative analysis of the experiment described in the legend to Fig. 6



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 6. MSL3181-512-GFP is sufficient to rescue the depletion of endogenous MSL3 after RNAi. (A and B) Depletion of MSL3 by RNAi. SL2 cells were treated with RNAi against GST (RNAi-GST) or MSL3 (RNAi-MSL3) and the X-chromosomal territory was stained for MSL3 (anti-MSL3 [{alpha}MSL3]) and H4K16ac (anti-H4K16ac [{alpha}K16ac]) (A) or MOF (anti-MOF [{alpha}MOF]) (B). DNA was stained with Hoechst 33258. For each immunostaining, the exposure times were identical between the experiments. (C and D) Functional rescue by expression of N-terminally truncated MSL3. Cells depleted of endogenous MSL3 were transiently transfected with MSL3181-512-GFP. Transfected cells were detected by anti-GFP staining and probed for X-chromosomal staining of H4K16ac (C) or MOF (D). Cells with a medium to low expression level of the GFP fusion and a clear enrichment on the X-territory are shown. For quantitative analysis, see Table 1.

Remarkably, most cells (68%) with a medium-to-low GFP level not only showed a clear accumulation of the MSL3181-512-GFP fusion at the X territory but also showed an obvious enrichment of MOF and H4K16ac (Fig. 6D and C, respectively). Since the percentage of H4K16ac territories was only 12.5% in the absence of MSL3181-512-GFP expression (Table 1), we conclude that the N-terminally truncated protein can functionally rescue the depletion of endogenous MSL3 to a significant degree, which shows that the nucleic acid binding properties of MSL3 are dispensable.


arrow
DISCUSSION
 
The MRG domain of MSL3 is required for MSL1 interaction. We have mapped the MSL1 interaction surface to the C-terminal half of MSL3. This part of MSL3 is characterized by similarities to the MRG domain that subsumes MRG15, MSL3, and related proteins in multiple species into the so-called MRG family (5, 25). The msl3 gene is related to the Drosophila mrg15 gene, suggesting an early gene duplication event. Accordingly, MRG sequences in MSL3 are highly conserved between D. melanogaster and Drosophila virilis (for evolutionary considerations, see references 24 and 25). The MRG domain defined by Marin and Baker (25) consists of three blocks of strong sequence similarity separated by short amino acid stretches of lesser conservation. Interestingly, these "linker" regions harbor rather long insertions in MSL3 of flies and humans. The C terminus of MSL3 may thus be organized by folding of MRG signature sequences, which are disconnected in the primary sequence (see Fig. 1), into a compact unit from which the MSL3-specific structures "loop out." Consistent with this idea, we found that every deletion in the C terminus of MSL3 compromises interaction with MSL1. Most of these deletions affect at least one of the blocks of MRG sequence similarity, most likely leading to global misfolding. However, one deletion that abolishes MSL1 binding ({Delta}328-433) selectively removed MSL3-specific sequences between two MRG blocks. There is considerable conservation of these sequences in the Drosophila species for which sequence information has recently become available (T. Straub, personal communication), suggesting a conserved function, but whether this sequence contains a dedicated MSL1 interface remains to be explored. In any case, our analysis suggests that the MRG sequence similarity reflects a functional domain. The MRG-MSL1 contact is essential for targeting MSL3 to the X-chromosomal territory, confirming the functional importance of the interactions defined in vitro. We suggest that MRG modules in other MRG family members may also constitute protein-protein interaction units.

Role of nucleic acid binding of MSL3. Our in vitro analysis showed that MSL3 interacted better with single-stranded nucleic acids than with dsDNA. The significance of ssDNA interaction, if any, is unclear at the moment. In contrast, there is evidence that MSL3 interacts with roX RNA in vivo and in vitro (2, 8), but the domain involved in RNA binding had not been defined. Our biochemical analysis demonstrated that the nucleic acid binding structures reside in the N-terminal half of MSL3, which also contains the CRD. Previously, Buscaino et al. (8) suggested that RNA interaction of MSL3 is affected by its acetylation at lysine 116, close to the CRD. In our hands, a fragment comprising the first 140 amino acids (and hence the CRD as well as K116) was not sufficient for nucleic acid binding, but sequences up to amino acid 259 contributed significantly. To what extent the CRD of MSL3 contributes to RNA binding needs to be established. The CRDs of MSL3 and MOF appear more related to each other than to canonical chromodomains. They lack the {alpha}-helix supporting the ß-sheet bundle and aromatic residues that may be involved in recognition of methylated histone N termini (7). The CRD of MOF also appears not to be sufficient for RNA binding (A. Buscaino and A. Akhtar, personal communication). A further interesting similarity between MOF and MSL3 is that nucleic acid interactions are not the primary targeting determinant for either MOF (27) or MSL3 (this work). Although impairment of the CRDs leads to somewhat increased binding of the corresponding GFP fusion protein to autosomes, their concentration on the X-chromosomal territory is still obvious. However, the CRDs and noncoding RNA may have functions that are not assayed for in simple recruitment experiments. It is also possible that the CRDs of MOF and MSL3 provide partially redundant functions for DCC assembly. In contrast, mutations in MOF or MSL3 that abrogate their interaction with the C terminus of MSL1 prevent faithful recruitment to the X chromosome. Obviously, the recruitment assay we employed may just reveal the strongest binary interaction that MSL3 or MOF are involved in. However, the fact that overexpression of an MSL3 lacking all nucleic acid binding capacity was able to complement an MSL3 deficiency and to trigger the accumulation of MOF and H4K16 acetylation on the X-chromosomal territory emphasizes the importance of the MSL protein interactions for the assembly of a functional DCC.

MSL complexes can be formed in vitro in the absence of RNA (26; A. Izzo and P.B. Becker, unpublished observations). A deficiency of roX RNA in vivo can be partially overcome by overexpression of the "platform" proteins MSL1 and MSL2 (28). It is possible that transient overexpression of MSL3 overcomes the RNA requirement and that under normal conditions of limiting MSL protein concentrations RNA is required for faithful DCC assembly.

DCC assembly may provide a checkpoint for activation of MOF. The remarkable stimulation of MOF's HAT activity upon association of MSL3 with an MSL1-MOF complex was not due to enhanced binding of MSL3 to nucleic acids but rather required contact of MSL3 with the MSL1 scaffold. MOF and MSL3 are brought into proximity by interaction with adjacent structures in the C terminus of MSL1 (27). It is possible that the MSL1 scaffold stabilizes an otherwise transient and therefore nonproductive direct contact between MSL3 and MOF (27). The existence of such a contact has been inferred from the fact that MSL3 can be acetylated by MOF (8). However, when it comes to acetylation, MSL1 is a much better substrate for MOF than MSL3 (27). The new data reinforce our previous model of an acetylation "checkpoint" built into DCC assembly. Accordingly, the regulatory potential of H4K16 acetylation would only be fully realized upon binding of MOF with MSL1 and the completion of the complex by association of MSL3 (27). Such a checkpoint would render full activation of MOF dependent on proper DCC assembly and hence "maleness" and serve to restrict the critical epigenetic mark to the X chromosome.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Training and Mobility Network grant HPRN-CT-2000-00078 from the European Union, by DFG through Transregio5, and by Fonds der Chemischen Industrie.

We thank I. Dahlsveen, G. Gilfillan, T. Straub, and the reviewers for critical reading of the manuscript and helpful discussions and T. Straub for sequence alignments. We thank M. Kuroda and John Lucchesi for MSL antibodies and A. Buscaino and A. Akhtar for unpublished information.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Adolf-Butenandt-Institut, Molekularbiologie, Schillerstr. 44, 80336 München, Germany. Phone: 49-89-2180-75428. Fax: 49-89-2180-75425. E-mail: pbecker{at}med.uni-muenchen.de. Back

{dagger} Present address: Laboratoire de Biologie Moléculaire des Eucaryotes, LBME-CNRS UMR 5099-IFR 109, Université Paul Sabatier, 118 Route de Narbonne, 31062-Toulouse Cedex, France. Back


arrow
REFERENCES
 
    1
  1. Akhtar, A., and P. B. Becker. 2000. Activation of transcription through histone H4 acetylation by MOF, an acetyltransferase essential for dosage compensation in Drosophila. Mol. Cell 5:367-375.[CrossRef][Medline]
    2. 2
  2. Akhtar, A., D. Zink, and P. B. Becker. 2000. Chromodomains are protein-RNA interaction modules. Nature 407:405-409.[CrossRef][Medline]
    3. 3
  3. Amrein, H., and R. Axel. 1997. Genes expressed in neurons of adult male Drosophila. Cell 88:459-469.[CrossRef][Medline]
    4. 4
  4. Bashaw, G. J., and B. S. Baker. 1996. Dosage compensation and chromatin structure in Drosophila. Curr. Opin. Genet. Dev. 6:496-501.[CrossRef][Medline]
    5. 5
  5. Bertram, M. J., and O. M. Pereira-Smith. 2001. Conservation of the MORF4 related gene family: identification of a new chromo domain subfamily and novel protein motif. Gene 266:111-121.[CrossRef][Medline]
    6. 6
  6. Bhadra, U., M. Pal-Bhadra, and J. A. Birchler. 2000. Histone acetylation and gene expression analysis of sex lethal mutants in Drosophila. Genetics 155:753-763.[Abstract/Free Full Text]
    7. 7
  7. Brehm, A., K. R. Tufteland, R. Aasland, and P. B. Becker. 2004. The many colours of chromodomains. Bioessays 26:133-140.[CrossRef][Medline]
    8. 8
  8. Buscaino, A., T. Kocher, J. H. Kind, H. Holz, M. Taipale, K. Wagner, M. Wilm, and A. Akhtar. 2003. MOF-regulated acetylation of MSL-3 in the Drosophila dosage compensation complex. Mol. Cell 11:1265-1277.[CrossRef][Medline]
    9. 9
  9. Chang, K. A., and M. I. Kuroda. 1998. Modulation of MSL1 abundance in female Drosophila contributes to the sex specificity of dosage compensation. Genetics 150:699-709.[Abstract/Free Full Text]
    10. 10
  10. Copps, K., R. Richman, L. M. Lyman, K. A. Chang, J. Rampersad-Ammons, and M. I. Kuroda. 1998. Complex formation by the Drosophila MSL proteins: role of the MSL2 RING finger in protein complex assembly. EMBO J. 17:5409-5417.[CrossRef][Medline]
    11. 11
  11. Dorigo, B., T. Schalch, K. Bystricky, and T. J. Richmond. 2003. Chromatin fiber folding: requirement for the histone H4 N-terminal tail. J. Mol. Biol. 327:85-96.[CrossRef][Medline]
    12. 12
  12. Doyon, Y., W. Selleck, W. S. Lane, S. Tan, and J. Côté. 2004. Structural and functional conservation of the NuA4 histone acetyltransferase complex from yeast to humans. Mol. Cell. Biol. 24:1884-1896.[Abstract/Free Full Text]
    13. 13
  13. Eisen, A., R. T. Utley, A. Nourani, S. Allard, P. Schmidt, W. S. Lane, J. C. Lucchesi, and J. Cote. 2001. The yeast NuA4 and Drosophila MSL complexes contain homologous subunits important for transcription regulation. J. Biol. Chem. 276:3484-3491.[Abstract/Free Full Text]
    14. 14
  14. Gilfillan, G. D., I. K. Dahlsveen, and P. B. Becker. 2004. Lifting a chromosome: dosage compensation in Drosophila melanogaster. FEBS Lett. 567:8-14.[CrossRef][Medline]
    15. 15
  15. Gorman, M., A. Franke, and B. S. Baker. 1995. Molecular characterization of the male-specific lethal-3 gene and investigations of the regulation of dosage compensation in Drosophila. Development 121:463-475.[Abstract]
    16. 16
  16. Gu, W., P. Szauter, and J. C. Lucchesi. 1998. Targeting of MOF, a putative histone acetyl transferase, to the X chromosome of Drosophila melanogaster. Dev. Genet. 22:56-64.[CrossRef][Medline]
    17. 17
  17. Gu, W., X. Wei, A. Pannuti, and J. C. Lucchesi. 2000. Targeting the chromatin remodeling MSL complex of Drosophila to its sites of action on the X chromosome requires both acetyl transferase and ATPase activities. EMBO J. 19:5202-5211.[CrossRef][Medline]
    18. 18
  18. Kelley, R. L., and M. I. Kuroda. 1995. Equality for X chromosomes. Science 270:1607-1610.[Abstract/Free Full Text]
    19. 19
  19. Koonin, E. V., S. Zhou, and J. C. Lucchesi. 1995. The chromo superfamily: new members, duplication of the chromo domain and possible role in delivering transcription regulators to chromatin. Nucleic Acids Res. 23:4229-4233.[Abstract/Free Full Text]
    20. 20
  20. Lucchesi, J. C. 1998. Dosage compensation in flies and worms: the ups and downs of X-chromosome regulation. Curr. Opin. Genet. Dev. 8:179-184.[CrossRef][Medline]
    21. 21
  21. Lucchesi, J. C. 1999. Dosage compensation: roX marks the spot. Curr. Biol. 9:R807-R808.[CrossRef][Medline]
    22. 22
  22. Lyman, L. M., K. Copps, L. Rastelli, R. L. Kelley, and M. I. Kuroda. 1997. Drosophila male-specific lethal-2 protein: structure/function analysis and dependence on MSL-1 for chromosome association. Genetics 147:1743-1753.[Abstract]
    23. 23
  23. Maiato, H., C. E. Sunkel, and W. C. Earnshaw. 15 June 2003, posting date. Dissecting mitosis by RNAi in Drosophila tissue culture cells. Biol. Proced. Online 5:153-161. [Online.] http://www.biologicalprocedures.com.
    24. 24
  24. Marin, I. 2003. Evolution of chromatin-remodeling complexes: comparative genomics reveals the ancient origin of "Novel" compensasome genes. J. Mol. Evol 56:527-539.[CrossRef][Medline]
    25. 25
  25. Marin, I., and B. S. Baker. 2000. Origin and evolution of the regulatory gene male-specific lethal-3. Mol. Biol. Evol. 17:1240-1250.[Abstract/Free Full Text]
    26. 26
  26. Meller, V. H. 2003. Initiation of dosage compensation in Drosophila embryos depends on expression of the roX RNAs. Mech. Dev. 120:759-767.[CrossRef][Medline]
    27. 27
  27. Morales, V., T. Straub, M. F. Neumann, G. Mengus, A. Akhtar, and P. B. Becker. 2004. Functional integration of the histone acetyltransferase MOF into the dosage compensation complex. EMBO J. 23:2258-2268.[CrossRef][Medline]
    28. 28
  28. Oh, H., Y. Park, and M. I. Kuroda. 2003. Local spreading of MSL complexes from roX genes on the Drosophila X chromosome. Genes Dev. 17:1334-1339.[Abstract/Free Full Text]
    29. 29
  29. Rattner, B. P., and V. H. Meller. 2004. Drosophila male-specific lethal 2 protein controls sex-specific expression of the roX genes. Genetics 166:1825-1832.[Abstract/Free Full Text]
    30. 30
  30. Sandaltzopoulos, R., and P. B. Becker. 1998. Heat shock factor increases the reinitiation rate from potentiated chromatin templates. Mol. Cell. Biol. 18:361-367.[Abstract/Free Full Text]
    31. 31
  31. Sandaltzopoulos, R., and P. B. Becker. 1999. A solid phase approach for the analysis of reconstituted chromatin, p. 195-206. In P. B. Becker (ed.), Chromatin protocols. Humana Press, Totowa, N.J.
    32. 32
  32. Scott, M. J., L. L. Pan, S. B. Cleland, A. L. Knox, and J. Heinrich. 2000. MSL1 plays a central role in assembly of the MSL complex, essential for dosage compensation in Drosophila. EMBO J. 19:144-155.[CrossRef][Medline]
    33. 33
  33. Smith, E. R., A. Pannuti, W. Gu, A. Steurnagel, R. G. Cook, C. D. Allis, and J. C. Lucchesi. 2000. The Drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation. Mol. Cell. Biol. 20:312-318.[Abstract/Free Full Text]
    34. 34
  34. Stuckenholz, C., Y. Kageyama, and M. I. Kuroda. 1999. Guilt by association: non-coding RNAs, chromosome-specific proteins and dosage compensation in Drosophila. Trends Genet. 15:454-458.[CrossRef][Medline]
    35. 35
  35. Vaquero, A., M. Scher, D. Lee, H. Erdjument-Bromage, P. Tempst, and D. Reinberg. 2004. Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol. Cell 16:93-105.[CrossRef][Medline]

Molecular and Cellular Biology, July 2005, p. 5947-5954, Vol. 25, No. 14
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.14.5947-5954.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Gelbart, M. E., Kuroda, M. I. (2009). Drosophila dosage compensation: a complex voyage to the X chromosome. Development 136: 1399-1410 [Abstract] [Full Text]  
  • Sun, B., Hong, J., Zhang, P., Dong, X., Shen, X., Lin, D., Ding, J. (2008). Molecular Basis of the Interaction of Saccharomyces cerevisiae Eaf3 Chromo Domain with Methylated H3K36. J. Biol. Chem. 283: 36504-36512 [Abstract] [Full Text]  
  • Izzo, A., Regnard, C., Morales, V., Kremmer, E., Becker, P. B. (2008). Structure-function analysis of the RNA helicase maleless. Nucleic Acids Res 36: 950-962 [Abstract] [Full Text]  
  • Rodriguez, M. A., Vermaak, D., Bayes, J. J., Malik, H. S. (2007). Species-specific positive selection of the male-specific lethal complex that participates in dosage compensation in Drosophila. Proc. Natl. Acad. Sci. USA 104: 15412-15417 [Abstract] [Full Text]  
  • Zhang, P., Du, J., Sun, B., Dong, X., Xu, G., Zhou, J., Huang, Q., Liu, Q., Hao, Q., Ding, J. (2006). Structure of human MRG15 chromo domain and its binding to Lys36-methylated histone H3. Nucleic Acids Res 34: 6621-6628 [Abstract] [Full Text]  
  • Smith, E. R., Cayrou, C., Huang, R., Lane, W. S., Cote, J., Lucchesi, J. C. (2005). A Human Protein Complex Homologous to the Drosophila MSL Complex Is Responsible for the Majority of Histone H4 Acetylation at Lysine 16. Mol. Cell. Biol. 25: 9175-9188 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morales, V.
Right arrow Articles by Becker, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morales, V.
Right arrow Articles by Becker, P. B.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»