![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, August 2005, p. 6521-6532, Vol. 25, No. 15
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.15.6521-6532.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Johnson and Johnson Pharmaceutical Research and Development, San Diego, California
Received 1 December 2004/ Returned for modification 3 February 2005/ Accepted 6 May 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation and blocked IL-1ß-induced IL-6 as well as lipopolysaccharide- and CpG-induced tumor necrosis factor alpha production in multiple cellular systems. Mechanistically, we provide evidence that IRAK1c functions as a dominant negative by failing to be phosphorylated by IRAK4, thus remaining associated with Tollip and blocking NF-B activation. The presence of a regulated, alternative splice variant of IRAK1 that functions as a kinase-dead, dominant-negative protein adds further complexity to the variety of mechanisms that regulate TIR signaling and the subsequent inflammatory response. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B (NF-B), p38 kinase, and c-Jun N-terminal kinase (JNK), eventually leading to gene transcription and induction of an inflammatory response (1). The IRAK family of serine-threonine kinases consists of four members: IRAK1, IRAK2, IRAKM, and IRAK4 (1, 6). Despite significant structural homology between family members, they also have distinct functional roles in signal transduction. Both IRAK1 and IRAK4 exhibit kinase activity, while IRAKM and IRAK2 lack this activity (6). IRAKM functions as an induced negative regulator (13), and IRAK2 appears to be partially redundant for IRAK1 (21). Both human and mouse IRAK4 deficiency results in nonresponsiveness to a broad panel of TIR family ligands (19, 22). Although the importance of kinase activity remains controversial, IRAK1 deficiency results in a partial defect in TIR activation, with substantial decreases in IL-1, IL-18, and lipopolysaccharide (LPS) responsiveness (11, 12).
Upon ligand activation of TIR family members, IRAK4 and IRAK1 are recruited to the receptor complex (1). At the receptor, IRAK1 associates with Tollip, MyD88, and TRAF6, and phosphorylation by IRAK4 triggers IRAK1 autophosphorylation (10, 15, 17). IRAK1 hyperphosphorylation results in disassociation from Tollip and release from the receptor-MyD88 complex (2, 10). This leads to the formation of a new protein complex consisting of hyperphosphorylated IRAK1 and TRAF6, a prerequisite for TRAF6-mediated NF-B activation and induction of an inflammatory response (14).
TIR signal transduction is regulated by multiple mechanisms to prevent tissue damage that arises from sustained inflammation. IRAK1 is one of the most receptor-proximal kinases and thus is regulated by multiple mechanisms. IRAKM is an induced regulator that is proposed to block IRAK4 activation and subsequent IRAK1 phosphorylation (13). IRAK1 hyperphosphorylation results in a decrease in protein stability, providing a potential mechanism to regulate IRAK1 activity (27). Alternative splicing is another mechanism by which a single gene can generate multiple, functionally distinct protein products. A splice variant of a key adapter protein in the TIR pathway, MyD88, can regulate signaling by serving as a dominant negative (8). Furthermore, several IRAK1 splice variants have been described in both humans and mice. IRAK1b, a splice variant found in humans, lacks 90 bp arising from the use of an alternative 5' acceptor splice site in exon 12 of the gene (9). IRAK1b lacks kinase activity and exhibits a prolonged half-life (9). IRAK1s, a splice variant found in the mouse, is generated by a novel splice acceptor site in exon 12 of the murine gene resulting in a frameshift and generation of a premature stop codon (28). Although IRAK1s is kinase dead, it constitutively activated the NFB and JNK pathway.
Here, we report the identification of a novel IRAK1 splice variant, IRAK1c, which lacks a region encoded by exon 11 of the gene. IRAK1c can be detected in different tissues and cell lines and is the exclusive form of IRAK1 expressed in brain. IRAK1c lacks kinase activity and potently suppresses activation by both IL-1ß and Toll receptor ligands. IRAK1c can be recruited to the IL-1 receptor upon activation, but IRAK1c is not phosphorylated by IRAK4 and thus cannot disassociate from the adapter proteins MyD88 and Tollip, resulting in a block in NF-B activation and cytokine production. Furthermore, unlike IRAK1 or the point mutant IRAK1-KD (where KD indicates a kinase-dead point mutation), IRAK1c is unable to reconstitute the IL-1ß-driven IL-6 production in IRAK1–/– fibroblasts. The identification of an inducible, dominant-negative splice variant of IRAK1 highlights a novel mechanism by which TIR receptor signaling and the inflammatory response can be regulated.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The following antibodies were used: anti-FLAG tag and mouse monoclonal anti-actin (Sigma); anti-myc tag (Covance); anti-Tollip mouse monoclonal (Alexis); rabbit polyclonal anti-IRAK1, mouse monoclonal anti-TRAF6, rabbit polyclonal anti-IL-1R, rabbit polyclonal anti-IB
, and rabbit polyclonal anti-p-cJUN (Santa Cruz Biotechnology); rabbit polyclonal IRAK4 (Upstate Biotechnology); and rabbit polyclonal anti-IRAK1 as previously described (12).
RNA and RT-PCR. Human tissue RNA and cDNA were from BD Biosciences. RNA from tissue culture cells was extracted using RNeasy (QIAGEN) according to the manufacturer's instructions including a DNase digestion (QIAGEN). cDNA was prepared using Superscript II (Invitrogen). Reverse transcription-PCR (RT-PCR) primers were designed to specifically recognize the IRAK1 splice variant by bridging exons 10 and 12. The specific forward primers for IRAK1c (GACCAAGTATCTGGTGTACGAGAG) and IRAK1 (GACCAAGTATCTGAAAGACCTGGTG) were used with a common reverse primer (TCAGCTCTGAAATTCATCACTTTC) from a 26-cycle RT-PCR. Control amplification primers for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were from Promega. PCR products were separated on agarose gels and visualized after ethidium bromide staining.
Expression constructs and stable transfection. cDNAs were amplified using a GC-Rich PCRx system (Invitrogen). Amplification primers for IRAK1, IRAK2, IRAK4, TRAF6, MyD88, and Tollip were derived from the GenBank database. Myc, hemagglutinin (HA), and FLAG tags were introduced by PCR, and coding sequences were cloned into pCDNA3.1 or pFASTBac (Invitrogen). Purified recombinant HIS-IRAK4 for in vitro kinase assays was made using insect Sf9 cells and purified using affinity chromatography. Kinase-inactive IRAK1 and IRAK1c clones were generated by PCR containing the point mutation K239S. Glutathione transferase (GST)-IRAK1 exon 11 was generated by PCR subcloning into pGEX4T3, and GST protein was purified using glutathione beads (Amersham) after a 6-h induction with IPTG (isopropyl-ß-D-thiogalactopyranoside). For retroviral vectors, coding sequences were cloned into MscvPuro (BD Biosciences), and retrovirus was produced in the provided 293 packaging cell line. Stable transfectants of G292, THP-1, and IRAK1–/– fibroblasts cells were derived by continuous selection in puromycin (Sigma), with tagged protein expression verified by immunoblotting and intracellular staining.
Immunoprecipitation and immunoblotting. Cells were untreated or treated with IL-1ß and either lysed in a Triton-containing lysis buffer (0.5% Triton X-100, 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM NaF, 1 mM Na3VO4, 20 µM aprotinin, 1 mM phenylmethylsulfonyl fluoride [PMSF]) or a sodium dodecyl sulfate (SDS)-containing RIPA lysis buffer (1% TX-100, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM NaF, 1 mM Na3VO4, 20 µM aprotinin, 1 mM PMSF). Lysates were clarified by centrifugation at 14,000 x g for 10 min at 4°C. For immunoprecipitations, cell extracts were incubated with 5 µg of antibody for 2 h, followed by a 1-h incubation with 20 µl of protein G-Sepharose beads (Amersham Biosciences). After incubation, the beads were washed four times with lysis buffer, separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to Immobilon-P membranes (Millipore), and analyzed by immunoblotting as previously described (20).
In vitro kinase assay.
Cell lysis and immunoprecipitations were done in kinase lysis buffer (50 mM HEPES, pH 7.9, 20 mM MgCl2, 1% TX-100, 1 mM NaF, 1 mM Na3VO4, 20 mM gylcerol-2-phosphate, 5 mM p-nitrophenyl-phosphate, 1 mM dithiothreitol, 1 mM PMSF). Immunoprecipitates were incubated in kinase buffer (20 mM Tris, pH 7.5, 20 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 20 mM gylcerol-2-phosphate, 20 mM p-nitrophenyl-phosphate, 25 nM IRAK4, 1 mM dithiothreitol, 2 µg of maltose binding protein [MBP] substrate, 20 µM ATP, and 10 µCi of [
32-P]ATP) for 20 min at 32°C. For GST substrate reactions, 3 µg of each GST substrate was included. Reactions were stopped by the addition of 3x SDS-PAGE sample buffer. Samples were subjected to SDS-PAGE and transferred to Immobilon-P membranes, and the proteins were visualized and quantified by autoradiography using a Typhoon 8600 Variable Mode Imager (Amersham Biosciences).
Reporter gene assays and cytokine ELISAs.
For the NF-B reporter assay, 293 or G292 cells were seeded in 24-well plates and transfected with the indicated reporter and expression plasmid using Fugene-6 (Roche). pHTS-NF-B-luciferase plasmid was used to measure NF-B-dependent gene activation (Biomyx Technology). The cells were lysed in Glo lysis buffer and analyzed using the Bright Glo Luciferase assay system (Promega). For detection of secreted tumor necrosis factor alpha (TNF-) and IL-6 protein, THP-1 cells (1 x 104 cells/well), G292 cells (3 x 104 cells/well) or murine fibroblasts (1 x 104 cells/well) were incubated overnight in 96-well plates and stimulated for 4 h with LPS or for 6 h with IL-1ß as indicated. For TLR9 stimulations, cells were stimulated with 1 µM GpC control (gggggACGATCGTCggggg) or the CpG 2216 stimulatory oligodeoxynucleotide (gggggAGCATGCTggggg) synthesized by GenBase (uppercase and lowercase letters indicate phosphodiester-linked and phosphorothioate-linked nucleotides, respectively). Supernatants were collected and analyzed for TNF- or IL-6 using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Transfection of 293 cells with expression vectors encoding myc-tagged IRAK1c followed by immunoprecipitation with anti-IRAK1 and anti-myc tag antibodies revealed that the splice variant was expressed as a protein of approximately 68 kDa (Fig. 1C, top panel). To confirm the expression of IRAK1c at the protein level, we analyzed lysates obtained from two independent human brain samples. When compared to 293 cells transfected with IRAK1c, lysate prepared from whole brain exhibited strong expression of IRAK1c with minute or undetectable IRAK1 expression (Fig. 1C, bottom panel). In contrast, the monocytic human cell line THP-1 predominantly expressed IRAK1 with minimal IRAK1c detected. Taken together, these results indicate that IRAK1c is an alternatively spliced variant of IRAK1 that is broadly expressed in many tissues and is the major form of IRAK1 expressed in the brain.
IRAK1c lacks kinase activity and cannot be phosphorylated by IRAK4. Exon 11 of the IRAK1 gene (Fig. 1A), which is missing in IRAK1c, encodes a 79-amino-acid region corresponding to the C terminus of the kinase domain (see Fig. S1 in the supplemental material). To directly determine whether IRAK1c retained kinase activity, 293 cells were transfected with expression vectors encoding various myc-tagged IRAK1 proteins including a K239S kinase-dead IRAK1 point mutant (IRAK1-KD), IRAK1c, a K239S kinase-dead IRAK1c point mutant (IRAK1c-KD), or the empty vector. An in vitro kinase assay was performed with the anti-myc immunoprecipitates from transfected cell lysates using myelin basic protein as a substrate. IRAK1 overexpressed in 293 cells was constitutively active, as seen by autophosphorylation as well as phosphorylation of the MBP substrate (Fig. 2A, lane 1). In contrast, IRAK1c exhibited no kinase activity, as did the two kinase-dead point mutants IRAK1-KD and IRAK1c-KD. These data indicated that the region encoded by exon 11 of the IRAK1 gene, which is absent in IRAK1c, is required for kinase activity.
|
Based upon recent reports of the sequential activation of IRAK1 (14), we wanted to test whether IRAK4 could mediate the initial phosphorylation of IRAK1c. To test this, we performed in vitro kinase assays using immunoprecipitates from cells transfected with IRAK1, IRAK1-KD, IRAK1c, and IRAK1c-KD expression vectors that were incubated in the presence of recombinant purified IRAK4 (Fig. 2B). When these immunoprecipitates were incubated with recombinant IRAK4, we were able to detect a phosphorylated band that corresponded to IRAK1-KD (Fig. 2B, lane 2). Interestingly, neither IRAK1c nor IRAK1c-KD showed any phosphorylation in the presence of IRAK4 (Fig. 2B, lane 3 and 4). Based upon these data, we hypothesized that the IRAK1c splice variant is not phosphorylated by IRAK4 and thus is unable to become fully activated.
It remains possible that this finding could be due to the inability of IRAK1c to associate with IRAK4. To address this hypothesis, we tested the ability of IRAK4 to associate with the various IRAK1 proteins in this assay. A second set of anti-myc immunoprecipitates, which were subjected to an in vitro kinase assay in the presence of recombinant IRAK4, were washed with lysis buffer and immunoblotted with an anit-IRAK4 antibody. When the IRAK4 associated with IRAK1 (Fig. 2C, top panel) was quantified and corrected for IRAK1 protein expression (Fig. 2C, middle panel), we found that both IRAK1 and IRAK1-KD had similar levels of association with IRAK4 (Fig. 2C, bottom panel). However, both IRAK1c and IRAK1c-KD showed a 45% decrease in association with IRAK4. Since activated IRAK1 is targeted for degradation (27), IRAK1 expressed in 293 cells, which is kinase active, exhibits a pronounced gel shift and lower protein levels when compared to IRAK1-KD, IRAK1c, and IRAK1c-KD (Fig. 2C, middle panel).
Although the known IRAK4 phosphorylation sites in IRAK1 are not contained in the 79-amino-acid stretch comprising the missing exon 11 in IRAK1c (14), we wanted to test this experimentally. We generated a GST fusion protein consisting of exon 11 (GST-ex11) and subjected it to an in vitro kinase assay with recombinant human IRAK4. Although IRAK4 was able to mediate robust phosphorylation of a MBP substrate, no phosphorylation was detected with a GST control protein or GST-ex11 (Fig. 2D). These data suggested that the missing exon 11 of IRAK1c did not contain a previously undescribed IRAK4 phosphorylation site.
IRAK1c strongly associates with TIR family signaling proteins. Previous studies have demonstrated that IRAK1 forms homodimers as well as heterodimers with other IRAK family members (25). To test whether IRAK1c could form a homodimer with IRAK1 or a heterodimer with IRAK2, 293 cells were transfected with HA-tagged IRAK1c and myc-tagged IRAK1 or IRAK2. Immunoblot analyses of coimmunoprecipitated proteins revealed that IRAK1c formed homodimers with IRAK1 as well as heterodimers with IRAK2 (Fig. 3A).
|
B (4). Myc-tagged IRAK1 proteins were expressed alone or with FLAG-tagged MyD88, Tollip, and TRAF6 in 293 cells. FLAG-tagged proteins were immunoprecipitated, separated by SDS-PAGE, and immunoblotted with anti-myc antibody to detect coimmunoprecipitated IRAK1 proteins (Fig. 3B). As previously reported (15), IRAK1 expressed in 293 cells is autophosphorylated and rapidly degraded (Fig. 3B, third panel). Due to this lower level of IRAK1 protein expression, a short exposure indicated that kinase-dead IRAK1 associated strongly with the adapter proteins MyD88 and Tollip, as well as TRAF6, compared to wild-type IRAK1 (Fig. 3B, top panel). However, a longer exposure revealed that IRAK1, expressed at lower levels in these cells, did indeed associate with MyD88, Tollip, and TRAF6 (second panel). Interestingly, IRAK1c was found to behave similarly to IRAK1-KD and strongly associated with MyD88, Tollip, and TRAF6 (Fig. 3B, compare lanes 4 to 6 with lanes 7 to 10). Tollip is the adapter protein that is preassociated with IRAK1 and is responsible for recruiting IRAK1 from the cytosol to the receptor (2). The ability of IRAK1c to strongly associate with Tollip suggested that IRAK1c is recruited to the receptor complex upon ligand activation. It also indicated that the missing exon 11-encoded region in IRAK1c does not perturb the association of IRAK1 with MyD88, Tollip, and TRAF6. IRAK1c is recruited to the IL-1R and associates with endogenous MyD88, Tollip and TRAF6 after TIR activation. Although our previous experiment suggested IRAK1c can be recruited to the IL-1R, we wanted to experimentally test this hypothesis. To examine ligand-induced receptor association, we used G292 cells, a human osteosarcoma cell line that is strongly IL-1ß responsive. To study the effects of IRAK1c, we generated stable G292 cell lines overexpressing myc-IRAK1, myc-IRAK1-KD, or myc-IRAK1c by retroviral transduction. Cells were either left unstimulated or stimulated with IL-1ß, and lysates were prepared. Immunoprecipitation of IL-1R followed by anti-myc immunoblotting revealed that IRAK1 was recruited to the receptor in an activation-dependent manner (Fig. 4A). As previously reported, IRAK1-KD associated with the receptor in a manner similar to IRAK1 (10), and IRAK1c was also recruited to the IL-1R upon treatment with IL-1ß.
|
Since our overexpression studies in 293 cells had indicated that IRAK1c could associate with MyD88 and TRAF6, we also tested the ability of IRAK1c to associate with these key proteins in this activation-driven cellular system. Anti-myc immunoprecipitates were immunoblotted with either an anti-MyD88 or an anti-TRAF6 antibody (Fig. 4C). Like wild-type IRAK1, both IRAK1-KD and IRAK1c associated with MyD88 and TRAF6, supporting previous data that the lack of IRAK1-KD and IRAK1c kinase activity does not affect association with MyD88 and TRAF6 at the receptor complex (10). Based upon these results, we hypothesized that because IRAK1c cannot be phosphorylated by IRAK4 and lacks kinase activity, it therefore cannot disengage from the receptor complex containing Tollip, MyD88, and TRAF6 and thus would fail to activate downstream signaling that results in NF-B activation.
IRAK1c expression blocks NF-B activation.
To initially test the effect of IRAK1c on TIR signaling, we used a luciferase reporter to assay NF-B activation in 293 cells triggered by the inflammatory cytokine IL-1ß. To confirm the validity of the assay, a MyD88 expression vector was transfected resulting in high levels of NF-B activation, even in the absence of IL-1ß stimulation (Fig. 5A). Transfection of IRAK1 or IRAK1-KD in 293 cells activated a NF-B-luciferase reporter, and this activity was enhanced upon IL-1ß stimulation (Fig. 5A). These results are consistent with previous reports (16) and suggest that kinase activity of IRAK1 may not be crucial for activation of downstream signaling pathways such as NF-B. However, no NF-B-luciferase activity was detected in IRAK1c-transfected cells (Fig. 5A); furthermore, NF-B activity induced by IL-1ß treatment was suppressed by IRAK1c overexpression. Similar effects were observed with the IRAK1c-KD-transfected cells. This negative effect of IRAK1c was dose dependent, as demonstrated in transfection studies with a titration of IRAK1c (Fig. 5C). To ensure that these observed effects were not cell line specific, the same experiment was repeated using G292 cells, an osteosarcoma cell line that is highly IL-1 responsive. Unlike 293 cells (data not shown), G292 cells are fully competent and respond to IL-1ß stimulation by producing proinflammatory cytokines like IL-6. In G292 cells, IRAK1c also functioned as a potent negative regulator that blocked IL-1ß-induced NF-B activation in a dose-dependent manner (Fig. 5C). Interestingly, when we compared the ability of IRAK1, IRAK1-KD, IRAK1c, and IRAK1c-KD to modulate NF-B-luciferase activity in G292 cells, we found that an IL-1-responsive cell line like G292 did not behave like 293 cells. Unlike the 293 cell system, overexpression of IRAK1 or IRAK1-KD did not result in NF-B activation in the absence of IL-1 stimulation (Fig. 5A and B). Upon IL-1 stimulation, G292 cells transfected with IRAK1 showed enhanced NF-B activity, but those transfected with IRAK1-KD did not show an overall increase compared to vector-transfected cells (Fig. 5B). These results suggested that the role of IRAK1 and IRAK1-KD can vary depending on the cell type used. However, in the case of IRAK1c, both cell types indicated that the distinct functional role of IRAK1c as a negative regulator is not merely due to the lack of kinase activity.
|
B activation in a dose-dependent manner (Fig. 5D). These data suggested that IRAK1c functioned as an inhibitor of TIR signaling upstream of TRAF6 and did not affect signaling events downstream of TRAF6.
IRAK1c blocks IL-1ß-induced NF-B and MAPK activation.
Our previous findings using transfected 293 or G292 cells and a NF-B-luciferase assay (Fig. 5A to D) suggested that IRAK1c blocked NF-B activation. In order to specifically examine signaling events upstream of NF-B activation, we stimulated IRAK1–/– murine embryonic fibroblasts that had been reconstituted with IRAK1, IRAK1-KD, and IRAK1c and prepared lysates directly in sample buffer. Immunoblot analysis with an anti-IB antibody indicated that while both IRAK1 and IRAK1-KD could activate the NF-B pathway as demonstrated by IB degradation, IRAK1c-reconstituted cells exhibited a block in this pathway (Fig. 5E, top panel). Similar results were obtained when we examined the mitogen-activated protein kinase (MAPK) pathway by assaying JNK activation using a phospho-specific antibody to the JNK substrate cJUN. While IRAK1 and IRAK1-KD cells stimulated with IL-1ß showed robust p-cJUN, IRAK1c cells showed a dramatic block in cJUN phosphorylation (Fig. 5E, middle panel). Together, these data indicated that cells expressing IRAK1c could not activate the NF-B or MAPK pathways, suggesting that IRAK1c might function as an inhibitor of TIR receptor-triggered inflammation.
IRAK1c blocks IL-1ß and LPS-induced IL-6 and TNF- production.
The most potent biological effect triggered upon TIR receptor activation and signaling through IRAK1 is the release of mediators of the inflammatory response such as IL-6 and TNF- (1). To study the effects of IRAK1c on cytokine production, we tested the ability of IRAK1c to block the production of inflammatory cytokines. 293 cells, although commonly used to study the early biochemical events of TIR receptor and IRAK signal transduction, are not TIR responsive. Extensive analysis of 293 cells indicated that IL-1ß stimulation of 293 cells did not lead to the production of inflammatory cytokines such as TNF- or IL-6 or chemokines such as IL-8 (data not shown). However, G292 cells are sensitive to TIR receptor stimulation and produce both cytokines and chemokines upon IL-1ß treatment. Using the stably transduced G292 cell lines, we examined the ability of IRAK1, IRAK1-KD, and IRAK1c to modulate production of the proinflammatory cytokine IL-6 upon IL-1ß stimulation. Overexpression of IRAK1 resulted in a statistically significant increase in IL-6 production (Fig. 6A). Consistent with our NF-B-luciferase data (Fig. 5B), IRAK1-KD overexpression did not enhance IL-6 production (Fig. 6A). Furthermore, IRAK1c functioned as an inhibitor that significantly decreased IL-6 production when compared to vector-transduced cells (P < 0.05).
|
(Fig. 6B); TNF- production is significantly decreased in THP-1 cells that overexpress myc-IRAK1c. This effect was also observed in THP-1 cells overexpressing an HA-tagged or untagged IRAK1c (data not shown). Similar results were obtained when THP-1 cells were stimulated with the TLR9 ligand, CpG (Fig. 6C). These data indicated that the IRAK1c splice variant not only blocked NF-B activation but also significantly decreased production of inflammatory cytokines like TNF- upon activation of several TIR family members. Consistent with our findings using G292 cells, IRAK1 enhanced LPS- and CpG-induced TNF- production, while IRAK1-KD showed no change compared to vector-transfected cells (Fig. 6 B and C). Since IRAK1 can homodimerize, the preceding experiments are performed in the presence of endogenous IRAK1. In order to obtain a clear understanding of the functional role of IRAK1c, we decided to use murine embryonic fibroblasts derived from wild-type and IRAK1–/– mice (KO). Using KO cells reconstituted with IRAK1, IRAK1-KD, and IRAK1c, we examined the role of the various IRAK1 proteins by assaying IL-1ß-induced IL-6. The genetic ablation of IRAK1 (KO) results in a significant decrease in IL-1ß-induced IL-6 when compared to control wild-type cells (Fig. 6D). Reconstitution of the KO cells with either IRAK1 or IRAK1-KD rescues this defect, suggesting that kinase activity itself is not required for the role of IRAK1. However, reconstitution of these cells with IRAK1c did not rescue the defect in IL-6 production. These data suggested that although IRAK1c, like a point mutant IRAK1 (IRAK1-KD), lacks kinase activity, the missing 79 amino acids comprising exon 11 play a pivotal role in the function of IRAK1.
IRAK1c expression can be induced in human macrophages and dendritic cells. Previous studies of TIR family signaling molecules have indicated that expression of regulatory proteins can be induced. A negative regulator of the IRAK kinase family, IRAKM, is specifically induced in macrophages upon LPS stimulation (13). A splice variant of the adapter protein MyD88 was also induced by LPS treatment in human monocytes (7). To test whether IRAK1c is inducible, we purified monocytes and prepared dendritic cells from peripheral human blood. Cells were then stimulated with LPS, and RNA was prepared for RT-PCR analyses of IRAK1 versus IRAK1c expression. Although dendritic cells express lower levels of IRAK1 when compared to macrophages, both macrophages and dendritic cells exhibited inducible expression of IRAK1c upon LPS stimulation (Fig. 7A). As has been previously reported, we also observed a slight decrease in IRAK1 expression upon LPS stimulation in macrophages (29). In order to confirm that these RNA changes were reflected by changes in protein levels, lysates were prepared from monocytes and dendritic cells stimulated for 12 h with LPS. IRAK1 immunoblot analysis indicated that IRAK1 protein is degraded upon activation, while IRAK1c protein is induced in both monocytes and dendritic cells (Fig. 7B). These data suggest that, together with inducible regulators like IRAKM, the splice variant IRAK1c can function as a regulator to suppress or fine-tune signaling downstream of TIRs.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Unlike two other reported IRAK1 splice variants that utilize the alternative splice acceptor sites of exon 12 (9, 28), the IRAK1c transcript that we identified and characterized lacks a region of 79 amino acids that are encoded by exon 11. However, this splicing does not cause any frameshift changes in the region encoded by the downstream exons 12, 13, and 14. The missing portion of IRAK1c is in the C-terminal region of the IRAK1 kinase domain. This region is highly enriched with charged amino acid residues and could potentially form an accessible binding interface. Although all of these IRAK1 variants lack kinase activity (9, 28), IRAK1c is distinct from the other variants in that it functions as an inhibitor of TIR-induced inflammation. Similar differential roles of splice variants have also been recently reported for murine IRAK2 (5).
In order to functionally characterize IRAK1c, we transfected IRAK1c in multiple cellular systems and studied the resulting effects on different TIR ligand-mediated signaling events and inflammatory cytokine induction. The 293 human embryonic kidney epithelial cell line is a convenient system utilized by many research groups to study the early biochemical events of TIR signal transduction. Using 293 cells transfected with a NF-B-luciferase reporter, we showed that IRAK1c had a distinct inhibitory effect on NF-B activation compared to IRAK1 and the kinase-dead point mutant IRAK1-KD. However, 293 cells are poorly responsive to TIR ligands and do not produce proinflammatory cytokines. We therefore turned to three other cell types that are competent in responding to TIR ligands. Using IL-1ß-stimulated G292 osteosarcoma cells and LPS- or CpG-stimulated THP-1 monocytic cells, we observed that IRAK1c expression significantly suppressed NF-B activation and the induction of inflammatory cytokines such as IL-6 and TNF-. The dominant-negative effect of IRAK1c was upstream of TRAF6 as it could be rescued by TRAF6 overexpression. Furthermore, we generated fibroblast cell lines from IRAK1–/– mice and wild-type controls. IRAK1–/– fibroblasts are defective in IL-1-induced IL-6 production (12). Transfection of IRAK1–/– cells with IRAK1 or IRAK1-KD could reconstitute the IL-1 response of these cells with activation of NF-B and MAPK pathways and induction of IL-6. However, the splice variant IRAK1c could not rescue this defect, either in signaling or in cytokine production. These findings suggest that the naturally occurring IRAK1c splice variant, which lacks 79 amino acids and has no kinase activity, functions as an inhibitory protein and is distinct from the kinase-dead point mutant IRAK1-KD or an IRAK1 whole kinase domain deletion mutant that has been reported to behave similarly to IRAK1-KD (10). This result indicates that the lack of kinase activity alone is not the key factor for the negative regulatory role of IRAK1c. Other functional roles are apparently missing in the IRAK1c splice variant due to the deletion of the 79-amino-acid region.
Given the negative regulatory role of the IRAK1c splice variant, we attempted to dissect the mechanism by which it functioned. We showed that IRAK1c could dimerize with IRAK1 or IRAK2. IRAK1c associated with Tollip in resting cells and was recruited to the receptor complex upon activation. IRAK1c interacted with MyD88 and the key NF-B-activating protein TRAF6 but had a decreased association with IRAK4. Furthermore, IRAK1c is not phosphorylated by IRAK4. More importantly, IRAK1c cannot terminate its association with Tollip at the receptor complex. Since the kinase-dead point mutant IRAK1-KD had similar defects in disengaging from Tollip yet did not block NF-B activation or cytokine induction, it seems that the prolonged Tollip association cannot fully explain the distinct dominant-negative effect observed for IRAK1c but not for IRAK1-KD. It remains possible that other unidentified signaling proteins may interact with IRAK1 via exon 11, which is missing in IRAK1c. Alternatively, loss of the charged exon 11 might mask binding sites in IRAK1c and prevent formation of an optimal protein complex at the receptor. We therefore hypothesize that a change in the formation of a receptor complex mediated by IRAK1c could account for the functional defects observed upon expression of IRAK1c.
One key event upon IRAK1 recruitment to the receptor complex is the phosphorylation of IRAK1 by IRAK4 (1). Our studies indicated that while both IRAK1 and IRAK1-KD could serve as substrates for recombinant human IRAK4, IRAK1c could not be phosphorylated by IRAK4. This could be due to a loss of IRAK4 phosphorylation sites that are located in the region missing in IRAK1c. This possibility was excluded since this region expressed as a recombinant protein did not serve as a substrate for IRAK4. However, it is still possible that the lack of this region destabilizes the conformation of the IRAK1c kinase domain and thus masks the IRAK4 Thr209 phosphorylation site. Furthermore, the decreased IRAK1 and IRAK4 association that we observed may also contribute to this defect. In conclusion, the striking feature of IRAK1c that we identified is that it can no longer be phosphorylated by IRAK4.
Previous reports have indicated that IRAK1 forms homodimers and heterodimers with other IRAK family members such as IRAK2 (25). IRAK1 dimers are associated with the adapter protein Tollip in the cytosol at resting state (2, 10). Upon activation, Tollip-IRAK1 is recruited to the TIR receptor complex and interacts with the key adapter protein MyD88 and the NF-B-activating protein TRAF6 (10). At the receptor, IRAK1 dimers are phosphorylated at Thr209 by IRAK4, resulting in a conformational change of the kinase domain (14). This leads to phosphorylation of Thr387 in the activation loop of IRAK1 and triggers autophosphorylation on several residues in the ProST region located between the death domain and kinase domain (14). When IRAK1 is hyperphosphorylated, it disassociates from the receptor protein complex of MyD88 and Tollip (3, 10). IRAK1 continues to associate with TRAF6, eventually triggering activation of the NF-B pathway. Based on our biochemical studies, we proposed a model to explain the mechanism by which IRAK1c exerts its dominant-negative effects on TIR signaling (Fig. 8). In resting cells, IRAK1c dimerizes with IRAK1 or IRAK2 and associates with Tollip. Upon TIR activation, IRAK1c is recruited to the receptor complex and interacts with MyD88 and TRAF6 in a manner similar to IRAK1 and IRAK1-KD. However, unlike IRAK1, IRAK1c cannot be phosphorylated by IRAK4 and does not have kinase activity to undergo autophosphorylation. Furthermore, IRAK1c does not terminate its association with Tollip at the receptor complex, a prerequisite for further activation of the downstream NF-B and MAPK signaling cascades. Due to the functional defects of IRAK1c, it eventually leads to shutdown of TIR-mediated signaling and a decrease in inflammatory mediator production.
|
, another key kinase in the inflammatory pathway, was recently reported to down-regulate the NFB pathway (26).
Our studies have highlighted that alternative splicing is one of the mechanisms utilized in cells to regulate the proinflammatory signaling cascade triggered by TIRs. The key adapter protein in TIR signaling, MyD88, has been reported to generate an alternative splice variant, MyD88s, which negatively regulated NF-B activation (8). Expression of splice variants seems to be a strategy used by the IRAK family to regulate TIR response. Two splice variants of IRAK1 have been reported, although endogenous protein expression of these variants has yet to be demonstrated (9, 28). Furthermore, a recent paper reported four alternatively spliced variants of the murine IRAK2 gene (5). Interestingly, splice variants of the IRAK family seem to be species specific, probably reflecting a mechanism established late in evolution. All IRAK2 splice variants are found only in the mouse (5). IRAK1s is only found in the mouse, while IRAK1b is found both in mouse and human (9, 28). To date, we have been unable to clone an IRAK1c splice variant from mouse tissues or cell lines. These differences in splice variants between mouse and humans, together with other differences in expression of TLRs themselves, suggest that multiple differences in the TLR system, including both receptors and signaling molecules, contribute to the differences observed between the innate immune systems of mice and humans (18).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Burns, K., J. Clatworthy, L. Martin, F. Martinon, C. Plumpton, B. Maschera, A. Lewis, K. Ray, J. Tschopp, and F. Volpe. 2000. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2:346-351.[CrossRef][Medline]
3. Burns, K., S. Janssens, B. Brissoni, N. Olivos, R. Beyaert, and J. Tschopp. 2003. Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197:263-268.
4. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, and D. V. Goeddel. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383:443-446.[CrossRef][Medline]
5. Hardy, M. P., and L. A. O'Neill. 2004. The murine IRAK2 gene encodes four alternatively spliced isoforms, two of which are inhibitory. J. Biol. Chem. 279:27699-27708.
6. Janssens, S., and R. Beyaert. 2003. Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell 11:293-302.[CrossRef][Medline]
7. Janssens, S., K. Burns, J. Tschopp, and R. Beyaert. 2002. Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12:467-471.[CrossRef][Medline]
8. Janssens, S., K. Burns, E. Vercammen, J. Tschopp, and R. Beyaert. 2003. MyD88S, a splice variant of MyD88, differentially modulates NF-kappaB- and AP-1-dependent gene expression. FEBS Lett. 548:103-107.[CrossRef][Medline]
9. Jensen, L. E., and A. S. Whitehead. 2001. IRAK1b, a novel alternative splice variant of interleukin-1 receptor-associated kinase (IRAK), mediates interleukin-1 signaling and has prolonged stability. J. Biol. Chem. 276:29037-29044.
10. Jiang, Z., J. Ninomiya-Tsuji, Y. Qian, K. Matsumoto, and X. Li. 2002. Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced signaling complexes phosphorylate TAK1 and TAB2 at the plasma membrane and activate TAK1 in the cytosol. Mol. Cell. Biol. 22:7158-7167.
11. Kanakaraj, P., K. Ngo, Y. Wu, A. Angulo, P. Ghazal, C. A. Harris, J. J. Siekierka, P. A. Peterson, and W. P. Fung-Leung. 1999. Defective interleukin (IL)-18-mediated natural killer and T helper cell type 1 responses in IL-1 receptor-associated kinase (IRAK)-deficient mice. J. Exp. Med. 189:1129-1138.
12. Kanakaraj, P., P. H. Schafer, D. E. Cavender, Y. Wu, K. Ngo, P. F. Grealish, S. A. Wadsworth, P. A. Peterson, J. J. Siekierka, C. A. Harris, and W. P. Fung-Leung. 1998. Interleukin (IL)-1 receptor-associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production. J. Exp. Med. 187:2073-2079.
13. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr., R. Medzhitov, and R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-like receptor signaling. Cell 110:191-202.[CrossRef][Medline]
14. Kollewe, C., A. C. Mackensen, D. Neumann, J. Knop, P. Cao, S. Li, H. Wesche, and M. U. Martin. 2003. Sequential auto-phosphorylation steps in the interleukin-1 receptor-associated kinase-1 (IRAK-1) regulate its availability as an adapter in IL-1 signaling. J. Biol. Chem.
15. Li, S., A. Strelow, E. J. Fontana, and H. Wesche. 2002. IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase. Proc. Natl. Acad. Sci. USA 99:5567-5572.
16. Li, X., M. Commane, Z. Jiang, and G. R. Stark. 2001. IL-1-induced NFkappa B and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc. Natl. Acad. Sci. USA 98:4461-4465.
17. Lye, E., C. Mirtsos, N. Suzuki, S. Suzuki, and W. C. Yeh. 2004. The role of interleukin 1 receptor-associated kinase-4 (IRAK-4) kinase activity in IRAK-4-mediated signaling. J. Biol. Chem. 279:40653-40658.
18. Mestas, J., and C. C. Hughes. 2004. Of mice and not men: differences between mouse and human immunology. J. Immunol. 172:2731-2738.
19. Picard, C., A. Puel, M. Bonnet, C. L. Ku, J. Bustamante, K. Yang, C. Soudais, S. Dupuis, J. Feinberg, C. Fieschi, C. Elbim, R. Hitchcock, D. Lammas, G. Davies, A. Al-Ghonaium, H. Al-Rayes, S. Al-Jumaah, S. Al-Hajjar, I. Z. Al-Mohsen, H. H. Frayha, R. Rucker, T. R. Hawn, A. Aderem, H. Tufenkeji, S. Haraguchi, N. K. Day, R. A. Good, M. A. Gougerot-Pocidalo, A. Ozinsky, and J. L. Casanova. 2003. Pyogenic bacterial infections in humans with IRAK-4 deficiency. Science 299:2076-2079.
20. Rao, N., A. K. Ghosh, P. Zhou, P. Douillard, C. E. Andoniou, and H. Band. 2002. An essential role of ubiquitination in Cbl-mediated negative regulation of the Src-family kinase Fyn. Signal Transduct. 2:29-39.
21. Rosati, O., and M. U. Martin. 2002. Identification and characterization of murine IRAK-2. Biochem. Biophys. Res. Commun. 297:52-58.[CrossRef][Medline]
22. Suzuki, N., S. Suzuki, G. S. Duncan, D. G. Millar, T. Wada, C. Mirtsos, H. Takada, A. Wakeham, A. Itie, S. Li, J. M. Penninger, H. Wesche, P. S. Ohashi, T. W. Mak, and W. C. Yeh. 2002. Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4. Nature 416:750-756.[CrossRef][Medline]
23. Vincent, M. S., D. S. Leslie, J. E. Gumperz, X. Xiong, E. P. Grant, and M. B. Brenner. 2002. CD1-dependent dendritic cell instruction. Nat. Immunol. 3:1163-1168.[CrossRef][Medline]
24. Vogel, S. N., K. A. Fitzgerald, and M. J. Fenton. 2003. TLRs: differential adapter utilization by toll-like receptors mediates TLR-specific patterns of gene expression. Mol. Interv. 3:466-477.
25. Wesche, H., X. Gao, X. Li, C. J. Kirschning, G. R. Stark, and Z. Cao. 1999. IRAK-M is a novel member of the Pelle/interleukin-1 receptor-associated kinase (IRAK) family. J. Biol. Chem. 274:19403-19410.
26. Yagasaki, Y., T. Sudo, and H. Osada. 2004. Exip, a splicing variant of p38alpha, participates in interleukin-1 receptor proximal complex and downregulates NF-kappaB pathway. FEBS Lett. 575:136-140.[CrossRef][Medline]
27. Yamin, T. T., and D. K. Miller. 1997. The interleukin-1 receptor-associated kinase is degraded by proteasomes following its phosphorylation. J. Biol. Chem. 272:21540-21547.
28. Yanagisawa, K., K. Tago, M. Hayakawa, M. Ohki, H. Iwahana, and S. Tominaga. 2003. A novel splice variant of mouse interleukin-1-receptor-associated kinase-1 (IRAK-1) activates nuclear factor-kappaB (NF-kappaB) and c-Jun N-terminal kinase (JNK). Biochem. J. 370:159-166.[CrossRef][Medline]
29. Yeo, S. J., J. G. Yoon, S. C. Hong, and A. K. Yi. 2003. CpG DNA induces self and cross-hyporesponsiveness of RAW264.7 cells in response to CpG DNA and lipopolysaccharide: alterations in IL-1 receptor-associated kinase expression. J. Immunol. 170:1052-1061.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||
