MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taipale, M.
Right arrow Articles by Akhtar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taipale, M.
Right arrow Articles by Akhtar, A.
Molecular and Cellular Biology, August 2005, p. 6798-6810, Vol. 25, No. 15
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.15.6798-6810.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

hMOF Histone Acetyltransferase Is Required for Histone H4 Lysine 16 Acetylation in Mammalian Cells

Mikko Taipale,1 Stephen Rea,1 Karsten Richter,2 Ana Vilar,3,4 Peter Lichter,2 Axel Imhof,3 and Asifa Akhtar1*

European Molecular Biology Laboratory, Gene Expression Programme, Meyerhofstrasse 1, 69117 Heidelberg, Germany,1 Division of Molecular Genetics (B060), Deutsches Krebsforschungszentrum, INF 280, 69120 Heidelberg, Germany,2 Adolf-Butenandt-Institut, Schillerstrasse 44, 80336 München, Germany,3 Cancer Epigenetics Laboratory, Molecular Pathology Programme, Spanish National Cancer Centre, Melchor Fernández Almagro 3, 28029 Madrid, Spain4

Received 18 March 2005/ Returned for modification 11 April 2005/ Accepted 5 May 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reversible histone acetylation plays an important role in regulation of chromatin structure and function. Here, we report that the human orthologue of Drosophila melanogaster MOF, hMOF, is a histone H4 lysine K16-specific acetyltransferase. hMOF is also required for this modification in mammalian cells. Knockdown of hMOF in HeLa and HepG2 cells causes a dramatic reduction of histone H4K16 acetylation as detected by Western blot analysis and mass spectrometric analysis of endogenous histones. We also provide evidence that, similar to the Drosophila dosage compensation system, hMOF and hMSL3 form a complex in mammalian cells. hMOF and hMSL3 small interfering RNA-treated cells also show dramatic nuclear morphological deformations, depicted by a polylobulated nuclear phenotype. Reduction of hMOF protein levels by RNA interference in HeLa cells also leads to accumulation of cells in the G2 and M phases of the cell cycle. Treatment with specific inhibitors of the DNA damage response pathway reverts the cell cycle arrest caused by a reduction in hMOF protein levels. Furthermore, hMOF-depleted cells show an increased number of phospho-ATM and {gamma}H2AX foci and have an impaired repair response to ionizing radiation. Taken together, our data show that hMOF is required for histone H4 lysine 16 acetylation in mammalian cells and suggest that hMOF has a role in DNA damage response during cell cycle progression.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nucleosomes composed of DNA and histones define the fundamental structural unit of chromatin, which acts as a scaffold for nuclear processes such as transcription and replication. By modifying the nucleosomal structure in several ways, the chromatinized DNA can be made either more or less accessible. Alterations to chromatin structure are usually brought about in three different ways: by ATP-dependent remodeling of nucleosomes, by replacement of standard histones with histone variants, and by covalently modifying the N-terminal tails of histones. Histone modifications include acetylation, phosphorylation, methylation, ubiquitination, sumoylation, and poly(ADP-ribosyl)ation (for a review, see reference 54). Histone acetylation is the best-characterized modification and is controlled by histone acetyltransferases (HATs) and histone deacetylases.

Sequence analysis of HAT proteins reveal that they can be classified in distinct families, with each family having a characteristic substrate specificity (12). GNAT (GCN5-related N-acetyltransferases) family members mainly acetylate lysines on the histone H3 tail. The founding members of the other family, MYST, include Saccharomyces cerevisiae Ybf2p/Sas3p and Sas2p and human MOZ and Tip60 (56). The MYST homology domain is exceptionally well conserved among all family members. This region includes the acetyl coenzyme A binding domain similar to the one found in GNAT acetyltransferases (41) as well as a C2HC-type zinc finger. Recently, the crystal structure of Esa1, an essential yeast HAT, showed that even though the MYST and GNAT family share sequence homology only in motif A, there is high degree of structural conservation in the central core region between the two families (59, 60). The MYST family can be further divided into subgroups based on additional domains present in these proteins. The first subgroup contains proteins with PhD fingers (such as MOZ and MORF), the second subgroup contains proteins with a chromodomain (such as Esa1, dMOF, and Tip60) (41, 56), and a third one (including HBO1) has other known domains such as zinc fingers.

One of the chromodomain-containing members of the MYST family, dMOF, is an integral player in the Drosophila melanogaster dosage compensation process. Dosage compensation ensures that males and females, despite unequal numbers of X chromosomes, express the same amount of X-linked gene products. In Drosophila, this is thought to occur by an approximately twofold transcriptional upregulation of most male X-linked genes. The male X chromosome is coated by dosage compensation complex (DCC), comprised of at least five proteins (dMOF, dMSL1, dMSL2, dMSL3, and dMLE) and two noncoding RNAs (roX1, roX2). Transcriptional upregulation correlates with specific acetylation of histone H4 at lysine 16 (H4K16) on the male X chromosome by dMOF (3, 8, 51). A point mutation in a conserved glycine residue of dMOF that renders the protein enzymatically inactive leads to male-specific lethality (19). Biochemical characterization of the dMOF has shown that it is an RNA-binding protein that acetylates not only histone H4 lysine 16 but also other members of the DCC, namely dMSL1 and dMSL3 (4, 11, 31).

It is remarkable that all the proteins of the Drosophila DCC have been well conserved during evolution (26, 27, 45), even though dosage compensation is brought about by different means in other animal phyla. Based on current evidence, it is reasonable to assume that dosage compensation has evolved independently several times, illustrating an interesting case of convergent evolution (28). How, then, have different dosage compensation mechanisms evolved? Recent data suggest that animals have co-opted evolutionary ancient chromatin-modifying complexes for a new function in dosage compensation. Caenorhabditis elegans dosage compensation is regulated by condensin-like proteins, which are normally involved in chromosome compaction during mitosis (18). Likewise, polycomb proteins that have been implicated in X chromosome inactivation in mammals have an evolutionary older function in repression of homeotic genes during development (35). With the exception of the mammalian dMLE orthologue, the transcriptional coactivator RNA helicase A, the function of the Drosophila DCC gene orthologues in vertebrates remains unclear.

Recently, a putative human orthologue of Drosophila MOF, hMOF/MYST1, was isolated (34). Like the Drosophila protein, it contains a chromodomain and a MYST family HAT domain. A C-terminal fragment of this protein was shown to possess histone acetyltransferase activity toward histones H3, H2A, and H4 in vitro (34). A human gene hMSL3/MSL3L1 has also been isolated and characterized previously as a candidate gene for several developmental disorders (15, 39). It encodes a protein with significant homology to the Drosophila MSL3 in three distinct regions, including the two chromo-like domains (27).

Intrigued by this evolutionary conservation, we have studied the role of hMOF and hMSL3 proteins in mammalian cells. We report that human MOF possesses acetyltransferase activity on histones and nucleosomes. Interestingly, depletion of hMOF in HeLa cells leads to a dramatic decrease in histone H4 lysine 16 acetylation, while other acetylation sites appear to be unaffected. In addition, the cells show altered nuclear morphology with polylobular nuclei. This striking phenotype can be rescued by treating the affected cells with the histone deacetylase inhibitor trichostatin A (TSA). HeLa cells transfected with hMOF small interfering RNA (siRNA) show proliferation defects and accumulate in the G2/M phase of the cell cycle. We show that the observed G2/M arrest is at least partially caused by activation of the DNA damage response pathway, illustrated by an increased number of ATM pS1981 and {gamma}H2AX foci in hMOF-depleted cells.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein expression and antibodies. Full-length hMOF was produced in Escherichia coli strain BL21(DE3) as a glutathione S-transferase (GST) fusion in pET41b(+) vector (Merck Biosciences). Cells were induced with 0.3 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 3 h at 18°C. FLAG-hMSL3 was expressed in ER2566 strain as an intein-CBD fusion, with induction with 0.3 mM IPTG for 3 h at 30°C. Following the cleavage of intein-CBD tag, the eluted protein was immunoprecipitated with anti-FLAG beads (Sigma) and the bound full-length hMSL3 protein was eluted with FLAG peptide. Cloning details are available upon request.

Antibodies against hMOF-GST and FLAG-hMSL3 fusion proteins were produced in rats and rabbits, respectively. Both antibodies were further affinity purified. To generate hMOF peptide antibodies, rabbits were injected with keyhole limpet hemocyanin-conjugated peptides PERKITRNQKRKHDE and KWAPPKHKQVKLSKK at Eurogentec, Belgium. Antibody was affinity purified with the peptide KWAPPKHKQVKLSKK. Antibody against RNA helicase A was obtained from C.-G. Lee (University of Medicine and Dentistry, New Jersey), MRG15 was obtained from O. Pereira-Smith (University of Texas, San Antonio), RCC1 was obtained from I. Mattaj (EMBL, Heidelberg), lamin A/C and lamin B1 were obtained from H. Herrmann (DKFZ, Heidelberg), and H4K12Ac was obtained from Bryan Turner (University of Birmingham). ß-Tubulin and FLAG (Sigma), ATM pS1981 (Rockland Immunochemicals), H4K16Ac (Chemicon), H3K14Ac and H3K23Ac (Abcam), and {gamma}H2AX (Upstate) were purchased as indicated.

Coimmunoprecipitation and GST pull-down assays. HeLa nuclear extract was prepared as previously described (16). Approximately 100 µg nuclear protein in HEMG buffer (25 mM HEPES, pH 7.6, 12.5 mM MgCl2, 0.5 mM EDTA, 1 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 10% glycerol) with 100 mM KCl was used in immunoprecipitation. Immunoprecipitates were washed three times with HEMG buffer with 100 mM KCl at room temperature, and bound proteins were eluted with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer.

In vitro GST pull-down assays were performed in HEMG buffer with 200 mM KCl. Briefly, 300 ng of FLAG-hMSL3 or RCC1 was incubated with 1 µg of recombinant hMOF constructs bound to glutathione beads for 1 h at room temperature. After incubation, beads were washed three times, for 5 min each time, with HEMG buffer with 200 mM KCl. Bound proteins were eluted with SDS loading buffer.

Histone acetyltransferase assays. Histone acetyltransferase assays were performed as described earlier (2). Protein (100 ng or indicated amounts) was incubated for 30 min at 30°C in HAT buffer (20 mM Tris-HCl, pH 8.8, 1.5 mM MgCl2, 10 mM NaCl, supplemented with 125 nCi [3H]acetyl-coenzyme A) with 1 µg of recombinant histone octamer or 1 µg of nucleosomal histones assembled by salt exchange. Reactions were either blotted on a hydrophobic p81 paper and scintillation counted or run on 15% SDS-PAGE and Coomassie stained. The signal on SDS-PAGE gels was intensified with Amplify solution (Amersham).

Mass spectrometry. For the in vivo analysis of modified histones, histone bands were modified in gel using propionic anhydride or D6 acetic anhydride and digested with trypsin (6, 7, 38, 49). Matrix-assisted laser desorption ionization (MALDI) spectra were recorded on a Voyager STR instrument (PE-Sciex). For mass spectrometry (MS)/MS analysis, collision-induced decay spectra were recorded on a Q-STAR XL instrument (PE-Sciex) with manually adjusted collision energies. Fragment spectra were interpreted manually.

Correlation of confocal laser scanning and electron microscopy. Ultrastructural investigation by electron microscopy was correlated to observations by laser scanning microscopy as described in reference 40. Briefly, cells grown on gridded coverslips (Cellocate; Eppendorf AG, Germany) were fixed for 1 h on ice in a mixture of 4% freshly prepared formaldehyde, 1% glutaraldehyde (electron microscopy grade; Sigma), 1 mM MgCl2, and 100 mM sodium phosphate buffer, pH 6.8, rinsed in buffer, and embedded in Vectashield fluorescence mounting medium (Vector Laboratories) for observation by confocal laser scanning microscopy (LSM). Following LSM investigation, the coverslips were rinsed in buffer, postfixed in 1% buffered OsO4 for 30 min at room temperature, dehydrated in aqueous ethanol, and embedded in epoxy resin (Epon 812; Sigma). The coverslips were subsequently removed under liquid nitrogen depicting the negative imprint of the Cellocate grid. Ultrathin sections at a nominal thickness of 70 nm were prepared from the grid region of interest, poststained in 2% uranyl acetate and aqueous lead citrate, and observed in a Philips 410 transmission electron microscope.

Cell culture and transfection. HeLa and HepG2 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, penicillin, streptomycin (Invitrogen), and L-glutamine (Invitrogen). Synthetic siRNAs (hMOF-1, GUGAUCCAGUCUCGAGUGA; hMOF-2, AAAGACCAUAAGAUUUAUU; hMOF-3, CAAGAUCACUCGCAACCAA; hMSL3-1, CGGUUAGUGAAACUUCCAU; hMSL3-2, AAAGGUGACUUCGUCUAAA; control, CACGTACGCGGAATACTTCG, sense strand) were purchased from MWG Biotech. Approximately 1.5 x 105 cells were transfected with Oligofectamine (Invitrogen) with a 60 nM final concentration of siRNA complexes. TSA was added to a final concentration of 25 ng/ml for 72 h, and 2 mM caffeine was added for 24 h where indicated.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recombinant hMOF is an active histone acetyltransferase. To analyze the enzymatic activity of hMOF protein, we produced recombinant full-length hMOF protein in bacterial cells. To study the functional status of the recombinant enzyme, histone acetyltransferase assays were performed with recombinant histones, mononucleosomes, oligonucleosomes, and derivatives of hMOF lacking N or C termini (Fig. 1A and B). As expected, the MYST homology domain is sufficient for hMOF acetyltransferase activity, and the C2HC zinc finger region is required for activity (Fig. 1C, lanes 3 and 4). As shown in Fig. 1C and D, hMOF is a robust histone acetyltransferase with substrate preference for histone H4, but it also acetylates histone H3 and histone H2A on free histones as well as on nucleosomes (Fig. 1D, right panel, compare lanes 1 to 3 with 4 to 9). In contrast to recombinant dMOF, which exclusively acetylates histone H4 in a nucleosomal context (2), hMOF significantly acetylates both histone H3 and histone H4 (Fig. 1D, compare lanes 10 and 11, and data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. hMOF is a histone acetyltransferase. (A) Schematic representation of the GST-hMOF fusion constructs used in histone acetyltransferase assays. (B) Constructs of GST-hMOF and FLAG-hMSL3 expressed in E. coli stained with Coomassie. (C) Filter binding HAT assay with different hMOF constructs using a recombinant histone octamer as a substrate for acetylation. Bars 1 to 4 correspond to lanes 1 to 4 in panel B; bar 5, GST alone; bar 6, histones alone. +, with; –, without. (D) Separation of histones from HAT assay by SDS-PAGE. Left panel: top and middle, autoradiographs (short exposure, overnight; long exposure, 2 weeks) of the gel. Bottom, Coomassie staining of the same gel. Right panel: comparison of hMOF (lane 10) and dMOF (lane 11) HAT activity on nucleosomes. mononucl., mononucleosomes. (E) Nucleosomal HAT activity of anti-FLAG immunoprecipitates from HA-2x FLAG-tagged hMOF or from HeLa cells. Left panel: autoradiograph (top) and corresponding Coomassie gel (bottom). Right panel: detection of modified residues with acetylation-specific antibodies.

 
We were next interested in testing whether this difference in substrate specificity observed between hMOF and dMOF would also be observed with hMOF immunoprecipitated from cells. For this purpose, we immunoprecipitated hMOF from a stable cell line expressing hemagglutinin (HA)-2x FLAG-tagged hMOF with an anti-FLAG antibody. Nuclear extracts prepared from untagged HeLa cells were used as controls. Interestingly, we observed that in contrast to recombinant hMOF, immunoprecipitated hMOF acetylates only histone H4 in mononucleosomes (Fig. 1E, left panel), suggesting that hMOF is more specific in vivo. Indeed, Western blot analysis of acetylated histones revealed that immunoprecipitated hMOF acetylates H4K16, while H4K12 remained unacetylated (Fig. 1E, right panel). It therefore appears that while Drosophila MOF is capable of specific H4K16 acetylation in vitro, hMOF specificity for histone H4 is regulated either by additional complex components or posttranslational modifications (see below).

Loss of hMOF abolishes H4 lysine 16 acetylation in vivo. To study the function of the hMOF protein in vivo, we used RNA interference in HeLa and HepG2 cells. Using three independent synthetic siRNAs against the hMOF coding region, we were able to specifically reduce the levels of hMOF protein down to 10% of its original level in HeLa cells (Fig. 2A, upper panel, and data not shown). To determine which lysine residues would be targets of acetylation by hMOF in vivo, we isolated endogenous histones by acid extraction from cells treated with either control siRNA or hMOF-specific siRNA. The histones were separated by SDS-PAGE, and subsequently, Western blot analysis was performed with antibodies against acetylated histones. Ponceau S staining of the membranes revealed equal loading of histones. Interestingly, the level of histone H4 lysine 16 acetylation (H4K16) in hMOF-depleted cells was severely reduced in comparison to the control cells (Fig. 2A, right and middle panels). In contrast, there was no significant difference in acetylation of H3K14, H3K23, or H4K12, although these lysines were targets of recombinant hMOF in vitro (Fig. 2A and data not shown). Although we did not analyze H4K5 or H4K8 acetylation status by Western blotting, mass spectrometric analysis of endogenous histones did not reveal significant changes (see below).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of the histone modification state in cells treated with siRNA against hMOF. (A, right and middle panels) Acetylation of histone H4 lysine 16 is specifically reduced in hMOF-depleted cells. Cells were transfected with either control or hMOF-1 siRNA. Western blot analysis of the acid-soluble fraction was performed with acetylation-specific antibodies as indicated. The amount of histones loaded was controlled by staining the membrane with Ponceau S. (Left panel) Western blot analysis to show reduction of proteins levels by MOF siRNA 1 and 2 in comparison to control siRNA. (B) MALDI-time of flight analysis of H4 molecules purified via SDS-PAGE and propionylated and digested as described previously (6). Only the peptide containing amino acids 4 to 17 of H4 is shown. Note that the peptide with the highest m/z carries four propionyl groups and corresponds to the unmodified form in vivo. (C) Quantitation of acetylation levels seen in vivo. For quantitation, H4 molecules have been modified using D6 acetic anhydride rather than propionic anhydride to ensure similar ionization behavior of the in vitro- and in vivo-modified peptides. (D) Schematic display of the fragment ions generated by collision-induced decay from a monoacetylated peptide. To analyze a specific effect of hMOF knockdown on H4K16 acetylation, we have analyzed the monoacetylated peptide by MS/MS. (E) Enlarged regions of the MS/MS spectra generated from the monoacetylated peptide from control (left panels) or hMOF knockdown (right panels) cells. Note that the fragment ions containing lysines 5, 8, or 12 show a similar ratio of the acetylated (Ac) form to the nonacetylated (propionylated [Pr]) form, whereas the peptide containing K16 (middle panel) is strongly hypoacetylated in cells treated with siRNA against hMOF.

 
To further analyze the acetylation status of the endogenous histones, mass spectrometric analysis was performed on the isolated histones. To this end, histones extracted from control and hMOF-depleted cells were separated by SDS-PAGE, modified in gel using propionic anhydride or D6 acetic anhydride (Fig. 2B and 2C, respectively), and digested with trypsin (6). Comparing the MALDI-time of flight spectra of the digested peptides from control and hMOF-depleted cells showed a 20% increase in the unacetylated peptide, a 20% drop of the mono- and diacetylated forms, and a complete absence of tri- and tetra-acetylated H4 in cells treated with an siRNA against hMOF.

As the Western blot results with acetylation-specific antibodies suggested a strong effect of hMOF ablation on the acetylation of H4K16 (Fig. 2A), we performed an MS/MS analysis on the monoacetylated/propionylated H4 peptide that carries amino acids 4 to 17 of the H4 tail. By comparing the relative abundance of the expected fragment ions for the nonacetylated (propionylated) and the acetylated peptides (Fig. 2D), we concluded that in HeLa cells, the major histone H4 acetylation sites are K16 and K12 (85%). There is, however, a marked difference in the ratio of K12/K16 acetylation between cells depleted for hMOF and control cells. Fragment ions containing only K16 (m/z of 530.35 for the acetylated form and m/z of 544.35 for the unacetylated, propionylated form) show an approximately sevenfold-lower appearance of the acetylated form in hMOF knockdown cells compared to control cells (Fig. 2E, second panel). This strong decrease in acetylation is partly rescued by an increase in the acetylation of lysines 5, 8, and 12 (compare the peak height of for acetylated versus nonacetylated in the top, middle, and bottom panels). This shift also explains the moderate effect of hMOF depletion on overall monoacetylation levels despite its strong impact on K16 acetylation.

hMOF and hMSL3 interact directly in vitro and in vivo. It has previously been shown in Drosophila that dMOF and dMSL3 can interact in vitro and that this interaction leads to acetylation of dMSL3 in vivo and in vitro (11). These observations led us to test whether the interaction is conserved between hMOF and hMSL3 in mammalian cells. We performed coimmunoprecipitation experiments with hMOF antibody or corresponding preimmune serum, as a negative control, from nuclear extracts prepared from HeLa cells. The coimmunoprecipitated samples were analyzed by SDS-PAGE followed by Western blot analysis. The results of these experiments show that hMSL3 coimmunoprecipitates with hMOF (Fig. 3A, compare lanes 1 and 2). Interaction was also detected when coimmunoprecipitation experiments were performed with anti-hMSL3 or using nuclear extracts from HEK293 cells (data not shown). It is important to note that we could observe two isoforms of hMSL3 (hMSL3a and hMSL3c) coimmunoprecipitating with hMOF. Based on bioinformatics analysis and GenBank, these isoforms most likely represent two splice variants of the hMSL3 gene.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. hMOF and hMSL3 interact in vivo and in vitro. (A) Immunoprecipitation (IP) of hMOF (lane 1) with preimmune serum (C) (lane 2) as a control. The amount of input is indicated (lanes 3 and 4). (B) In vitro pull-down assay of hMSL3 (top panel) and RCC1 (bottom panel) with hMOF-GST constructs (lanes 1 to 4). Input corresponds to 10% of the starting material (lanes 5 to 8).

 
Since the interaction between hMOF and hMSL3 was conserved, we wanted to test whether the proteins interact with another orthologue of the Drosophila DCC proteins. However, the orthologue of maleless (MLE) protein, RNA helicase A, did not coimmunoprecipitate with hMOF or hMSL3, even in low stringency conditions, suggesting that it is not part of the mammalian MSL complex (Fig. 3A and data not shown). Furthermore, in contrast to a previous report (36), we could not detect an interaction between MRG15 and hMOF in vivo under our experimental conditions (Fig. 3A).

The experiment above demonstrates that interaction between hMOF and hMSL3 is conserved in mammalian cells. It does not address, however, whether this interaction is direct or mediated by another unknown component. To address this issue, we performed in vitro GST pull-down assays with GST-hMOF fusion derivatives and full-length hMSL3. Another nuclear protein, RCC1, was used as a control. Following binding, the beads were washed and the bound fraction was analyzed by Western blotting. The blots were first probed with hMSL3 or RCC1 antisera and subsequently with a GST antibody to control for equal loading of hMOF-GST constructs. Consistent with our observations in vivo, hMOF and hMSL3 interacted directly in vitro (Fig. 3B, top panel, lane 1). An interaction could still be detected with a deletion derivate of hMOF containing the MYST domain (lane 3 and 4), but no interaction was detected with the derivative containing only the chromodomain of hMOF (lane 2). The C2HC-type zinc finger that is embedded in the catalytic domain of hMOF was not required for interaction (Fig. 3B, lane 4). hMSL3 interaction with the C terminus of hMOF was specific, since another chromatin-associated protein, RCC1, did not interact with hMOF in the same experimental conditions (Fig. 3B, bottom panel). In summary, we can demonstrate a direct interaction between hMOF and hMSL3. We also found that the C terminus of hMOF mediates this interaction.

hMOF- and hMSL3-depleted cells show nuclear morphology defects. Apart from severe reduction of lysine 16 acetylation, another striking feature of hMOF knockdown cells was their abnormal nuclear structure. About 36 h after hMOF siRNA transfection, cells started to undergo dramatic changes in nuclear morphology and to form multiple lobes (Fig. 4B). The phenotype ranged from nuclei showing one extra lobe to cells with 6 to 8 lobes in the nucleus. This phenotype was observed with three independent hMOF siRNAs tested, and on average, 25 to 30% of the cells treated with hMOF siRNA showed severe morphological defects (see below). Interestingly, hMSL3-depleted cells also showed similar defects, albeit with a lower frequency, suggesting that the two proteins function in the same pathway (Fig. 4B and see below). Knockdown of hMSL3 in HeLa cells was effective with two independent siRNAs tested, as shown in Fig. 4A. Similar results were obtained when hMOF and hMSL3 were depleted in HepG2 cells, excluding a cell type-specific effect (Fig. 4B and data not shown). The polylobular phenotype was also observed in HeLa cells stably expressing enzymatically inactive epitope-tagged hMOF (HA-2x FLAG-hMOF G327D), whereas a cell line stably transfected with a wild-type hMOF construct (HA-2x FLAG-hMOF) had a normal morphological appearance (Fig. 5B).



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 4. Nuclear morphology defects in hMOF-depleted cells. (A) Knockdown of hMSL3 by RNA interference in HeLa cells 4 days after transfection of two independent hMSL3 siRNAs. The Western blot was probed with antibodies against hMSL3 (top panel), hMOF (middle panel), and ß-tubulin (bottom panel). (B) Spectrum of nuclear defects in HeLa and HepG2 cells. Panels show hMOF-depleted cells, hMSL3-depleted cells, and control cells 4 days after transfection of siRNA. Nuclei were stained with Hoechst 33342. (C) Still images from a movie of a dividing hMOF-depleted cell with chromatin labeled with H2B-GFP from early prophase (top left) to G1 (bottom right). Arrows indicate lobes appearingin the late telophase. (D) Confocal images of hMOF-depleted and control cells. Top left, confocal slice of mAB414-stained nuclei. Bar, 5 µm. Lamin B1 and lamin A/C (middle left and bottom left, respectively) are stacks of multiple confocal slices. (E) Ultrastructure of a lobulated nucleus of an hMOF-depleted cell. Upper panel: ultrathin section from the substrate side of the nucleus. The inset shows the corresponding LSM optical section of the GFP signal (inverted grayscale) from the same nucleus. The arrow points to the fold shown in detail in the lower panel. Note that the arrowed structure of this fold is also visible in the LSM image. Bar, 5 µm. Lower panel, consecutive ultrathin sections of the nuclear fold, starting with the bottommost section at the left. The inset shows an enlarged view of the front of the fold to show vesicles and filaments in this region. Bar, 1 µm.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. TSA treatment enhances the growth of hMOF-depleted cells. Cells were transfected with hMOF-1 siRNA or control siRNA and treated with 25 ng/ml TSA or left untreated as indicated. Error bars indicate standard errors of the means. (B) Effect of TSA on nuclear morphology in hMOF-depleted and control HeLa cells. Cells were transfected with hMOF siRNAs (hMOF-1, -2, or -3) or control siRNA (control). Nuclear morphology defects were scored in TSA-treated (gray bars) and untreated (black bars) cells 4 days after transfection. The experiment was performed at least 3 times, counting a minimum of 400 cells per sample each time. Error bars indicate standard errors of the means. Stable cell lines are HeLa cells expressing either wild-type hMOF (wt) or inactive LMOF (G327D). (C) Loss of hMOF correlates with H4K16 acetylation. HeLa (top) and HepG2 (bottom) cells were stained for hMOF (left, red) and acetylated H4K16 (middle, green). Right panels, DNA stained with Hoechst 33342. Arrows indicate cells in which hMOF has efficiently been knocked down. Note the altered structure of the hMOF-depleted nuclei.

 
Next, we were interested in determining the stage of the cell cycle at which hMOF-depleted cells acquire polylobular nuclei. We therefore produced a stable HeLa cell line expressing C-terminally GFP-tagged histone H2B (H2B-GFP) and used these cells in live imaging. hMOF-depleted and control cells were imaged for 48 h to ensure that we see at least one mitotic event during the imaging process. We observed that, in comparison to the control cells that had normal nuclei before and after mitosis, hMOF siRNA-treated cells that had normal round-shaped nuclei before mitosis showed a polylobular appearance in late telophase after nuclear envelope reassembly (Fig. 4C).

It has previously been reported that depletion of nuclear pore complex component RanBP2 leads to changes in nuclear morphology (42). Since the nuclei appear polylobulated after completion of mitosis, we wanted to address whether this defect appears due to abnormal nuclear envelope reassembly. For this purpose, we immunostained hMOF siRNA-treated and control cells with mAB414 monoclonal antibody that recognizes several nucleoporins. However, we observed no major defects in the nuclear pore distribution (Fig. 4D). Similarly, the cytoskeleton of hMOF knockdown cells appeared normal, as judged by phalloidin (F-actin) and ß-tubulin staining (data not shown). We have also tested differences in distribution of nucleoli (fibrillarin), heterochromatin (HP1{alpha}, H3K9 methylation, H3K27 methylation), and centromeres (CREST autoimmune serum) by immunofluorescence but have not been able to find any differences between hMOF knockdown and control cells (data not shown).

Another component influencing nuclear architecture is the nuclear lamina. Loss or overexpression of lamins, which constitute the nuclear lamina, has been reported to cause defects in nuclear structure (9, 20). We therefore tested whether the distribution or levels of nuclear lamina proteins, namely lamin A/C and lamin B1, were affected in hMOF siRNA-treated cells. Remarkably, we could observe a modest but consistent enrichment of lamin B1 and lamin A/C, typically in the constriction between the lobes (Fig. 4D; see below). The difference between hMOF-depleted and control cells was mainly in the distribution of lamins, as there was no significant change in lamin B1 or lamin A/C protein levels upon hMOF depletion (data not shown).

Ultrastructural investigation by electron microscopy revealed that the nucleoli were normal in shape and size and showed their characteristic stacked composition in fibrillar center, fibrillar component, and granular component, indicating normal physiological activity in hMOF-depleted versus control cells. Nuclear pores appeared as in normal control cells. In contrast, the lamina underneath the nuclear envelope was more discrete and regular in structure than in control cells. This is consistent with observations made above with enriched lamin staining.

Major structural reorganization was, however, seen at the cytoplasmic side of the folds which separate the nuclear lobules. The folding process appears to be more complicated than a simple indentation of the nuclear envelope from the periphery to the center. At the front of the fold, the substrate-facing side (bottom) of the nuclear envelope forms stacks of wrinkles in an oblique direction to the main fold (Fig. 4E). This front region of folds is densely packed with vesicles and filaments, suggesting that folds are formed also by an active engagement of the cytoplasm. In summary, we did not observe gross changes in nuclear organization in hMOF-depleted cells.

However, it remains possible that subtle changes in chromatin acetylation levels in cells or changes in acetylation of an unknown substrate may contribute to the observed nuclear deformations. We reasoned that if this was the case, changing the balance of acetylation in the cell might rescue the polylobular phenotype. To address this issue, we first transfected HeLa cells with a control siRNA or hMOF siRNA, and 24 h after transfection, we added trichostatin A (25 ng/ml), a potent histone deacetylase inhibitor, to the growth medium for another 72 h. This was followed by Western blot analysis to assess the knockdown efficiency, assay for cell growth, and observation of the nuclear morphology in these cells. hMOF was efficiently knocked down in untreated and TSA-treated cells (data not shown). Interestingly, whereas control cells proliferated significantly more slowly in the presence of TSA, hMOF knockdown cells grew slightly better in the presence than in the absence of TSA (Fig. 5A). TSA did not, however, fully restore normal growth of hMOF knockdown cells. More importantly, nuclear morphology was restored in TSA-treated hMOF knockdown cells. Similar results were obtained with all hMOF siRNAs tested (Fig. 5B). We further confirmed that in both HeLa and HepG2 cells, polylobulation correlates with loss of hMOF, which can also be tracked with an H4K16Ac-specific antibody (Fig. 5C).

However, TSA treatment did not lead to an increase in H4K16 acetylation in hMOF-depleted cells (data not shown), suggesting that this modification is not directly linked to nuclear shape changes and that hMOF has other cellular targets (see Discussion).

Cell cycle checkpoint activation in hMOF-depleted HeLa cells. We also observed that hMOF siRNA-treated HeLa cells showed proliferation defects in comparison to the control siRNA-treated cells (Fig. 6A). hMOF-depleted cells were negative for Trypan blue staining, indicating that the primary cause of growth arrest was not due to apoptosis or necrosis (data not shown). Next, we analyzed the control siRNA and hMOF siRNA-treated populations with flow cytometry to observe changes in cell cycle profiles. We found that hMOF siRNA-treated cells accumulate in the G2/M phase of the cell cycle in comparison to the control cells (Fig. 6B). Furthermore, fluorescence-activated cell sorter (FACS) analysis also revealed that the cells treated with hMOF siRNA were approximately 10% larger than the control cells in all phases of the cell cycle (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. (A) Growth of HeLa cells after transfection with hMOF or control siRNA. Error bars indicate standard errors of the means. (B) FACS profile of hMOF-depleted and control cells 4 days after transfection. The percentage of cells in each phase of the cell cycle is also indicated. (C) The PIKK inhibitor caffeine partly suppresses the accumulation of hMOF-depleted cells in G2/M. Caffeine-treated (2 mM, 24 h) or untreated HeLa cells were analyzed by FACS 4 days after transfection of hMOF siRNA or control siRNA. Bars indicate percentages of G2/M cells. Error bars indicate standard errors of the means. (E) hMOF-depleted cells show an increase in ATM S1981 phosphorylation. (E) Kinetics of DSB repair in hMOF-depleted and control cells after irradiation (IR) (1 Gy). At each time point, ATM pS1981 foci were counted from 50 randomly selected cells. Error bars indicate standard errors of the means within the experiment. Inset, example of ATM pS1981 and {gamma}H2AX foci 4 h after 1-Gy irradiation in control (top) and hMOF-depleted (bottom) cells.

 
Eukaryotic cells have developed a number of checkpoints that delay cell cycle progression in response to environmental stress. There is an evolutionarily conserved checkpoint at the G2/M boundary of the cell cycle, and a wide variety of agents can trigger this G2/M checkpoint (for a review, see reference 43). Regulation of the checkpoint is a complex process with redundancy in response to different genotoxic and nongenotoxic stresses. Recent evidence suggests that there are two major signaling cascades regulating this G2 delay. One pathway is caffeine insensitive and involves the p38 kinases activated in the cytoplasm (10), while the other, which is caffeine sensitive, is driven by the nuclear ATM/ATR/DNA-PK pathway (43).

We reasoned that activation of either of these checkpoints could explain the accumulation of hMOF-depleted cells in G2/M. First, we tested activation of p38{alpha} in hMOF-depleted and control cells but detected no difference in p38{alpha} phosphorylation (data not shown).

Next, we tested whether the arrest in hMOF knockdown cells involved the ATM/ATR pathway by using two inhibitors of these cascades, caffeine and wortmannin. It is important to note that both caffeine and wortmannin can inhibit activation of both ATM and ATR, but the 50% inhibitory concentration of both drugs for ATR is an order of magnitude higher than for ATM (46, 47). Therefore, to distinguish between these two possibilities, we used 2 mM caffeine or 2 µM wortmannin, doses that should primarily inhibit ATM. At 72 h after transfection, hMOF-depleted and control cells were treated with caffeine or wortmannin for 24 h or left untreated. Subsequently, cells were analyzed by FACS to determine cell cycle profiles. Both caffeine and wortmannin restored the cell cycle profile of hMOF-depleted cells to almost that of control cells (Fig. 6C and data not shown).

To examine whether hMOF-depleted cells had activated the ATM-dependent checkpoint, we immunostained hMOF knockdown and control cells with an antibody against phosphorylated ATM (pS1981). In control cells, about 20% of cells had one or several ATMp foci. However, the number of cells with ATMp foci after depletion of hMOF was consistently higher, about 40%, with both siRNAs tested (Fig. 6D). Both the percentage of the cells with phospho-ATM foci and the average number of foci was increased upon hMOF knockdown. These foci colocalized with {gamma}H2AX foci (data not shown), suggesting that they represent double-stranded breaks (DSBs) occurring during the normal cell cycle.

Hypoacetylation of histones could render DNA susceptible to breakage, thereby activating the checkpoint, or alternatively, it could impair repair of normally occurring DSBs. In both cases, the result would be an increased number of ATMp and {gamma}H2AX foci. To distinguish between these possibilities, we treated the hMOF-depleted and control cells with ionizing radiation (1 Gy) and performed a time course study to assess DNA repair kinetics by counting the presence of ATMp and {gamma}H2AX foci. hMOF-depleted cells consistently showed a significant delay in kinetics of DNA repair as observed by the presence of more ATMp foci in comparison to control cells (Fig. 6E). Similar results were obtained with a higher dose of 6 Gy and with HepG2 cells. These results suggest that hMOF-depleted and thus H4K16-hypoacetylated HeLa cells activate the G2/M checkpoint due to a delay in the kinetics of the DNA repair process of hypoacetylated chromatin, as opposed to hypoacetylation leading to more DNA damage without having an effect on the repair process itself.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here we show that the interaction between hMOF and hMSL3 is conserved in mammalian cells and is mediated by the C-terminal region of the hMOF protein. We also observe that hMOF-depleted and hMSL3-depleted HeLa and HepG2 cells have polylobular nuclei. hMOF knockdown cells have severely reduced levels of histone H4 lysine 16 acetylation, which may be the primary cause of these defects. This is consistent with our observations that nuclear morphology defects can be rescued by treating the cells with the histone deacetylase inhibitor trichostatin A. Furthermore, we find that depletion of hMOF causes increased phosphorylation of ATM, which can explain the accumulation of cells in G2/M. Consistent with this, inhibiting the ATM pathway with caffeine or wortmannin suppresses the G2/M arrest caused by depletion of hMOF.

Role of hMOF in histone H4 lysine 16 acetylation in vivo. We detected a significant decrease in H4K16 acetylation in hMOF knockdown cells, whereas acetylation of other lysines (H4K12, H3K14, and H3K23) remained mostly unaffected, although these lysines are acetylated by recombinant hMOF in vitro. Endogenous mammalian MSL complex therefore appears to be specific for H4K16, or alternatively, there could be more redundancy between HATs acetylating H3K14, H3K23, and H4K12 in mammalian cells. Purification of the human MSL complex should shed more light on this issue in the future.

The dramatic decrease in H4K16 acetylation in hMOF knockdown cells suggests that hMOF is the major H4K16 acetyltransferase in mammals. To our knowledge, this is the first report connecting a mammalian histone acetyltransferase to a specific lysine residue in vivo. In mammals, lysine 16 is clearly the most abundant acetylation site on histone H4 (32, 53, 55). In bulk chromatin preparations, nearly all acetylated histone H4 molecules are acetylated at H4K16, be it mono-, di-, tri-, or tetra-acetylated H4 (32, 53, 55). It will be interesting to study whether localization of hMOF coincides with H4K16 acetylation patterns on promoters and/or coding regions previously documented in mammalian cells.

It was originally suggested that histone acetylation is a hierarchical process, where one modification is required for subsequent acetylation (55). H4K16, being the most commonly acetylated residue, would be placed on top of the cascade. However, we could detect no reduction in H4K5, H4K8, or H4K12 acetylation in hMOF knockdown cells. On the contrary, hMOF-depleted cells appeared to compensate for the loss of K16 acetylation by higher levels of acetylation on other lysine residues on the H4 tail. This result clearly implies that K16 acetylation is not a prerequisite for subsequent acetylation.

Conserved interaction between hMOF and hMSL3. We found that hMOF and hMSL3 coimmunoprecipitate in vivo in HeLa cells as well as HEK293 cells. Furthermore, we detect a direct interaction between hMOF and hMSL3 in vitro. We have also mapped the sites of interaction to the C-terminal MYST domain. A similar nuclear morphology phenotype in hMOF- and hMSL3-depleted cells corroborates the finding that the two proteins function in the same complex.

The human orthologue of dMLE, RNA helicase A, did not interact with hMOF or hMSL3 under the conditions used. dMLE seems to interact with other members of the Drosophila DCC only transiently (14), suggesting that it is not a stable component of the complex. It is possible that dMLE is a later addition to the DCC, perhaps reflecting the role of noncoding RNAs as functional units of the Drosophila complex. This would be consistent with the results of this study.

hMOF is involved in the maintenance of nuclear structure in HeLa cells. We observed that the nuclei of both hMOF and hMSL3 knockdown cells appear polylobulated. By using live cell imaging, we were able to show that, in hMOF-depleted cells, these defects appear during nuclear envelope reassembly in late telophase. We did not observe any lagging chromosomes in mitosis in these cells, indicating the defects are not due to missegregation of chromosomes. However, lamin A/C and lamin B1 were redistributed to the concave surfaces of invaginations. Consistent with this observation, we could detect thickened nuclear lamina structures in hMOF-depleted cells by electron microscopy. Previous studies have shown that overexpression of full-length or dominant-negative forms of lamins leads to nuclear structure aberrations (9, 20). It was recently shown that expression of Chk tyrosine kinase in the nucleus leads to a strikingly similar polylobular phenotype, including redistribution of lamin B1 and a high concentration of microtubules around the invaginations (33). However, Chk-dependent nuclear shape change was mitosis independent, whereas we could only see morphological changes following mitosis. It is therefore likely that there are multiple mechanisms maintaining nuclear shape.

Acetylation appears to be involved in the process, since expression of an enzymatically inactive hMOF induced changes in nuclear morphology similar to those induced by hMOF knockdown. Consistently, polylobulation of HeLa cells was rescued upon treatment with TSA, a potent histone deacetylase inhibitor. It is, however, unlikely that H4K16 acetylation plays a direct role in nuclear morphology changes. First, TSA treatment of hMOF-depleted cells did not lead to an increase in H4K16 acetylation. Second, hMSL3 depletion had no impact on bulk K16 acetylation despite a similar phenotype (data not shown). Third, the histone deacetylases known to deacetylate H4K16 belong to the TSA-insensitive SIR family (22, 57). It is thus conceivable that hMOF also has other TSA-sensitive cellular targets that remain to be identified.

hMOF, H4K16 acetylation, and DNA damage response pathway. We also observed that the depletion of hMOF affected cell proliferation in HeLa cells. This effect was not due to apoptosis or necrosis, but we found that the cells were enriched at the G2/M phase of cell cycle. In an effort to understand whether a checkpoint cascade is activated in hMOF-depleted cells, we observed that the G2/M defect could be suppressed by inhibiting checkpoint response with low doses of caffeine. Low doses of caffeine were used to rule out the involvement of DNA-PK and the ATR pathway. Consistent with this observation, we found no defects in UV-induced DNA damage response in hMOF siRNA-treated cells (data not shown). In addition to caffeine, we also observed that wortmannin had a similar effect on the cell cycle profile (data not shown). These results strongly suggest that hMOF-depleted cells have activated the DNA damage pathway. Decreasing cellular hMOF levels led to increased phosphorylation of serine 1981 of ATM and {gamma}H2AX, hallmarks of activation of this pathway (5). hMOF knockdown cells do not seem to be more susceptible to DNA damage. However, the kinetics of DNA repair after irradiation is slowed down in these cells. Thus, the most likely explanation for the activation of the checkpoint is that hMOF-depleted cells fail to efficiently repair DSBs that occur during the cell cycle, thus delaying the progression to mitosis.

Previously, acetylation of histone H4 has been linked to cell cycle progression through G2/M in yeast (29, 30). Yeast cells with four mutant lysines (K5Q, K8Q, K12Q, and K16Q) in the H4 tail accumulate in G2/M in a RAD9-dependent manner (29, 30). RAD9 is a sensor protein that arrests cell cycle progression if cells have accumulated DNA damage (58). Interestingly, yeast Esa1p is required for cell cycle progression, and rad9 can also suppress the esa1 phenotype (13, 50). Esa1p is a MYST family acetyltransferase closely related to hMOF. It is the catalytic subunit of the NuA4 histone acetyltransferase complex that also contains Eaf3p, the yeast ortholog of hMSL3. Another striking phenotype of esa1 mutant cells is accumulation of visible changes in chromatin structure (13). hMOF-depleted cells accumulate similarly in G2/M, in a caffeine-sensitive manner, and show changes in nuclear shape, suggesting that the involvement of histone H4 acetylation in cell cycle progression and/or DNA repair is evolutionarily conserved from yeast to mammals.

Recently, several studies have shown the involvement of histone methylation and acetylation in DSB repair (21, 23, 25, 37, 44). Intriguingly, acetylation of histones has been shown to increase the activity of DNA-PK in a nucleosomal context in vitro (37). Furthermore, it has been shown that within 1 to 2 kb of a defined DSB, very little {gamma}H2AX can be detected (48) and that H4K16 is generally hypoacetylated in fission yeast (23). These studies suggest that there is a connection between H4K16 acetylation, DNA-PK activity, and H2AX phosphorylation in DSB repair. If this aspect of DSB repair is evolutionarily conserved to mammals, it would have interesting implications for the role of hMOF in DSB repair.

H4K16 acetylation and cancer. It is remarkable that lysine 16 acetylation by the MOF enzyme has been evolutionarily used for various purposes. In Drosophila, it correlates with increased X-linked gene transcription (1), while in yeast, H4K16 acetylation by orthologous SAS2 regulates heterochromatin spreading (52) and, perhaps surprisingly, negatively correlates with gene transcription (24). It appears that mammals have adopted histone H4 lysine 16 acetylation to be one of the most abundant histone modifications.

Recently, it was shown that loss of acetylation at H4K16 is a common hallmark of human cancer (17). A variety of human tumor cell lines and primary tumors show significant hypoacetylation at H4K16 and hypo(tri)methylation at H4K20. Remarkably, reduction in H4K16 acetylation correlates with tumor progression. It was also shown that hMOF is not associated with hypomethylated repetitive D4Z4 sequences in the HL60 tumor cell line, in contrast to wild-type lymphocytes, where these elements are normally methylated.

We have shown that hMOF is the major H4K16-specific histone acetyltransferase in human cell lines. If this is the case for most tissues, it implies a significant role for hMOF activity in tumorigenesis. Clearly, future studies need to address the role of hMOF and H4K16 acetylation in healthy and cancer tissues.


    ACKNOWLEDGMENTS
 
We thank Jan Ellenberg and the members of his laboratory as well as ALMF for help with confocal and live cell imaging. We thank Thomas Köcher and Matthias Wilms for mass spectrometric analysis of recombinant hMOF and Klaus-Josef Weber for invaluable help with irradiation experiments. We are also grateful to Iain Mattaj, Matthias Hentze, Elisa Izaurralde, Jan Ellenberg, and Juerg Müller for critical reading of the manuscript. In addition, we thank Iain Mattaj, Chee-Gun Lee, Harald Herrmann, Olivia Pereira-Smith, Bryan Turner, and Jan Ellenberg for providing antibodies. Tej Pandita and John Lucchesi are acknowledged for communication of results prior to publication. We are also indebted to Harald Herrmann and to the members of the Akhtar laboratory for useful discussions.

This work partially funded by DFG Transregio 5. S.R. is a recipient of EMBO and HFSP postdoctoral fellowships.


    FOOTNOTES
 
* Corresponding author. Mailing address: European Molecular Biology Laboratory, Gene Expression Programme, Meyerhofstrasse 1, 69117 Heidelberg, Germany. Phone: 49 6221 3878550. Fax: 49 6221 3878518. E-mail: akhtar{at}embl.de. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Akhtar, A. 2003. Dosage compensation: an intertwined world of RNA and chromatin remodelling. Curr. Opin. Genet. Dev. 13:161-169.[CrossRef][Medline]

2. Akhtar, A., and P. B. Becker. 2000. Activation of transcription through histone H4 acetylation by MOF, an acetyltransferase essential for dosage compensation in Drosophila. Mol. Cell 5:367-375.[CrossRef][Medline]

3. Akhtar, A., and P. B. Becker. 2001. The histone H4 acetyltransferase MOF uses a C2HC zinc finger for substrate recognition. EMBO Rep. 2:113-118.[CrossRef][Medline]

4. Akhtar, A., D. Zink, and P. B. Becker. 2000. Chromodomains are protein-RNA interaction modules. Nature 407:405-409.[CrossRef][Medline]

5. Bakkenist, C. J., and M. B. Kastan. 2003. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 421:499-506.[CrossRef][Medline]

6. Bonaldi, T., A. Imhof, and J. T. Regula. 2004. A combination of different mass spectroscopic techniques for the analysis of dynamic changes of histone modifications. Proteomics 4:1382-1396.[CrossRef][Medline]

7. Bonaldi, T., J. T. Regula, and A. Imhof. 2004. The use of mass spectrometry for the analysis of histone modifications. Methods Enzymol. 377:111-130.[Medline]

8. Bone, J. R., J. Lavender, R. Richman, M. J. Palmer, B. M. Turner, and M. I. Kuroda. 1994. Acetylated histone H4 on the male X chromosome is associated with dosage compensation in Drosophila. Genes Dev. 8:96-104.[Abstract/Free Full Text]

9. Broers, J. L., E. A. Peeters, H. J. Kuijpers, J. Endert, C. V. Bouten, C. W. Oomens, F. P. Baaijens, and F. C. Ramaekers. 2004. Decreased mechanical stiffness in LMNA-/- cells is caused by defective nucleo-cytoskeletal integrity. Implications for the development of laminopathies. Hum. Mol. Genet. 13:2567-2580.[Abstract/Free Full Text]

10. Bulavin, D. V., S. A. Amundson, and A. J. Fornace. 2002. p38 and Chk1 kinases: different conductors for the G(2)/M checkpoint symphony. Curr. Opin. Genet. Dev. 12:92-97.[CrossRef][Medline]

11. Buscaino, A., T. Kocher, J. H. Kind, H. Holz, M. Taipale, K. Wagner, M. Wilm, and A. Akhtar. 2003. MOF-regulated acetylation of MSL-3 in the Drosophila dosage compensation complex. Mol. Cell 11:1265-1277.[CrossRef][Medline]

12. Carrozza, M. J., R. T. Utley, J. L. Workman, and J. Cote. 2003. The diverse functions of histone acetyltransferase complexes. Trends Genet. 19:321-329.[CrossRef][Medline]

13. Clarke, A. S., J. E. Lowell, S. J. Jacobson, and L. Pillus. 1999. Esa1p is an essential histone acetyltransferase required for cell cycle progression. Mol. Cell. Biol. 19:2515-2526.[Abstract/Free Full Text]

14. Copps, K., R. Richman, L. M. Lyman, K. A. Chang, J. Rampersad-Ammons, and M. I. Kuroda. 1998. Complex formation by the Drosophila MSL proteins: role of the MSL2 RING finger in protein complex assembly. EMBO J. 17:5409-5417.[CrossRef][Medline]

15. Cormier, T. A., S. K. Prakash, D. B. Magner, H. Y. Zoghbi, and I. B. Van den Veyver. 2001. Analysis of Mid1, Hccs, Arhgap6, and Msl3l1 in X-linked polydactyly (Xpl) and Patchy-fur (Paf) mutant mice. Mamm. Genome 12:796-798.[CrossRef][Medline]

16. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.[Abstract/Free Full Text]

17. Fraga, M. F., E. Ballestar, A. Villar-Garea, M. Boix-Chornet, J. Espada, G. Schotta, T. Bonaldi, C. Haydon, S. Ropero, K. Petrie, N. G. Iyer, A. Perez-Rosado, E. Calvo, J. A. Lopez, A. Cano, M. J. Calasanz, D. Colomer, M. A. Piris, N. Ahn, A. Imhof, C. Caldas, T. Jenuwein, and M. Esteller. 2005. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat. Genet. 37:391-400.[CrossRef][Medline]

18. Hagstrom, K. A., and B. J. Meyer. 2003. Condensin and cohesin: more than chromosome compactor and glue. Nat. Rev. Genet. 4:520-534.[CrossRef][Medline]

19. Hilfiker, A., D. Hilfiker-Kleiner, A. Pannuti, and J. C. Lucchesi. 1997. mof, a putative acetyl transferase gene related to the Tip60 and MOZ human genes and to the SAS genes of yeast, is required for dosage compensation in Drosophila. EMBO J. 16:2054-2060.[CrossRef][Medline]

20. Hoffmann, K., C. K. Dreger, A. L. Olins, D. E. Olins, L. D. Shultz, B. Lucke, H. Karl, R. Kaps, D. Muller, A. Vaya, J. Aznar, R. E. Ware, N. Sotelo Cruz, T. H. Lindner, H. Herrmann, A. Reis, and K. Sperling. 2002. Mutations in the gene encoding the lamin B receptor produce an altered nuclear morphology in granulocytes (Pelger-Huet anomaly). Nat. Genet. 31:410-414.[CrossRef][Medline]

21. Huyen, Y., O. Zgheib, R. A. Ditullio, Jr., V. G. Gorgoulis, P. Zacharatos, T. J. Petty, E. A. Sheston, H. S. Mellert, E. S. Stavridi, and T. D. Halazonetis. 2004. Methylated lysine 79 of histone H3 targets 53BP1 to DNA double-strand breaks. Nature 432:406-411.[CrossRef][Medline]

22. Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795-800.[CrossRef][Medline]

23. Jazayeri, A., A. D. McAinsh, and S. P. Jackson. 2004. Saccharomyces cerevisiae Sin3p facilitates DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 101:1644-1649.[Abstract/Free Full Text]

24. Kurdistani, S. K., S. Tavazoie, and M. Grunstein. 2004. Mapping global histone acetylation patterns to gene expression. Cell 117:721-733.[CrossRef][Medline]

25. Kusch, T., L. Florens, W. H. Macdonald, S. K. Swanson, R. L. Glaser, J. R. Yates III, S. M. Abmayr, M. P. Washburn, and J. L. Workman. 2004. Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions. Science 306:2084-2087.[Abstract/Free Full Text]

26. Marin, I. 2003. Evolution of chromatin-remodeling complexes: comparative genomics reveals the ancient origin of "novel" compensasome genes. J. Mol. Evol. 56:527-539.[CrossRef][Medline]

27. Marin, I., and B. S. Baker. 2000. Origin and evolution of the regulatory gene male-specific lethal-3. Mol. Biol. Evol. 17:1240-1250.[Abstract/Free Full Text]

28. Marin, I., M. L. Siegal, and B. S. Baker. 2000. The evolution of dosage-compensation mechanisms. Bioessays 22:1106-1114.[CrossRef][Medline]

29. Megee, P. C., B. A. Morgan, B. A. Mittman, and M. M. Smith. 1990. Genetic analysis of histone H4: essential role of lysines subject to reversible acetylation. Science 247:841-845.[Abstract/Free Full Text]

30. Megee, P. C., B. A. Morgan, and M. M. Smith. 1995. Histone H4 and the maintenance of genome integrity. Genes Dev. 9:1716-1727.[Abstract/Free Full Text]

31. Morales, V., T. Straub, M. F. Neumann, G. Mengus, A. Akhtar, and P. B. Becker. 2004. Functional integration of the histone acetyltransferase MOF into the dosage compensation complex. EMBO J. 23:2258-2268.[CrossRef][Medline]

32. Munks, R. J., J. Moore, L. P. O'Neill, and B. M. Turner. 1991. Histone H4 acetylation in Drosophila. Frequency of acetylation at different sites defined by immunolabelling with site-specific antibodies. FEBS Lett. 284:245-248.[CrossRef][Medline]

33. Nakayama, Y., and N. Yamaguchi. 2005. Multi-lobulation of the nucleus in prolonged S phase by nuclear expression of Chk tyrosine kinase. Exp. Cell Res. 304:570-581.[CrossRef][Medline]

34. Neal, K. C., A. Pannuti, E. R. Smith, and J. C. Lucchesi. 2000. A new human member of the MYST family of histone acetyl transferases with high sequence similarity to Drosophila MOF. Biochim. Biophys. Acta 1490:170-174.[Medline]

35. Otte, A. P., and T. H. Kwaks. 2003. Gene repression by Polycomb group protein complexes: a distinct complex for every occasion? Curr. Opin. Genet. Dev. 13:448-454.[CrossRef][Medline]

36. Pardo, P. S., J. K. Leung, J. C. Lucchesi, and O. M. Pereira-Smith. 2002. MRG15, a novel chromodomain protein, is present in two distinct multiprotein complexes involved in transcriptional activation. J. Biol. Chem. 277:50860-50866.[Abstract/Free Full Text]

37. Park, E. J., D. W. Chan, J. H. Park, M. A. Oettinger, and J. Kwon. 2003. DNA-PK is activated by nucleosomes and phosphorylates H2AX within the nucleosomes in an acetylation-dependent manner. Nucleic Acids Res. 31:6819-6827.[Abstract/Free Full Text]

38. Peters, A. H., S. Kubicek, K. Mechtler, R. J. O'Sullivan, A. A. Derijck, L. Perez-Burgos, A. Kohlmaier, S. Opravil, M. Tachibana, Y. Shinkai, J. H. Martens, and T. Jenuwein. 2003. Partitioning and plasticity of repressive histone methylation states in mammalian chromatin. Mol. Cell 12:1577-1589.[CrossRef][Medline]

39. Prakash, S. K., I. B. Van den Veyver, B. Franco, M. Volta, A. Ballabio, and H. Y. Zoghbi. 1999. Characterization of a novel chromodomain gene in xp22.3 with homology to Drosophila msl-3. Genomics 59:77-84.[CrossRef][Medline]

40. Richter, K., M. Reichenzeller, S. Gorisch, U. Schmidt, M. O. Scheuermann, H. Herrmann, and P. Lichter. 2005. Characterization of a nuclear compartment shared by nuclear bodies applying ectopic protein expression and correlative light and electron microscopy. Exp. Cell Res. 303:128-137.[CrossRef][Medline]

41. Roth, S. Y., J. M. Denu, and C. D. Allis. 2001. Histone acetyltransferases. Annu. Rev. Biochem. 70:81-120.[CrossRef][Medline]

42. Salina, D., P. Enarson, J. B. Rattner, and B. Burke. 2003. Nup358 integrates nuclear envelope breakdown with kinetochore assembly. J. Cell Biol. 162:991-1001.[Abstract/Free Full Text]

43. Sancar, A., L. A. Lindsey-Boltz, K. Unsal-Kaccmaz, and S. Linn. 2004. Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem. 73:39-85.[CrossRef][Medline]

44. Sanders, S. L., M. Portoso, J. Mata, J. Bahler, R. C. Allshire, and T. Kouzarides. 2004. Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage. Cell 119:603-614.[CrossRef][Medline]

45. Sanjuan, R., and I. Marin. 2001. Tracing the origin of the compensasome: evolutionary history of DEAH helicase and MYST acetyltransferase gene families. Mol. Biol. Evol. 18:330-343.[Abstract/Free Full Text]

46. Sarkaria, J. N., E. C. Busby, R. S. Tibbetts, P. Roos, Y. Taya, L. M. Karnitz, and R. T. Abraham. 1999. Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine. Cancer Res. 59:4375-4382.[Abstract/Free Full Text]

47. Sarkaria, J. N., R. S. Tibbetts, E. C. Busby, A. P. Kennedy, D. E. Hill, and R. T. Abraham. 1998. Inhibition of phosphoinositide 3-kinase related kinases by the radiosensitizing agent wortmannin. Cancer Res. 58:4375-4382.[Abstract/Free Full Text]

48. Shroff, R., A. Arbel-Eden, D. Pilch, G. Ira, W. M. Bonner, J. H. Petrini, J. E. Haber, and M. Lichten. 2004. Distribution and dynamics of chromatin modification induced by a defined DNA double-strand break. Curr. Biol. 14:1703-1711.[CrossRef][Medline]

49. Smith, C. M., P. R. Gafken, Z. Zhang, D. E. Gottschling, J. B. Smith, and D. L. Smith. 2003. Mass spectrometric quantification of acetylation at specific lysines within the amino-terminal tail of histone H4. Anal. Biochem. 316:23-33.[CrossRef][Medline]

50. Smith, E. R., A. Eisen, W. Gu, M. Sattah, A. Pannuti, J. Zhou, R. G. Cook, J. C. Lucchesi, and C. D. Allis. 1998. ESA1 is a histone acetyltransferase that is essential for growth in yeast. Proc. Natl. Acad. Sci. USA 95:3561-3565.[Abstract/Free Full Text]

51. Smith, E. R., A. Pannuti, W. Gu, A. Steurnagel, R. G. Cook, C. D. Allis, and J. C. Lucchesi. 2000. The drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation. Mol. Cell. Biol. 20:312-318.[Abstract/Free Full Text]

52. Suka, N., K. Luo, and M. Grunstein. 2002. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat. Genet. 32:378-383.[CrossRef][Medline]

53. Thorne, A. W., D. Kmiciek, K. Mitchelson, P. Sautiere, and C. Crane-Robinson. 1990. Patterns of histone acetylation. Eur. J. Biochem. 193:701-713.[Medline]

54. Turner, B. M. 2002. Cellular memory and the histone code. Cell 111:285-291.[CrossRef][Medline]

55. Turner, B. M., L. P. O'Neill, and I. M. Allan. 1989. Histone H4 acetylation in human cells. Frequency of acetylation at different sites defined by immunolabeling with site-specific antibodies. FEBS Lett. 253:141-145.[CrossRef][Medline]

56. Utley, R. T., and J. Cote. 2003. The MYST family of histone acetyltransferases. Curr. Top. Microbiol. Immunol. 274:203-236.[Medline]

57. Vaquero, A., M. Scher, D. Lee, H. Erdjument-Bromage, P. Tempst, and D. Reinberg. 2004. Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol. Cell 16:93-105.[CrossRef][Medline]

58. Weinert, T. A., and L. H. Hartwell. 1988. The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae. Science 241:317-322.[Abstract/Free Full Text]

59. Yan, Y., N. A. Barlev, R. H. Haley, S. L. Berger, and R. Marmorstein. 2000. Crystal structure of yeast Esa1 suggests a unified mechanism for catalysis and substrate binding by histone acetyltransferases. Mol. Cell 6:1195-1205.[CrossRef][Medline]

60. Yan, Y., S. Harper, D. W. Speicher, and R. Marmorstein. 2002. The catalytic mechanism of the ESA1 histone acetyltransferase involves a self-acetylated intermediate. Nat. Struct. Biol. 9:862-869.[Medline]


Molecular and Cellular Biology, August 2005, p. 6798-6810, Vol. 25, No. 15
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.15.6798-6810.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow