Cancer Research Center at Massachusetts General Hospital and Harvard Medical School, 55 Fruit Street, Boston, Massachusetts 02114,1 Washington University School of Medicine, Division of Gastroenterology, 660 South Euclid Avenue, St. Louis, Missouri 63110,2 NIA-NIH, LCMB Box 12, 5600 Nathan Shock Drive, Baltimore, Maryland 21224,3 Department of Pediatrics, Harvard Medical School, MassGeneral Hospital for Children, Fruit Street, Boston, Massachusetts 021144
Received 20 November 2004/ Returned for modification 23 December 2004/ Accepted 2 May 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
eIF4E's transforming function is likely to be clinically significant because eIF4E is overexpressed in a variety of malignant cells and tissues (15, 16, 53, 77). One critical role for eIF4E in oncogenesis may be as the downstream effector of the akt survival pathway that collaborates with various other oncogenes (83, 103). As such, it appears to work in part by preventing apoptotic cell death (54). Whether its overexpression is a cause or an effect of malignant transformation remains an intriguing and important question. In both head and neck tumors, as well as in rare breast cancers, amplifications of the eIF4E gene have been described (37, 92). However, noncytogenetic regulatory events appear to contribute to its overexpression in colon, lung, lymphoma, and bladder cancers (77). The nature of these regulatory events remains unknown.
Despite the growing realization of its potential importance in cancer, astonishingly little is known about mechanisms that regulate levels of eIF4E (57). Numerous studies have shown its functional regulation by various signal transduction pathways and by binding to its antagonist, the 4E binding protein (reviewed in references 11 and 15). However, measurements of its quantitative levels in cells have attracted much less attention (101). Early studies that demonstrated serum and heat shock regulation of initiation factors were hampered because eIF4E levels were too low to detect in two-dimensional gels (24-26). Tissue-specific changes in eIF4E mRNA have been demonstrated in Drosophila and zebra fish (31, 39). In mammalian systems, its levels vary during epithelial differentiation and cardiocyte growth (56, 102). Our initial report that serum induces eIF4E mRNA remains a critical demonstration that transcriptional regulation of eIF4E can play an important role in its overall regulation (80). Importantly, the promoter of the eIF4E gene contains two essential E boxes that bind to, and can be regulated by, the MYC oncogene (32, 46). However, an additional site at 25 in the promoter was equally important to the function of the eIF4E promoter (45). Its position at 25, where TATA sequences would be anticipated, suggested that eIF4E might be regulated by a unique basal promoter element. To better understand the regulation of eIF4E in normal and malignant tissues, we sought to further characterize this regulatory motif that we now designate the 4E basal element (4EBE).
As in the case of eIF4E, little is known about transcriptional regulation of other translation initiation factors. The abundance of translation initiation factors eIF1 and eIF4A exceeds the abundance of ribosomal proteins; both are therefore among the most abundant proteins in the cell (26, 101). The promoters for both follow the classic paradigm of strong promoters that contain TATA sites (14, 73). The promoters for eIF2
and eIF2ß have also been analyzed in some detail. eIF2
and eIF2ß are both less abundant than ribosomal proteins. Their promoters lack TATA sequences (9, 42), and they both share a palindromic sequence (TGCGCATGCGCA) that binds nuclear respiratory factor 1 (NRF-1). NRF-1 is thought to coordinate transcriptional regulation of nucleus-encoded respiratory proteins located in the mitochondria (9, 29, 47). Also called
-palindromic binding protein (
-PAL), NRF-1 avidly binds the palindromic sequence in the eIF2
promoter (8, 29). Overexpression of NRF-1 increases eIF2
and net protein synthesis, although it actually inhibits cell division through effects on E2F1 (30). Intriguingly, NRF-1 can heterodimerize with max, and the
-PAL sequence is an alternative-binding site for Myc (4, 30, 80). Finally, an inhibitory sequence in the first intron of eIF2
functions as an initiator (INR) element, and INR elements are repressed by Myc (67, 81, 88).
Nuclear run-on experiments first demonstrated a connection between Myc and transcription of translation initiation factors eIF4E and eIF2
(80). Since then, accumulating data have linked Myc regulation to ribosomal proteins and additional translation initiation factors and thereby to growth regulation in the cell (86). The c-Myc target gene database lists 16 translation initiation factors whose potential connections to Myc regulation have been suggested (105). Evidence for this linkage comes from chromatin immunoprecipitation, loss of expression in c-myc-null cells, gain of expression in primary liver cells, and increased expression resulting from conditional increases in Myc function (32, 48, 68, 72). The best evidence for a Myc connection is still found for eIF4E and eIF2
, although the rules associating Myc with regulation of these two factors remain ambiguous (105). Although Myc does not regulate these factors in all circumstances, its regulation of translation initiation is potentially important in cancer biology because a dominant inhibitor of translation initiation blocks transformation by Myc (55).
The location of the 4EBE at the site where TATA should be found raises the possibility that it is a functional basal promoter element. Two types of cis-acting DNA elements regulate eukaryotic promoters transcribed by RNA polymerase II genes: (i) basal or core promoter elements located near or at the transcription initiation site and (ii) upstream or regulatory promoter elements that are binding sites for various transcription activators and/or repressors (40). Utilization of the TATA-binding protein (TBP) is common to promoters transcribed by all RNA polymerases (106). TBP is present in a complex called TFIID containing TBP along with various TBP-associated factors (TAFs) (28, 107, 108). Although TBP is generally required for the transcription of most genes, the identification of TBP-related factors TRF1 and TRF2 and a TBP-free, TAF-containing complex, which lacks TBP but contains TAFs, suggests that there are alternative mechanisms by which transcription may be initiated in the case of certain genes (34, 74). Additional basal promoter elements have been identified that can be distinguished from TATA. Seminal work contributed by Smale demonstrated an additional basal element spanning the transcription initiation site that was called the INR element that functions as a TATA equivalent in many TATA-less genes (90). Initiator elements are especially important in cell growth control since they were identified as the
element in the promoters of ribosomal protein genes (1, 22, 35, 84). Specific DNA-binding proteins, including YY1, TFII-I, USF, and E2F, bind initiator elements (2, 43, 44, 82).
In characterizing the eIF4E promoter, we identified protein species of 68 and 97 kDa that bound the 4EBE (45). This element, initially designated LS3 (5'-TTACCCCCCCTT), is highly conserved between mouse, rat, and human eIF4E promoters (45, 56). We first considered that this element might be a classic initiator because of its strategic location, the lack of a TATA, and its pyrimidine richness. However, the element did not cross-compete with known initiator sequences, was not transactivated by YY1, and was not supershifted by antibodies to any known initiator-binding proteins in electrophoretic mobility shift assay (EMSA) experiments (45). Although C-rich it also did not bind SP1 because SP1 oligonucleotides did not cross-compete for binding and an antibody to SP1 did not supershift complexes in EMSA experiments (45). Here we examine the role of this element, which we now designate the 4EBE. We report that this sequence functions as a basal promoter element in reporter gene experiments and binds the transcription factor hnRNP K that is known to interact with TBP (62). We go on to demonstrate that overexpression of hnRNP K causes an eIF4E-dependent cellular transformation that synergizes with Myc, identifying a new regulatory interaction that could play a role in human malignancies overexpressing eIF4E.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
The expression plasmids pCEP4 (Invitrogen empty vector control [hygromycin selectable]), pCEPmyc (human Myc driven by cytomegalovirus), and pCEP4EBPµ(a constitutive dominant-inhibitory form of the 4E binding protein that blocks eIF4E function) were described previously (55). pcDNA-hnRNP K was created by using the cDNA for hnRNP K from an Image Clone purchased from Invitrogen that was then cloned into pcDNA3.1 (Invitrogen; G418 selectable) by using NotI and XhoI restriction sites. An hnRNP K retroviral expression vector was constructed by cloning the hnRNP K cDNA into the pBABE-puro vector by using an EcoRI-XhoI fragment from pcDNA-hnRNP K.
Terminal oligopyrimidine (TOP) reporter plasmids, including rpL32-green fluorescent protein (GFP) and a mutant rpL32-GH containing a C
A mutation in its cap to eliminate TOP function were a generous gift from O. Meyuhas (96).
Cells, transfections, and chloramphenicol acetyltransferase (CAT) assays. HeLa cells were obtained from the American Type Culture Collection, Manassas, Va. Adherent cells were grown in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum (FCS), antibiotics and L-glutamine. HO15 (myc/) and TGR (myc+/+) cells were obtained from John Sedivy (59) and were also grown in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, antibiotics, and L-glutamine. Rat 1A cells were isolated for their susceptibility to transformation in one step by Myc (93) and were obtained from Chi Dang.
For CAT assays, exponentially growing HeLa cells were transfected in 100-mm dishes by using standard calcium phosphate coprecipitations (85). Briefly, HeLa cells were transfected with 10 µg of CAT reporter plasmid and 2 µg of pSVtkhGH plasmid as internal control. Cells were fed with fresh medium 24 h after transfection and harvested for CAT activity 48 h posttransfection by a standard assay (46). The CAT activity in each case was normalized to human growth hormone levels in the media, as determined by using a commercial radioimmunoassay kit (Nichols Institute) according to the manufacturer's instructions. Transfections were typically performed in duplicate and repeated three times.
Rat1A cells were transfected by using Lipofectin reagents (Gibco-BRL) with pCEP4, pCEPmyc, and pCEP-4EBPµ, respectively, together with either pcDNA3.1 or pcDNA-hnRNP K as indicated in individual figure legends. Pooled transfectants were selected in the presence of 500 µg of Geneticin and 200 µg of hygromycin/ml. Since all colonies expressed the transfected proteins due to the double selection applied to all transfections, pooled transfectants were used in all studies.
Packaged retroviruses expressing hnRNP K or a GFP control were made with the EcoPac retroviral packaging vector; 293T cells were cotransfected with either pBABE-GFP or pBABE-hnRNP K by using standard calcium chloride techniques. Subconfluent HO15 cells were infected with 50% viral supernatants. Two days after infection, puromycin was added at a concentration of 2 µg/ml to select for infected cells, and puromycin selection was continued throughout the remainder of the experiment. After expansion, HO15 cells carrying either pBABE-GFP or pBABE-hnRNP K were seeded in 35-mm plates and allowed to become confluent. They were then serum starved for 48 h; half of the plates were stimulated with 10% fetal bovine serum for 20 h. DNA synthesis was measured by addition of [3H]thymidine (1 µCi of 50 mCi/mmol; MP Biomedicals) for the last 2 h of serum stimulation and is plotted as the mean and standard deviation for three determinations per condition. Cells were harvested by using a previously described method (75). Additional cells were expanded into 100-mm plates for polysomal analysis by the method described below.
For hnRNP K siRNA experiments, proliferating TGR or HO15 cells were transfected with 10 nM scrambled control duplex oligonucleotide (Dharmacon, Inc.) containing sense 5'-GCGCGCUUUGUAGGAUUCGtt-3' and antisense 5'-CGAAUCCUACAAAGCGCGCtt-3'. These transfections were compared to 10 nM small interfering RNA (siRNA) for hnRNP K (Hrpk_1 siRNA; Ambion, Inc.) containing sense 5'-GGAACAAGCCUUUAAAAGAtt-3' and antisense 5'-UCUUUUAAAGGCUUGUUCCtc-3'. Transfections were accomplished by using Oligofectamine (Invitrogen, Inc.) according to the manufacturer's instructions. mRNA and protein were harvested after 48 h and analyzed for the expression of hnRNP K and eIF4E as described below.
Additional siRNAs were used to block eIF4E expression in Rat1A cells. Proliferating Rat1A cells were transfected with 50 nM concentrations of the following siRNA duplexes from Ambion, Inc.: siRNA ID 56229 E1 sense (GGAUGGUAUUGAGCCUAUGtt), E1 antisense (CAUAGGCUCAAUACCAUCCtt); and siRNA ID 56139 E2 sense (GGUGGGCACUCUGGUUUUUtt) and E2 antisense (AAAAACCAGAGUGCCCACCtg). The cells were then compared to a nontargeting siRNA duplex for luciferase containing the following sequences (Dharmacon): nontargeting siRNA #2 sense, 5'-UAAGGCUAUGAAGAGAUACUU-3'; nontargeting siRNA #2 antisense, 5'-PGUAUCUCUUCAUAGCCUUAUU-3'.
These experiments were performed by using the same conditions as for the hnRNP K experiments. Protein was harvested after 48 h and analyzed for eIF4E and actin protein as described below. These siRNAs were then transfected into Rat1A cells expressing hnRNP K and transferred into soft agar after 48 h. Soft agar colony formation was evaluated 8 days later.
Protein purification and monitoring by Southwestern analysis. Nuclear extracts were prepared from at least 108 of HeLa cells growing in monolayer culture by a modification of the Dignam method (19, 20, 65). The extraction buffer was composed of 0.5% deoxycholate, 1% octyl-ß-glucoside, 20 mM HEPES (pH 7.9), 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 0.5 mM dithiothreitol (DTT), and 25% glycerol. The initial crude extract was dialyzed overnight against hydrophobic exchange column buffer [1 M (NH4)2SO4, 20 mM HEPES (pH 7.2), 100 mM KCl, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT]. The precipitate resulting from dialysis against the 1 M (NH4)2SO4 was removed by centrifugation at 14,000 rpm for 5 min in a microcentrifuge. The supernatant was loaded on a phenyl Sepharose column and eluted by using a 1 to 0 M (NH4)2SO4 gradient over 10 column volumes. Then, 1-ml fractions were collected and the positive fractions were identified by using aliquots from the fractions in Southwestern analyses as described below. The positive fractions were dialyzed overnight in monoS column loading buffer (50 mM NaCl, 10 mM HEPES [pH 7.4], 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 0.2 mM PMSF). The loading preparation was cleared by centrifugation, and positive fractions were identified by Southwestern analysis after elution from the monoS column with a 50 to 500 mM NaCl gradient. The monoS-positive fractions were pooled and dialyzed overnight against affinity binding buffer (50 mM NaCl, 5 mM MgCl2, 20 mM HEPES [pH 7.4], 1 mM DTT, 1 mM EDTA, 0.2 mM PMSF, 5% glycerol). Affinity binding to a 1.2 mM concentration of a biotinylated 4EBE trimeric double-stranded oligonucleotide (CTAGATTCCTCTTACCCCCCCTTCTTCCTCTTACCCCCCCTTCTTCCTCTTACCCCCCCTTGG) was performed at 4°C for 20 min in the presence of 0.4 µg of salmon sperm DNA/µl. Next, we added 100 µl of streptavidin beads, and binding continued for an additional 6 h at 4°C with gentle mixing with continuous rotation. The streptavidin beads were then washed extensively with the affinity binding buffer and spun gently, and the bound material was eluted by boiling in standard Laemmli loading buffer. This preparation was run on a 10% denaturing polyacrylamide gel, and a single protein band was identified at 68 kDa by using colloidal blue staining.
Southwestern analyses were performed essentially as described previously (38, 89, 94, 100). Nuclear extracts (50 µg) from the indicated cell types were run on 10% denaturing polyacrylamide gels, electroblotted to nitrocellulose for 12 h, and allowed to dry. The filters were then immersed for 10 min in denaturation-renaturation buffer containing 6 M guanidine hydrochloride. Partial renaturation of immobilized proteins was effected by five successive incubations of the filters in buffer containing progressive (twofold) dilutions of guanidine hydrochloride and finally in buffer lacking the denaturant. Filters were blocked with 5% nonfat dry milk in binding buffer (50 mM Tris [pH 7.5], 50 mM NaCl, 1 mM EDTA, 1 mM DTT) and were then washed twice with 0.25% nonfat dry milk in binding buffer. Filters were hybridized in binding buffer containing Klenow-labeled LS3 trimer oligonucleotide probe, 0.25% nonfat dry milk, and 1 µg of sonicated salmon sperm DNA per ml for 60 min at room temperature. Filters were then washed three times with binding buffer containing 0.25% nonfat dry milk alone and dried.
Recombinant gst-hnRNP K was purified by using standard methods from extracts of Escherichia coli transformed with pGEX-hnRNP K generously provided by David Levens (85, 98).
DNA-binding assays.
HeLa nuclear extracts were obtained and analyzed by using published methods (19, 97). Gel shift activity for 4EBE binding proteins was determined in EMSA binding buffer (25 mM Tris [pH 7.5], 50 mM NaCl, 1 mM EDTA, 200 mM glycine, 0.1% Tween 20, 0.55 mg of bovine serum albumin/ml, 10% glycerol) with 2 ng of poly(dI-dC)/µl as a nonspecific competitor. Complexes formed in binding buffer were resolved on a 4% nondenaturing polyacrylamide gel containing 0.5x TBE (0.045 M Tris-borate [pH 8.0], 0.5 mM EDTA) at 4°C. After labeling with [
-32P]ATP with polynucleotide kinase, oligonucleotides were purified by polyacrylamide gel electrophoresis. Each binding reaction contained between 0.1 to 0.5 ng of labeled oligonucleotide. Competition experiments were performed by using the indicated molar excess of unlabeled oligonucleotides. Oligonucleotide sequences are provided in the relevant figures.
Chromatin immunoprecipitation assays. We evaluated TGR cells during logarithmic growth, at confluence after 72 h in the absence of serum to arrest the cells, and 8 h after serum was added to the growth-arrested cells. Cells grown on 150-mm diameter plates were harvested and resuspended in growth medium. Cross-linking was performed by adding fresh 37% formaldehyde to a final concentration of 1.5%, followed by incubation at room temperature for 15 min with gentle agitation. The reaction was stopped by adding glycine to a final concentration of 0.125 M, followed by incubation for 5 min. Cells were collected by centrifugation at 1,500 x g for 5 min; the pellet was washed twice with ice-cold phosphate-buffered saline (120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer [pH 7.4]), washed twice with immunoprecipitation buffer (IP buffer; 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% NP-40, 50 mM Tris-HCl [pH 7.5], 0.5 mM DTT), and then resuspended with IP buffer supplemented with 0.5% sodium dodecyl sulfate (SDS) and protease inhibitor cocktail (Roche). Sonication was performed by Branson Sonifier 250 with a microtip at output 6 with 10-s bursts until the desired DNA fragment sizes were reached. The lysate was then subjected to centrifugation at 12,000 x g for 10 min. The supernatant was collected and diluted at least fivefold with IP buffer. For immunoprecipitation, antibody was added to the lysate, followed by incubation at 4°C for 1 h with agitation. Protein A-Sepharose beads (Amersham) were added to the mixture and further incubated for 1 h. The beads were collected by centrifugation at 1,500 x g for 30 s, washed twice with IP buffer, twice with high-salt IP buffer (500 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% NP-40, 50 mM Tris-HCl [pH 7.5], 0.5 mM DTT), washed twice with stringent wash buffer (10 mM Tris-HCl [pH 7.5], 0.25 M LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA), and washed twice with TE buffer (10 mM Tris-HCl, 0.1 mM EDTA). The bound fraction was eluted by incubating the beads in elution buffer (TE with 1% SDS) at 65°C for 10 min. The cross-links were reversed by incubating the eluate at 65°C for at least 6 h. Samples were treated with proteinase K at 37°C for 1 h, phenol-chloroform extracted, and ethanol precipitated. The following primer sets were used in PCRs: pair 1, c-myc promoter (TACTCTACTCCAGCTCTGGAACG, forward) and c-myc promoter (ACCTACGACAGATGAGGTCTGAG, reverse); pair 2, nontranscribed locus AC120715 (ACCAGCCAGTCAGAGTTCAGG, forward) and nontranscribed locus AC120715 (GGTTTCATCATCCCGAGAC, reverse); pair 3, eIF4E promoter (CTCCACTTCCCAGAAGCCTCTTG, forward) and eIF4E promoter (CGGTTCCACAGTCGCCATCTTAG, reverse); and pair 4, 5S rRNA genes (GTCTACGGCCATACCACCCT, forward) and 5S rRNA genes (AAAGCCTACAGCACCCGGTA, reverse). Aliquots of the samples were assayed by PCR at 95°C for 30 s, 59°C for 45 s, and 72°C for 30 s for 35 cycles and then fractionated on an agarose gel.
Expression analyses for mRNA and protein.
Levels of expression of myc, hnRNP K, eIF4E, and actin mRNAs were analyzed by using total cellular RNA from the indicated transfectants that was size fractionated (10 µg/lane) on formaldehyde agarose gels, transferred to Hybond-N nylon matrices, and cross-linked by using UV light (10). Filters were hybridized in a rapid hybridization solution (Rapidhyb; Amersham) at 65°C with c-myc, hnRNP K, eIF4E, or actin cDNA fragments
32-P labeled by the Klenow reaction by using random priming. For Western analyses, cells were lysed in Laemmli loading buffer. A total of 10 µg of protein sample was subjected to SDS-10% polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membrane. Membranes were hybridized with anti-hnRNP K (sc-25373; Santa Cruz), anti-eIF4E (BD610270; Becton Dickinson), anti-Myc (SC41; Santa Cruz), or anti-actin (MAB1501R; Calbiochem) as indicated and detected by enhanced chemiluminescence (Amersham). For RNA blots of the polysomal and subpolysomal fractions, RNA was extracted from the polysomal and subpolysomal fractions by using TRIzol reagent, and 50% of the harvested RNA was analyzed by using standard RNA blotting techniques (85).
Polysomal profile analysis. One 100-mm diameter plate containing the indicated stable Rat1A transfectants was harvested for each polysomal analysis. Confluent transfectants were harvested and lysed in 300 µl of RSB (10 mM NaCl, 10 mM Tris-HCl [pH 7.4], 15 mM MgCl2) containing 100 µg of heparin/ml, 1.2% Triton X-100, and 0.12% deoxycholate (60, 96). Nuclei were pelleted for 3 min in a microcentrifuge at 4°C. The 300-µl extract was layered over 11.5 ml of a 15 to 45% (wt/wt) sucrose gradient with a 0.5-ml cushion of 45% sucrose. The gradients were centrifuged at 37,000 rpm for 2.5 h in an SW 41 (Beckman) rotor at 4°C. After centrifugation, the A260 was continuously monitored and recorded across the gradient.
For the polysomal rpL32 transient reporter experiments, Rat 1A cells were transfected in 100-mm plates with plasmids carrying either the 5'-untranscribed region of rpL32-GFP or the same untranscribed region lacking the consensus 5'-terminal oligopyrimidine element designated rpL32(1C>A)-GH. Transfected cells were grown to confluence for 72 h, and during the last 24 h cells were grown in medium lacking serum. For RNA blots of the polysomal and subpolysomal fractions, RNA was extracted from the polysomal and subpolysomal fractions by using TRIzol reagent, and 50% of the harvested RNA was probed for the GFP or GH cDNAs in the reporter genes by standard RNA blotting techniques (49).
Cell characterization. Protein content per cell was determined by lysis of a known number of cells in ELB lysis buffer and measurement of the protein content of an aliquot of these lysates by using a kit from Bio-Rad.
Subconfluent transfectants were labeled with 10 µM bromodeoxyuridine cell-labeling reagent (Amersham Pharmacia) for 30 min and harvested for cell cycle analysis. Cells were fixed in 80% ethanol for at least 1 h, incubated in anti-bromodeoxyuridine antibody (Becton Dickinson) for 30 min and exposed to anti-mouse-fluorescein secondary antibody (Vector Labs) for 30 min. Cells were resuspended in propidium iodide (70 µg/ml) supplemented with RNase A (25 µg/ml) and analyzed. DNA content was measured by using a FACScan cytometer (Becton Dickinson). The mean and standard error were determined for each cell type in two repetitions of experiments with three independent assays per cell type.
Clonogenicity of the Rat1A transfectants in soft agar was performed as described previously (93). For the eIF4E siRNA experiments, Rat1A cells expressing hnRNP K were transfected with the nontargeting siRNA #2 from Dharmacon, and the two siRNAs for eIF4E from Ambion; untransfected control Rat1A cells expressing hnRNP K were included in the analysis of soft agar clone formation. Transfection was allowed to proceed for 48 h when the cells were treated with trypsin and replated in the soft agar. Colony numbers were scored 8 days later. For the pCEP4EBPµ experiments, cells were transfected for 48 h and then placed in selection medium for an additional 48 h. They were then transferred to soft agar and colonies were scored 14 days later.
| RESULTS |
|---|
|
|
|---|
4EBE supports activated transcription. We next evaluated the potential for 4EBE to support activated transcription by placing two binding sites for the activator Sp1 about 10 bases upstream of either TATA or 4EBE in the E1bCAT plasmid. As shown in Fig. 2B, both TATA and 4EBE can mediate Sp1-activated transcription, although TATA-mediated Sp1 transcription was stronger than 4EBE-mediated Sp1 transcription. Mutating the 4EBE element (5'-TTACCCCCCCTT to 5'-TTTTTCCTTTTT) resulted in a dramatic decrease in transcription activity similar to the absence of 4EBE or TATA. These results demonstrated that 4EBE could mediate transcriptional activity of the upstream activator Sp1 in transient-transfection reporter gene assays. TATA appeared more efficient in its ability to mediate activation by Sp1 when the binding sites for Sp1 were placed in relatively close proximity to TATA and was in general a stronger basal promoter element than 4EBE at this distance.
Effect of spacing between TATA/4EBE and upstream activators on transcription. Gene expression is regulated by interactions between the trans-acting factors that bind various cis-acting DNA elements in the promoter of a gene. The spacing of cis-acting elements in a promoter plays an important role in determining the ability of the trans-acting factors to interact with each other. In order to test the effect of spacing on the interactions between 4EBE and various upstream activating sequences, we placed two binding sites for Sp1 10 or 30 bases upstream of the TATA or 4EBE in the E1bCAT plasmid and four E-box elements 10 or 43 bases upstream of the E1bTATA or 4EBE (Fig. 2D). As predicted, both E1bTATA and 4EBE interacted best with Sp1 when Sp1 binding sites were close to the TATA or 4EBE. Although the optimal spacing between basal elements and E-boxes is not known, we chose 43 bases because 4EBE is 43 nucleotides from the proximal E-box element in the native eIF4E promoter. As shown in Fig. 2D, both TATA and 4EBE mediated transactivation by E-box binding proteins, but 4EBE was most active when separated from the E-box by its native spacing interval.
The poly(C)-binding transcription factor hnRNP K binds to the 4E-binding element. We purified proteins binding to the 4E-binding element by using a three-step purification procedure that is described in the methods section and included a DNA affinity step (Fig. 3). Purification was monitored by using Southwestern analysis. As the first step, hydrophobic exchange column chromatography through a 1 to 0 M (NH4)2SO4 gradient provided a significant enrichment for the 68-kDa band revealed by Southwestern analysis (Fig. 3A). As a second step, either anion-exchange chromatography or cation-exchange chromatography yielded very similar results (Fig. 3B) and could be used interchangeably. A final DNA affinity step yielded a single protein band at 68 kDa (Fig. 3C), which was identified as the poly(C)-binding transcription factor by microsequencing of the isolated protein band (Fig. 3D). hnRNP K binds a C-rich CT element in the promoter of the c-myc gene and has been shown to transactivate through binding to polypyrimidine tract DNA elements (36, 62, 95, 98). We generated a gst-hnRNP K fusion protein and found that this purified hnRNP K binds 4EBE (Fig. 3E).
|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We had previously demonstrated the required role of the 4EBE by using loss-of-function studies. We therefore evaluated its potential function as a dominant expression element by comparing it to TATA sequences that it appears to replace. This is especially important because basal promoter elements determine the range of transcriptional activators that regulate individual promoters (13). The regulation of eIF4E levels in the cell represents a particular physiologic challenge because the range of normal expression levels of eIF4E is very narrow. With the exception of mRNAs that use internal ribosomal entry sites, eIF4E is required for translation initiation of nearly all mRNAs. It must therefore be expressed ubiquitously in all cells at some undefined minimum level. In contrast, as little as a threefold increase in eIF4E levels is sufficient to derepress translation of at least a subset of mRNAs that can transform cells to a malignant phenotype (7, 91).
Using standard reporter gene analyses we show here that the 4EBE can function like TATA to drive reporter gene expression, and its activity can be enhanced by either SP1 or E-box elements (Fig. 2). Our reporter experiments do not eliminate the possibility that the 4EBE might also be functioning to bind a classic transcriptional activator. Further in vitro studies will be required to prove this point, but our reporter gene studies make 4EBE an interesting candidate to be an additional basal control element (40). The simple structure of the eIF4E promoter now includes a required E-box element and a promoter element that appears to replace TATA. To better understand this simple form of regulation, we then sought to identify the factor(s) that might bind to the 4EBE.
We identified hnRNP K as a candidate 4EBE binding protein by using standard protein purification methodology. Known interactions of hnRNP K with other promoters, especially c-myc, make it an especially interesting candidate eIF4E regulatory factor. eIF4E is a candidate myc target gene (86), and hnRNP K is one of the most important transcriptional controls of the c-myc promoter (36, 62, 95, 98). The coincidence of hnRNP K regulation of both myc and eIF4E promoters, together with the candidate role of myc in regulating eIF4E, would suggest that complex combinatorial interactions between myc and hnRNP K could be especially important in controlling eIF4E levels. Indeed, we initially showed that the eIF4E regulatory factor increases in cells in direct relationship to myc levels, as might be expected if this factor can regulate myc or is regulated by myc (45). Michelotti et al.'s demonstration that hnRNP K directly interacts with the TBP (62) fits our demonstration that the 4EBE is a core promoter element in the eIF4E promoter. Using EMSAs, additional reporter gene experiments and chromatin immunoprecipitation we demonstrated that the polypyrimidine track in the 4EBE functioned like that in the myc promoter and that both elements functioned identically as DNA-binding elements (Fig. 4 to 6).
We then transfected hnRNP K singly and together with Myc to assess the functional significance of hnRNP K as a 4E regulatory factor (Fig. 7). eIF4E mRNA levels increased in response to hnRNP K in pooled, selected transfectants overexpressing hnRNP K. Moreover, this increase was further augmented if both myc and hnRNP K were transfected into the cells. We then identified a siRNA that could knock down hnRNP K protein levels. In siRNA knockdown experiments we used TGR cells that are an immortalized diploid rat cell line so that we might also evaluate hnRNP K loss in the corresponding myc-null isolate (HO15) (59). Transient transfection of an hnRNP K siRNA markedly inhibited hnRNP K protein levels and decreased eIF4E mRNA levels 48 h after transfection. The loss of eIF4E expression in response to loss of hnRNP K might be an indirect effect of the parallel myc knockdown in myc wild-type cells since hnRNP K is known to regulate c-myc. We therefore repeated these experiments in myc-null cells. The hnRNP K knockdown had less effect on eIF4E mRNA levels in the myc-null cells, either due to a change from myc dependence in the TGR cells where the siRNA also affected eIF4E regulation by c-myc or because they are slower growing and therefore harder to optimally transfect. Nevertheless, we again saw decreases in eIF4E mRNA 48 h after introduction of the hnRNP K siRNA.
We have previously shown that eIF4E leads to preferential effects on mRNAs that regulate cell division over those that regulate cell growth as one potential explanation for its ability to transform cells (78, 79). This appears to be a mechanism through which cell growth can be coordinated with cell division. We would predict that an eIF4E regulatory factor should phenocopy some effects of eIF4E itself. We therefore first compared transformation by eIF4E to hnRNP K and found that hnRNP K was a somewhat more potent transforming agent at similar levels of eIF4E (Fig. 8A and B). hnRNP K overexpression also caused the same kinds of changes in cell proliferation patterns as those seen for eIF4E because its overexpression led to a decreased proportion of cells in the G1 phase of the cell cycle and accelerated entry into S phase (Fig. 8C and D).
hnRNP K is a multifunctional protein known to translationally repress several mRNAs (5), especially those involved in erythrocyte differentiation (33, 69). For example, the DICE element in the 15-lipoxygenase mRNA is silenced by hnRNP K in actively proliferating erythroid precursors. Our findings suggest that, in contrast, hnRNP K should actually enhance translation initiation through increased eIF4E. To resolve these apparent differences, we analyzed global translation initiation rates in hnRNP K-overexpressing cells by using polysomal profiles. We compared the amounts of mRNA in polysomal versus nontranslating fractions in Rat 1A and myc/ cells expressing increased amounts of hnRNP K to control cells (Fig. 9A and B). hnRNP K expression caused a clear shift toward increased mRNAs in the polysomal fraction that is actively translating mRNA. We also assessed the effect of hnRNP K on a 5'TOP reporter construct (Fig. 9C), which also showed enhanced translation initiation through a generalized enhancement of translation initiation. Thus, hnRNP K globally stimulates translation initiation, as one would expect of a factor that regulates eIF4E. Its repression of the DICE element is likely therefore a narrower function unique to that mRNA. We have shown that loss of eIF4E function has more effect on mRNAs regulating cell division than cell growth by effects on cell size and protein content (55). We therefore compared the cellular protein content of cells overexpressing either hnRNP K or eIF4E and found similar effects on cellular protein content; our findings were again consistent with the idea that both of them enhance expression of mRNAs involved in cell division in preference to those controlling cell growth (Fig. 9D).
Finally, we assessed the significance of eIF4E regulation by hnRNP K as a potential contributor to eIF4E's role in malignancy. Averaged over four experiments, hnRNP K more efficiently transformed cells than equivalent amounts of eIF4E expressed on its own (Fig. 8B). However, blocking eIF4E activity blocked transformation by hnRNP K by using two different methods to inhibit eIF4E (Fig. 10). Thus, although eIF4E is certainly not the only target of hnRNP K that functions in its ability to transform cells, it is an important one.
Taken together, our data strongly suggest that hnRNP K is a likely candidate eIF4E regulatory factor (4ERF). Purification of hnRNP K by 4EBE binding, demonstration of in vitro-synthesized hnRNP K binding to the 4EBE, demonstration that 4EBE binding is identical to myc CTE binding, regulation of endogenous eIF4E levels by altering hnRNP K levels, and similar cellular behavior of cells overexpressing hnRNP K and eIF4E are all most consistent with this view.
hnRNP K is more abundant than most typical transcription factors, and it affects nearly every step in transcription and translation (5). Moreover, it is an unusual transcription factor since it also binds to single-stranded DNA (ssDNA) and single-stranded RNA. Its functions as a candidate transcription factor need to be interpreted in this light. Its binding to TBP is consistent with our proposal that it could act to recruit TBP to the 25 region of the eIF4E promoter. In this view, the 4EBE likely functions as the equivalent of a basal promoter element. In contrast, the presence of a transactivation domain in the hnRNP K N terminus is more consistent with the view that hnRNP K might be acting as another activating protein, although the transactivation domain in hnRNP K is relatively weak (62, 98). Perhaps the most intriguing possibility is that hnRNP K acts indirectly to promote melting of promoter regions by virtue of its preferential binding to ssDNA (97). In this view, hnRNP K acts as a structural activating protein that regulates DNA conformation to promote transcription (6). Such ssDNA binding properties would allow hnRNP K to act on its own without requiring interactions with other parts of the transcription apparatus. ssDNA binding proteins are known to relieve the torsional stress of transcription and so enhance the rate of transcription by this alternative mechanism (50). Although we observed ssDNA binding by hnRNP K to the 4EBE in the eIF4E promoter, it was not as strong as was described for the myc CT-element by the Levens group. Clarification of the relative importance of these three mechanisms to hnRNP K's regulation of eIF4E will require additional exploration of all three mechanisms. Other proteins are also known to bind similar single-stranded polypyrimidine tracks, including several that bind to polypyrimidine elements in the c-myc promoter, and most function both as transactivators and to regulate DNA conformation (64). Any of these additional proteins are potential additional or alternative eIF4E regulatory factor candidates that will require additional future assessments. These proteins include the far upstream sequence binding protein (23), the Pur proteins (3, 87), the cellular nucleic acid binding protein (63), and myc single-stranded proteins (66). Finally, the nature of the 97-kDa protein that we originally identified remains unknown from these initial purification studies (45).
Overexpression of hnRNP K produced changes in global translation initiation rates, suggesting the possibility that the polypyrimidine sequence in the eIF4E promoter might be a unifying regulatory motif for additional translation initiation factors. This would be a particularly interesting result, given how little we understand mechanisms by which translation initiation factor synthesis might be coordinated. To evaluate this possibility, we inspected the proximal promoter regions of all 38 human translation initiation factors and found that eight additional promoters contained polypyrimidine stretches analogous to the sequence in eIF4E (Fig. 11). All nine polypyrimidine stretches were conserved in human, mouse, and rat genomes. All fell within 20 nucleotides of either the transcription initiation site or the translation initiation codon. Moreover, the location of c-Myc binding sequences within 10 to 500 bp of these polypyrimidine stretches in nearly all of these same promoters suggests that the E-box-polypyrimidine combination in the eIF4E promoter could be a regulatory motif that might regulate additional translation initiation factors.
|
| ACKNOWLEDGMENTS |
|---|