This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Luo, M. Articles by Melamed, P. Search for Related Content PubMed PubMed Citation Articles by Luo, M. Articles by Melamed, P.

Cross Talk in Hormonally Regulated Gene Transcription through Induction of Estrogen Receptor Ubiquitylation

Min Luo, Mingshi Koh, Jiajun Feng, Qiang Wu, and Philippa Melamed^*

Functional Genomics Laboratories, Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117542, Singapore

Received 7 May 2005/ Returned for modification 26 May 2005/ Accepted 31 May 2005

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Estrogen tightly regulates the levels of circulating gonadotropins, but a direct effect of estrogen receptor alpha (ER) on the mammalian LHß gene has remained poorly defined. We demonstrate here that ER can associate with the LHß promoter through interactions with Sf-1 and Pitx1 without requiring an estrogen response element (ERE). We show that gonadotropin-releasing hormone (GnRH) promotes ER ubiquitylation and also degradation while stimulating expression of ubc4. GnRH also increases the association and lengthens the cycling time of ER on the LHß promoter. The ER association and transactivation of the LHß gene, as well as ER degradation, are increased following ubc4 overexpression, while the effects of GnRH are abated following ubc4 knockdown. Our results indicate that ER ubiquitylation and subsequent transactivation of the LHß gene can be induced by increasing the levels of the E2 enzyme as a result of signaling by an extracellular hormone, thus providing a new form of cross talk in hormonally stimulated regulation of gene expression.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
Estrogen is a growth factor that stimulates cell growth and differentiation in diverse tissues. One of its most central roles, however, is regulating the production of gonadotropins in the pituitary gland, which is exerted via negative and positive feedback acting at the brain and pituitary. It is the high level of estradiol (E₂) at the end of the follicular phase that works synergistically with the hypothalamic gonadotropin-releasing hormone (GnRH) and leads to the preovulatory luteinizing hormone (LH) surge that initiates ovulation.

The synergistic effects of GnRH and E₂ on LHß gene expression have been explained by a number of mechanisms, some of which increase the gonadotropes' sensitivity to GnRH. These include E₂/estrogen receptor (ER) effects on Egr-1, calcium influx, and mitogen-activated protein kinase (MAPK), which comprises part of the GnRH signaling pathway (4, 6, 8, 45). Conversely, the effects of ER on estrogen-responsive promoters are enhanced by GnRH, possibly involving MAPK phosphorylation of ER, which facilitates protein-protein interactions and transactivation, even in the absence of a ligand (9, 19, 33, 36, 53).

Despite evidence that E₂ enhances LHß gene transcription directly, the molecular mechanisms involved have remained elusive (3, 15, 25). This contrasts with the well-studied conserved tripartite element comprising Sf-1, Pitx1, and Egr-1 response elements on the proximal promoter, which likely mediates the GnRH response of all mammalian LHß genes (3, 11, 20, 46, 58). Notably, of these, only the rat LHß gene contains a possible estrogen response element (ERE). This element, located 1,159 bp upstream of the transcriptional start site, was shown to bind recombinant ER in gel shift assays (55) but bears little resemblance to the consensus ERE motif and is not found on the homologous genes of other mammals. Thus, any direct actions of the liganded ER on the LHß gene promoter, if they occur, are likely to involve other DNA binding factors, as shown, for example, for Sp1 and AP-1 (reviewed in reference 19). This contrasts with the situation in teleost fish, in which all of the isolated LHß gene proximal promoters do contain a near-consensus ERE, and in chinook salmon this was shown to mediate estrogen/ER responsiveness (27, 31).

ER transactivation appears to involve ubiquitylation which signals proteasome-mediated degradation. A direct correlation between the rate of ER degradation and its transcriptional activity has been noted (32, 48, 62), although other studies have suggested that it causes down-regulation, as inhibition of the degradation caused an increase in target gene expression (13). How these two seemingly opposing observations can be reconciled is not yet clear, although Fan et al. (13) suggest promoter context is likely crucial and may relate to the degree that ER availability is a limiting factor in transcription of a particular gene.

The ER is reportedly ubiquitylated after the first round of transcription, allowing its release from the promoter, which may be essential for subsequent ER/E₂-mediated transcription. In this way, the ER cycles on and off the promoter for as long as stimulation is present (37, 48, 54). This cycling reportedly also occurs in the absence of a ligand, but the cycling times are much shorter; it was suggested that the cycle time is limited by the formation of an active complex which promotes transcription and thus presumably also ER ubiquitylation (48).

A prevalent role of ubiquitin in mediating regulation of transcription factor activity is recognized: the ubiquitylation is thought to comprise a mechanism to switch off transcription until it is reinitiated, facilitating precise regulation of activator function (38, 50). Such a mechanism could regulate transcription factors whose activity is tightly controlled, allowing for a precise switching mechanism and rapid reinitiation of transcription in the case of continuous stimulation (30, 40). Furthermore, a possible direct association between transactivation and ubiquitylation, in which the activation domains of certain factors overlap with elements that signal destruction, has been noted (49, 50). However, the exact mechanisms through which ubiquitylation is effected at the promoter have yet to be elucidated, while additional roles for this modification in regulating transactivation, other than through protein degradation, have also been proposed (5, 38). Evidence for nonproteasomal effects of ubiquitylation in transcription include the finding that the APIS complex of the 19S base interacts with the Gal4 activation domain and appears to be involved in transcriptional activation independently of degradation, perhaps through enhancing initiation and/or elongation (14, 16, 43).

Our hypothesis for this work was that ER interacts with GnRH-mediated signals at the promoter to activate transcription of the LHß gene, and our aim was to elucidate the nature of this interaction and its effects. This led us to discover that GnRH exposure increases levels of ubiquitin-conjugating enzyme 4 (ubc4) and causes ubiquitylation of ER while enhancing its transactivation of the LHß gene and being involved in its degradation. We further demonstrate that the ER effect on LHß gene expression is direct, showing that ER is associated with the LHß gene proximal promoter in its native chromatin setting, and propose the mechanism of its recruitment.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Western blotting. Cells were lysed in extraction buffer (1x phosphate-buffered saline [PBS], 2% sodium dodecyl sulfate [SDS]) and stored at –80°C until required. The proteins (30 µg/lane) were resolved by electrophoresis on 12% SDS-polyacrylamide gels at 100 V for 2 h and subsequently transferred to an Immuno-Blot polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA) in transfer buffer (39 mM glycine, 48 mM Tris, 0.037% SDS, and 20% methanol) at 30 V for 4 h at 4°C. The membrane was blocked with 10% nonfat milk in Tris-buffered saline-Tween (TBST) (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20) for 1 h at room temperature (RT), washed with TBST for 30 min at RT, and then incubated for 1 h at RT with antisera to ER or ubc4 (H-184 or MC-20 for ER and SC-15000 for ubc4; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and GAPDH (sc-20357; Santa Cruz Biotechnology) diluted 1:1,000 in TBST plus 1% nonfat milk. After washing for 30 min, the membrane was incubated with goat or bovine horseradish peroxidase-conjugated antisera to rabbit or goat immunoglobulin G (0.4 µg/ml; Santa Cruz) for 1 h at RT and rinsed in TBST for 30 min at RT. The immunoreactive protein was detected using the Super Signal Pico West chemiluminescent system (Pierce Chemical Co., Rockford, IL), followed by exposure to Cl-XPosure film (Pierce Chemical Co.) for 1 to 5 min.

Cell culture and transient transfections. Cells were cultured in six-well plates and transiently transfected for chloramphenicol acetyltransferase (CAT) assays as described previously (35) using either FuGENE 6 (Roche Diagnostics, Basel, Switzerland) or GenePORTER 2 (Gene Therapy Systems, San Diego, CA). Alternatively, for luciferase assays, cells were grown in 96-well plates, and vectors for rLHß-luc (200 ng), the transcription factors (80 ng for Sf-1 and ER; 10 ng for Pitx1), and simian virus 40-Renilla (2 ng) were transfected using GenePORTER 2 after the total amount of DNA had been equilibrated using pWhitescript. Cells were incubated for 40 to 48 h after transfection before harvest. For cells exposed to GnRH (Buserilin) or E₂ (Sigma, St. Louis, MO), these were added to the medium to a final concentration of 10 nM 24 h before harvest unless otherwise stated. MG132 (Z-Leu-Leu-Leu-al; Sigma) was dissolved in dimethyl sulfoxide and added to cells to a final concentration of 10 µM 16 h before harvest.

CAT and ß-galactosidase (ß-Gal) assays were performed as described previously (27), and normalized activity was calculated as a ratio to the basal levels of activity in cells transfected with the control reporter constructs alone. Firefly luciferase and Renilla levels were measured using the Dual-Glo system (Promega) and the Veritas Microplate luminometer (Turner Biosystems), and reporter gene activity was calculated, after normalization, as activity (n-fold) over that in untreated controls.

Plasmid constructs. The csLHß-CAT and rLHß-CAT constructs have been described previously (28, 64). The rLHß-luc construct was created by ligating the 5' flanking region of the rLHß gene from the above construct into the pGL3 plasmid (Promega) containing the firefly luciferase reporter gene. Site-directed deletions were carried out using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) using primers comprising 25 bp of the region flanking the response element on both sides and the complementary sequence. All constructs were verified by sequencing.

The ubc4 expression vector was created by amplifying the coding sequence (accession no. BC003923) from LßT2 cell cDNA using primers to include BamHI and EcoRI restriction sites (5'-GACGGATCCATGGCTCTGAAGAGAATC-3' and 5'-GCAGAATTCTTACATCGCATACTTCTG-3'). The amplified and digested fragment was cloned into pCS2.

The small interfering RNA (siRNA) constructs for ubc4 and the green fluorescent protein (GFP) control were constructed in the pSUPER vector (Oligoengine, Seattle, WA) to include the specific 19-bp target sequence for the siubc4 construct (5'-GGCTACAATAATGGGGCCA-3') and the sequence for the siGFP construct (5'-GAACGGCATCAAGGTGAAC-3'). All constructs were verified by sequencing.

The expression vectors for ER, Pitx1, and Sf-1 were gifts from F. Pakdel (Rennes, France), J. Drouin (Montreal, Canada), and K. Parker (Durham, NC), respectively.

RNA extraction and cDNA synthesis. RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA), and the total RNA (5 µg) was reverse transcribed using Superscript II reverse transcriptase (Invitrogen) and random oligo(dT) primers (5 mM; New England Biolabs, Beverly, MA).

Construction and screening of subtractive hybridization libraries. Subtractive hybridization was carried out using the PCR-Select subtraction kit (BD Biosciences Clontech, Palo Alto, CA) using mRNA from unstimulated LßT2 cells and those exposed to GnRH for 8 h. The secondary PCR products were cloned into pGEM-T-Easy Vector (Promega, Madison, WI), and the up-regulated sequences were enriched by PCR. The library was plated, and individual colonies were picked for sequencing and identification against GenBank using BLAST (http://www.ncbi.nlm.nih.gov/BLAST).

Real-time PCR. Real-time PCR was carried out using the SYBR green I dye with the ABI Prism 7700 sequence detector (Perkin-Elmer Applied Biosystems). Initially, all PCR products were analyzed on agarose gels to ensure specificity of the amplification. PCRs were performed in a 20-µl volume, containing the PCR Master Mix, forward and reverse primers (for ubc4, 0.1 µM [each] 5'-AATGACCTGGCTCGAGATC-3' and 5'-GCAACCTTAGGCGGTTTGA-3'; for ß-actin, 5'-GCCATGTACGTAGCCATCCA-3' and 5'-ACGCTCGGTCAGGATCTTCA-3'), and 1 µl cDNA template. The samples were heated to 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The templates were serially diluted fivefold in order to ensure that the dynamic ranges of both the target and reference were similar, and the comparative cycle threshold (C_T) method was used to compare mRNA levels in the various samples. All samples were assayed in duplicate.

Stable transfection and enrichment of tagged proteins. The mouse ubiquitin coding sequence was PCR amplified from LßT2 genomic DNA extracted with DNAzol (Invitrogen) using primers designed to include NotI and PacI restriction sites (5'-CCTGAGAGCGGCCGCATGCAGATC-3' and 5'-CCGATTAATTAATTAGCCACCCCTC-3'). The digested product was cloned into pIVEX2.4b (Novagen). The sequence encoding the His tag and ubiquitin was PCR amplified to include BamHI and XhoI restriction sites (CTTTAAGAAGGATCCGCCACCATGGCTGG and 5'-CTCGCTCGAGATCGACTTGCCATG-3') and subcloned into pCMV (Stratagene).

LßT2 cells were transfected with the His-tagged ubiquitin expression vector using GenePORTER 2. After 48 h, cells were split into 96-well plates with around 500 cells per well. Stably transfected cells were selected by gentamicin (150 µg/ml) for 2 weeks, after which individual clones were transferred to six-well plates. After 1 week, these were selected for verification of expression by Western blotting using antisera to the His tag.

The stably transfected cells were lysed by boiling in PBS buffer with 2% SDS, and lysates were incubated at 100°C for 15 min prior to centrifugation (14,000 rpm, 15 min). The extracted protein (500 µg) was loaded onto the His tag binding column (Amersham Biosciences, Piscataway, NJ) preequilibrated with 20 mM imidazole in phosphate-NaCl buffer (20 mM phosphate and 0.5 M NaCl, pH 7.4). After binding for 15 min at RT, the unbound proteins were removed by centrifugation (735 x g for 1 min). The column was washed with 240 mM imidazole in the phosphate-NaCl buffer and incubated for 15 min, after which bound proteins were eluted in 100 µl of 480 mM imidazole. Proteins were precipitated with trichloroacetic acid and resuspended in 25 µl loading buffer before separation on SDS gels and Western analysis, as described above.

Two-hybrid assays. The reporter gene was the Gal4 response element of pG5CAT (Clontech), which was subcloned into the pGL3 firefly luciferase plasmid. The ER cDNA was cloned into the Gal4 DNA binding domain (DBD)-encoding plasmid (pM), and the ER, Sf-1, and Pitx1 cDNAs were cloned into the activation domain-encoding plasmid (pVP16; both from Clontech). Cells were plated at 2 x 10⁴ cells/well in 96-well plates before transfection using 2 µl GenePORTER 2 per well, 0.15 µg of the pM and pVP16 fusion constructs, and 0.1 µg of the reporter gene, with 0.01 µg of simian virus 40-Renilla luciferase as internal control. As marked, ubc4 expression vector was cotransfected at 0.1 µg, and total DNA amounts were equilibrated using pWhitescript. Cells were incubated for 40 h before harvest, with E₂ (Sigma) added to the medium (0.1% volume) for the last 24 h. Luciferase activity was measured and normalized, and reporter gene activity was calculated as activity over basal levels (n-fold) generated from transfection of the unfused pM and pVP16 constructs.

Plasmid immunoprecipitation (PIP). T3-1 cells (60% confluent in 100-mm plates) were transfected with 6 µg DNA and incubated for 24 h before cross-linking by formaldehyde (1%) for 10 min at RT on a shaking platform. Cross-linking was arrested by addition of glycine (0.125 M) for 5 min at RT. Cells were washed twice with 3 ml PBS containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml pepstatin A) before harvest. Cells from each plate were divided into four samples, centrifuged (8,000 rpm, 10 min, 4°C), resuspended in 500 µl SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1, protease inhibitors), and incubated on ice for 10 min. Cell debris was removed (13,000 rpm, 10 min, 4°C) and the supernatant transferred to fresh tubes; a 20-µl aliquot was kept for DNA input quantitation. The remainder was diluted with chromatin immunoprecipitation (ChIP) dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl, protease inhibitors) before preclearance with protein A Sepharose (PAS) (40 µl of 50% [vol/vol]) for 2 h at 4°C on a rotating platform. The PAS was removed (7,000 rpm, 1 min, 4°C) for incubation of the supernatant with ER antisera (H-184; Santa Cruz) overnight at 4°C on a rotating platform.

Proteins were collected by incubation with 40 µl of 50% (vol/vol) PAS (1 h, 4°C on a rotating platform), centrifugation (700 rpm, 1 min, 4°C), and sequential washes (4 min on a rotating platform) with each of the following buffers (1 ml): low-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), high-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl), and LiCl wash buffer (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1). This was followed by two washes with Tris-EDTA. After each wash, the proteins were collected by centrifugation (700 rpm, 1 min at 4°C). The DNA was eluted twice in 250 µl elution buffer (1% SDS, 0.1 M NaHCO₃) and vortexed for 15 min at RT, and the eluate was collected by centrifugation (700 rpm, 1 min). Reverse cross-linking was carried out on the 500 µl combined eluates by incubating at 65°C for 4 h with addition of 5 M NaCl (40 µl) and RNase (2 µl of 100 ng/µl). Further incubation was carried out for 1 h at 45°C in the presence of 10 µl of 0.5 M EDTA, 20 µl of 1 M Tris-HCl, pH 6.5, and 2 µl of 10-mg/ml proteinase K. The precipitated DNA was recovered by phenol-chloroform and extracted with isopropanol-sodium acetate. Reverse cross-linking and extraction were carried out similarly for the input DNA.

Precipitated and input DNA served as template for the PCRs using primers to the CAT3 (AAGTTGGGTAACGCCAGGGT and ACAAGGGTGAACACTATCCC) or CAT6 (GCGACACGGAAATGTTGAAT and ACAAGGGTGAACACTATCCC) vector or the csLHß (TGTGTACAGCAGGGATCTAA and TTCAGGGTTGGATGCTCTGC) or rat LHß (ACGCAAACTCCAACATTAGA and TCCCTACCTTGGGCACTTGG) proximal promoter. Amplified products were separated on ethidium bromide-stained agarose gels.

ChIP. LßT2 cells (80% confluent in 60-mm plates; approximately 5 x 10⁶ cells) were treated with E₂ (10 nM) for 1.5 h before addition of GnRH (100 nM). Cross-linking was carried out and arrested, and cells were rinsed and collected as for PIP but in batches of 4 x 10⁶ cells. Cells were centrifuged (8,000 rpm, 10 min, 4°C), resuspended, and incubated on ice for 10 min in 800 µl SDS lysis buffer. Samples were sonicated with a MISONIX XL2020 sonifier as follows: setting 2, 10 s at 30% duty cycle; setting 1, 10 s at 30% duty cycle with a 30-s interval on ice. Cell debris was removed (13,000 rpm, 10 min, 4°C) and the supernatant transferred to fresh tubes. A 20-µl aliquot was removed, and the remainder was diluted and processed as described above. Regions of the proximal promoters of LHß or ß-actin genes were amplified from input and precipitated samples as in the PIP, using primers as described above or the following primers for ß-actin: 5'-GCCATGTACGTAGCCATCCA-3' and 5'-ACGCTCGGTCAGGATCTTCA-3'. Alternatively, quantification was carried out using real-time PCR with primers on the mouse LHß proximal promoter (5'-GTGAAGCCCACCCACCACGC-3' and 5'-CCTTGGGCACCTGGCTTTAT-3') using ABI Prism 7700 and SYBR green. Each sample was assayed in duplicate, and the amount of precipitated DNA, based on average C_T, was calculated in relation to that in the input sample.

Statistical analysis. One-way analysis of variance (ANOVA) followed by Bonferroni's or Welch's t test were employed to determine means that were statistically different. Differences were considered significant when P was <0.05. All experiments were repeated at least three times, and representative individual experiments or compiled results are presented.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
GnRH leads to ER ubiquitylation and proteasome-dependent degradation in gonadotropes, which is mediated by stimulation of ubiquitin-conjugating enzyme 4. LßT2 gonadotrope cells were exposed to GnRH for 0 to 24 h, after which cells were harvested and lysed and Western analysis was carried out to detect changes in ER protein levels. The ER protein level was slightly reduced after 2 h of GnRH exposure, barely detectable after 8 h, and undetectable after 24 h; a similar decrease in the levels of the GAPDH internal control did not occur (Fig. 1A).

View larger version (32K): [in this window] [in a new window]   FIG. 1. GnRH exposure of gonadotropes causes a reduction in ER protein levels via activation of ubc4. (A) LßT2 cells were cultured and exposed to GnRH for 0 to 24 h. The cells were lysed, and the cell extract was run on 12% SDS gel before Western analysis using antisera to ER (upper panel) or GAPDH (lower panel) as control for protein loading. (B) LßT2 cells were cultured, some were exposed for 24 h to 10 nM E2 or GnRH in the absence or presence of MG132, and levels of ER (upper panel) and GAPDH (lower panel) proteins were assessed as described for panel A. (C) Real-time PCR was carried out on LßT2 cells following GnRH treatment (10 nM; 0 to 8 h), and mRNA levels of ubc4 and ß-actin were measured and are expressed as the levels (n-fold) over those in untreated cells. (D) ubc4 (upper panel) and GAPDH (lower panel) protein levels were measured as in panel A in control cells, in cells treated with GnRH, and in cells in which ubc4 was overexpressed. (E) Protein levels of ubc4 (top panel), ER (middle panel), and GAPDH (lower panel) were measured in LßT2 cells following ubc4 overexpression or transfection of a construct to block its expression (siubc4) and with or without GnRH treatment.

In order to detect global transcriptional activation in gonadotropes resulting from GnRH exposure, subtractive hybridization was carried out in control and GnRH-treated LßT2 cells. One of the clones in the subtracted library contained the coding sequence of ubiquitin-conjugating enzyme 4 (ubc4). The effect of GnRH on the mRNA levels of this gene were confirmed in real-time PCR, which showed a continuing increase in transcript levels between 1 and 8 h of exposure to GnRH, reaching nearly ninefold that in the control cells by 8 h, while levels of ß-actin remained unchanged (Fig. 1C). Western analysis of LßT2 cells confirmed that ubc4 protein levels are higher in LßT2 cells following GnRH treatment and that they could be substantially reduced by transfection of a construct (siubc4) designed to inhibit ubc4 expression (Fig. 1D and E). The transfection of this siubc4 construct increased ER protein levels in cells exposed to GnRH (normalized values, 0.19 ± 0.02-fold over untreated controls [GnRH treated only] versus 1.23 ± 0.15-fold over untreated controls [GnRH treated and siubc4 transfected]), while overexpression of ubc4 reduced the ER protein levels (normalized value, 0.54 ± 0.13 of untreated controls) (representative gel shown in Fig. 1E). Transfection of the siGFP pSUPER plasmid as a negative control did not alter ER protein levels (normalized value, 0.99 ± 0.03-fold of untreated controls) (not shown). These results indicate that the effect of GnRH in reducing ER protein levels could involve its increase in ubc4, which targets ubiquitylation of ER.

In order to examine the ubiquitylation status of ER following GnRH exposure, a stably transfected LßT2 cell line expressing His-tagged ubiquitin was produced. Some of these cells were exposed to GnRH, and the sample was enriched for His-tagged proteins for subsequent Western analysis using ER antisera; unenriched cell extract was run alongside for comparison. The immunoreactive ER in the enriched samples differed from that of the unenriched samples by an additional ca. 10 kDa and was evidently more abundant in GnRH-treated cells, apparently as a result of its increased monoubiquitylation (Fig. 2A). A time course study revealed a maximal effect of GnRH on the ubiquitylated ER after 2 h, while it was virtually undetectable after 8 h of exposure. This corresponded with the levels of unubiquitylated ER, which dropped dramatically between 2 and 4 h of GnRH exposure, as seen in the unenriched cell lysate (Fig. 2B).

View larger version (40K): [in this window] [in a new window]   FIG. 2. GnRH and ubc4 stimulate ER monoubiquitylation. (A) LßT2 cells stably transfected with a His-tagged ubiquitin (Ub) were exposed to GnRH for 2 h. After lysis, the unenriched (10 µg protein/lane) and His tag-enriched (from 500 µg protein) lysates from control and GnRH-treated cells were run simultaneously, and Western analysis was used to detect the ER proteins. (B) The stably transfected LßT2 cells were exposed to GnRH for 0 to 8 h, and the cell lysate was analyzed by Western analysis as above, before (top panel) or after (bottom panel) enrichment for His-tagged proteins. GAPDH levels in the unenriched cell lysate are also shown (middle panel) as loading control. C, control untransfected LßT2 cells.

The liganded ER transactivates LHß directly in synergy with Sf-1 and Pitx1 without requiring a consensus ERE.

View larger version (34K): [in this window] [in a new window]   FIG. 3. The liganded ER transactivates two vertebrate LHß gene promoters in synergy with Sf-1 and Pitx1. (A) The rLHß promoter-CAT6, (B) the csLHß 289-bp proximal promoter-CAT3, (C) the longer 3.3-kbp csLHß promoter-CAT3 with or without deletion of the ERE (at –260 bp), or (D) the rLHß promoter-luciferase constructs were transfected into COS 1 cells alone or with ER, Sf-1, and/or Pitx1 expression vectors. For panels A and B, as indicated, cells were exposed to 10 nM E2 at the time of transfection; for panels C and D, all cells transfected with ER were exposed to E2. Cells were harvested, reporter gene levels were assayed, and normalized values are expressed as the levels (n-fold) over those in control cells. (A to C) Statistical analysis (ANOVA followed by Bonferroni t test) compared mean values separately for groups with and without E2 (for panels A and B) or for intact and ERE-deleted promoter constructs (for panel C), and similar values (P > 0.05) are designated with the same letter in uppercase (for control and intact constructs) or lowercase (for E2-treated or ERE deletion constructs). (D) Welch's t test was used to compare means of treatments with and without cotransfection of ER plus E2. *, P < 0.05; **, P < 0.005. Means ± standard errors of the mean (SEM) are shown (n = 4 to 6).

The mechanism of association of endogenous ER with these LHß proximal promoters in the gonadotropes was demonstrated using PIP. For this, the same LHß-CAT constructs were transfected into mouse gonadotrope T3-1 cells for subsequent cross-linking and pull-down of the ER and associated plasmid DNA. In cells transfected with the rLHß-CAT construct, but not when the empty CAT vector was used, PCR successfully amplified regions of the construct precipitated using ER antisera. Deletion of the distal nonconsensus ERE (at bp –1159) (Fig. 4A) revealed that this element is not required for association of ER with the rLHß gene promoter, and deletion of the distal Sf-1 binding site (at bp –119) alone or together with the ERE also failed to abolish ER binding to the rLHß gene promoter. However, removal of both proximal (at bp –51) and distal Sf-1 binding sites abolished ER association with the promoter; this was in accordance with the binding of Sf-1, which was prevented only by the removal of both Sf-1 binding sites (Fig. 4B). Subsequently, a similar experiment to assess the role of the Pitx1 response element (RE) in association of the ER with the rLHß gene promoter was carried out. Removal of this element revealed that the ER association is considerably reduced compared to the intact control promoter construct but is not abolished (Fig. 4C).

View larger version (51K): [in this window] [in a new window]   FIG. 4. Association of ER with the rLHß promoter requires the Sf-1 REs. (A) Locations of response elements on the rLHß gene promoter for Sf-1, Pitx1, Egr-1, and a distal ERE are shown. (B) The intact rLHß-CAT construct or that lacking the ERE and/or proximal, distal, or both Sf-1 REs was transfected into T3-1 cells; also transfected was the empty CAT6 vector. After 24 h, cells were fixed by formaldehyde before lysis and precipitation of plasmids and associated proteins using antisera to ER or to Sf-1. The cross-linking was reversed and PCR amplification carried out using primers targeting the respective vectors. The top row in each pair (input) shows amplification of the target sequences in the same input samples, and the lower row in each pair (PIP) shows those after precipitation. All treatments were carried out in duplicate, with and without the antisera. (C) Similarly, the intact rLHß-CAT construct and that lacking the Pitx1 RE were transfected into T3-1 cells, and PIP was carried out in duplicate using antisera to ER. Amplification from the input sample is shown, as are those resulting from precipitation with and without antisera. Also shown are nontransfected controls (right column).

View larger version (39K): [in this window] [in a new window]   FIG. 5. Association of ER with the csLHß promoter requires the Sf-1 RE. (A) Locations of response elements on the csLHß gene promoter for Sf-1, Pitx1, and ER are shown. (B and C) PIP assays were carried out using the intact csLHß-CAT construct or (B) that lacking the ERE or the Sf-1 RE; also transfected was the empty CAT3 vector; (C) alternatively, intact and Pitx1 RE-deleted csLHß-CAT constructs were used. Precipitation and other experimental details and presentation of the data are as in Fig. 4.

View larger version (27K): [in this window] [in a new window]   FIG. 6. Activation of the LHß gene promoter by ER requires Sf-1 REs. (A) The intact csLHß-CAT construct and the same construct lacking the ERE, Sf-1 RE, or Pitx1 RE or having combinations of these deletions were transfected into LßT2 cells. (B) Alternatively, the intact rLHß-CAT construct or the same construct lacking the distal ERE, both Sf-1 REs, or the Pitx1 RE were transfected into COS 1 cells, all with or without cotransfection of the ER expression vector and exposure to E2. After 48 h, cells were harvested and CAT/ß-Gal levels assayed and presented as in Fig. 3. Statistical analysis (ANOVA followed by Bonferroni t test) compared mean values separately for groups with or without ER, and similar values (P > 0.05) are designated with the same letter in upper- or lowercase. Additional analysis compared means for the same promoter constructs with or without ER, and only those significantly different are shown. *, P < 0.05. Means ± SEM are shown (n = 3 to 4).

GnRH-induced ubc4 enhances ER transactivation of the LHß gene.

View larger version (33K): [in this window] [in a new window]   FIG. 7. ubc4 is involved in mediating the effect of GnRH on the LHß gene and increases ER transactivation and apparent dimerization and interaction with Sf-1 and Pitx1. (A and B) LßT2 or (C) COS 1 cells were transfected with the csLHß promoter-CAT construct with or without ER, Pitx1, and Sf-1 expression vectors and/or exposed to GnRH, as marked. All cells cotransfected with ER were also exposed to E2. Some of the cells were also transfected with the siubc4 construct or ubc4 expression vector. After 48 h, cells were harvested and CAT/ß-Gal levels were assayed; results are presented as in Fig. 3. (D) Two-hybrid assays were carried out in LßT2 cells using a Gal4 DBD-ER fusion construct with VP16 AD fused to ER, Pitx1, or Sf-1, the Gal4-responsive reporter gene, and a Renilla luciferase construct for internal control; all cells were exposed to E2 (10 nM) at the time of transfection. Luciferase activity was measured 40 h after transfection and is calculated, after normalization and subtraction of any activity of the fusion constructs alone, as the level (n-fold) over the levels in the negative control, in which unfused Gal4 DBD and VP16 AD constructs were transfected (basal level). (A to D) Statistical analysis (ANOVA followed by t test) compared pairs of means for each treatment group, with and without cotransfection of siubc4 or ubc4 expression vector; statistically different means are designated with the following symbols: *, P < 0.05; **, P < 0.01; or ***, P < 0.001. Other values are not significant (N.S.). Means ± SEM are shown (n = 3 to 7).

GnRH and ubc4 increase the association of ER with the LHß gene promoter and lengthen its cycling time. Finally, in order to reveal the effects of GnRH and ubc4 on the association of the endogenous ER with the native mouse LHß promoter, ChIP assays were carried out in mouse LßT2 gonadotropes. Initially, this was to evaluate changes in the association of endogenous ER with the LHß promoter following treatment with GnRH or ubc4 overexpression or knockdown of ubc4 through transfection of the siubc4 construct; all cells except the controls were exposed to E₂. The association of ER with the LHß promoter was evident in all cells exposed to E₂ except those in which the siubc4 construct was transfected. Notably, the siRNA knockdown of ubc4 abolished the clear stimulatory effect of GnRH on ER association with the LHß gene promoter (Fig. 8).

View larger version (37K): [in this window] [in a new window]   FIG. 8. GnRH treatment increases the association of ER with the murine LHß promoter through ubc4. LßT2 cells in 60-mm plates were transfected with ubc4 expression vector, siubc4 construct, or neither, as marked, all in duplicate. After 48 h, all cells except controls were treated with E2 for 90 min before addition of GnRH (100 nM) to some of the cells, as marked. After a further 50 min, ChIP was carried out and PCR used to amplify endogenous mouse LHß gene promoter precipitated by the ER antisera and also in an aliquot from the same batch of cells which was designated as the input sample. Amplification of ß-actin was also performed as a negative control.

View larger version (27K): [in this window] [in a new window]   FIG. 9. GnRH treatment lengthens the cycling times of ER on the murine LHß promoter through ubc4. LßT2 cells were transfected with (A and B) the siubc4 construct, (C) ubc4 expression vector, or neither for 48 h, after which all cells were treated with E2 for 90 min. Some of the cells were then exposed to GnRH (100 nM) for 50 min, after which ChIP was carried out, and real-time PCR measured the association of ER with the endogenous murine LHß gene promoter. Levels of LHß gene promoter precipitated by the ER antisera were calculated in relation to the levels in the aliquot from the same batch of cells, which was designated as the input sample.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

 
We report here a novel form of cross talk between two hormonally induced signaling pathways that regulate LHß gene transcription, in which GnRH activates ER ubiquitylation, apparently through stimulation of ubc4. We further demonstrate that the stimulatory effect of ER on this gene is mediated through interactions with other regulatory transcription factors on the proximal promoter without necessarily requiring an ERE. The GnRH-stimulated ubc4 increases ER binding to the LHß promoter but ultimately also leads to its degradation (Fig. 10). Estrogen has a crucial role in the estrous cycle, regulating precisely the levels of circulating LH, whose surge is crucial in instigating ovulation. The concept that the liganded ER acts as a molecular switch whose activity can be modified locally at the gonadotrope by GnRH-mediated ubiquitylation is in keeping with this regulatory role while adding a novel dimension to the molecular mechanisms regulating gonadotropin synthesis.

View larger version (32K): [in this window] [in a new window]   FIG. 10. Model for the role of GnRH-induced activation of ubc4 and ER ubiquitylation in the activation of LHß gene transcription. GnRH activates formation of the tripartite complex of factors comprising Sf-1, Pitx1, and Egr-1 (3, 11, 20, 58), which bind respective REs on the mammalian LHß gene promoter (distal Sf-1 and Egr-1 REs are not shown). (1) At the same time, GnRH stimulates transcription of ubc4, which leads to ER monoubiquitylation and subsequent recruitment to the DNA-bound complex. Transcription is activated as a result of recruitment of additional coactivators (black shapes) and the general transcription machinery. (2) Transcriptional activation results in recruitment of additional E2 enzymes, E3 ligases, and E4 chain elongation factors to the complex, leading to ER polyubiquitylation, removal from the LHß gene promoter, and degradation by the proteasome. (3) The LHß promoter is available for subsequent activation by ER if the liganded receptor is present.

Results from the present study suggest that ubc4 is the limiting factor for ER ubiquitylation and degradation in the gonadotrope. This was also the case for ubc4- but not ubc2-mediated ubiquitylation of various rat proteins in which immunodepletion decreased and ubc4 administration increased levels of the ubiquitylated proteins (47). Although some E2 enzymes, including ubc4, are able to ubiquitylate the substrate directly, the E3 enzymes are thought to provide a crucial role in substrate recognition (5, 61). ER is known to interact with E6AP, which accepts ubiquitin from ubc4 and was associated with ER in re-ChIP experiments (1, 48). Moreover, gene knockout of E6AP resulted in reproduction-deficient animals with small gonads. However, the females did cycle and even produced litters (56). Given that estrogen-mediated regulation of cyclical circulating LH levels is crucial to ovulation, it is unlikely that E6AP has a role in regulating LHß production. ER has been found to associate with a variety of additional E3 ligases: at the pS2 promoter, ER associates with MDM2 and Rpt6, while other studies have shown ubiquitylation and degradation of ER are mediated through the NEDD8 pathway (12). NEDD8 enhances ubiquitylation by the SCF (Skp1, Cul-1, ROC1, and F-box protein) E3 complex and increases recruitment specifically of ubc4, so increasing polyubiquitylation (24, 57).

We have demonstrated the adverse effect of GnRH and ubc4 on ER protein levels, which appear to be concomitant with the increase in affinity of ER to the LHß gene promoter. The idea that ubc4 ubiquitylates ER and that this regulates its transactivation of the LHß gene concurs with a recent report that ubc4 (UbcH5) is required for ligand-mediated ER transactivation of the pS2 promoter (44). That report further suggested that TBL1 and TBLR1 are the specific adaptor proteins responsible for ubc4 recruitment, which was essential for transactivation by all nuclear receptors tested, although additional more specific E2 enzymes were also recruited: ER requires specifically UbcH7, which may be recruited through interactions with SRC-1 (44, 60). An earlier study demonstrated that the incubation of ER with an E1 enzyme together with both ubc4 and UbcH7 led to degradation of ER but not of progesterone or thyroid hormone receptors (41). Our Western analysis revealed only monoubiquitylated ER, suggesting that this might be a step distinct from subsequent polyubiquitylation and proteasomal degradation; if this were not the case, we would expect to see at least diubiquitylated ER before further chain elongation and recognition by the proteasome. We thus propose that the actions of GnRH-induced ubc4 comprise a prerequisite to subsequent degradation by additional receptor-specific E2 enzymes, possibly reflecting differentially regulated mono- and polyubiquitylation. The molecular mechanisms involved in differentiating between mono- and polyubiquitylation have yet to be defined, and although a recent report suggested the concentration of the E3 ligase could be the determinant (29), the latter may well also require additional enzymes, such as E4 ligases involved in promoting chain assembly, or the inhibition of negative regulators (26, 42) (Fig. 10).

Importantly, in this study we have demonstrated clearly that ER is associated with the LHß gene proximal promoter in murine gonadotropes and, in the presence of ligand, can directly stimulate its transcription. We have shown that the recruitment of ER to the LHß gene promoter requires the Sf-1 RE, while we also demonstrated direct physical interaction between ER and Sf-1 or Pitx1. Our PIP studies show that the ERE is not required for ER binding to either promoter, while our transfection studies also show ER transactivation in the ERE-deleted constructs; from here we conclude that the ERE is not required for ER transactivation of the LHß genes. For the rLHß gene promoter, the Pitx1 RE is also crucial for ER transactivation and may play a role in ER recruitment. The csLHß operates slightly differently due to the presence of a near-consensus ERE which can bind liganded ER but is dispensable when Sf-1 and Pitx1 are overexpressed, while Pitx1 is not crucial to either recruitment of ER or its transactivation. Our findings are consistent with previous studies on the mammalian LHß gene promoter showing that Pitx1's ability to interact synergistically with Sf-1 is largely independent from the requirement for a functional Pitx1 RE (58). The fact that the rLHß gene promoter is unresponsive to the liganded ER unless Sf-1 and Pitx1 are overexpressed indicates a cooperative mechanism of ER recruitment for activation of mammalian LHß genes requiring activation of these other transcription factors. This scenario presents the LHß genes as those that are not predominantly ERE driven, as described by Fan et al. (13), and by their argument, LHß gene activity would less likely be regulated by ER availability, so that ubiquitylation and proteasomal degradation would not result in desensitization. This supports our results which show that the activation of ubc4 by GnRH appears to cause sensitization to ER transactivation, although we have not demonstrated conclusively that this is due to the ER ubiquitylation and not via an indirect mechanism involving additional transcription factors or other signaling molecules.

Enhanced protein-protein interactions have been attributed to monoubiquitylation (21, 38). Although we show both ER dimerization and its interactions with Pitx1 and Sf-1 appear to increase when ubc4 is overexpressed, these proteins do not contain any of the domains known to bind ubiquitin (10, 52, 61). It is possible, therefore, that the increased transactivation of the reporter gene occurs as a result of increased ER interaction with a common coactivator complex, which is independent from but still requires the VP16 AD for transcription initiation in this system. This is feasible, given that a number of coactivators have been shown to contain ubiquitin recognition domains, while the TBLR1-ubc4 complex was proposed to serve specifically to facilitate removal of corepressors and help recruit both the ubiquitin/19S proteasome and the coactivator complex (2, 17, 44). UbcH7 was recently also reported to function as a steroid hormone coactivator, acting through SRC-1 (60). Further studies will be required to understand whether this increased interaction is a direct consequence of the ER ubiquitylation or a result of the recruitment of additional bridging molecules to facilitate the increased association with the LHß gene promoter.

Interestingly, in the gonadotropes, a recent study showed that the ring finger E3, SNURF, coprecipitates with Sf-1 and specifically enhances LHß gene transcription (7). The proposed mechanism for this enhancement was through repressing suppression by androgen receptor which inhibits transcription of this gene through interactions with Sf-1 (23). However, SNURF, which also serves as a coactivator for ER, accepts ubiquitin from ubc4 and is up-regulated by estrogen exposure (18, 22, 51). It is plausible, therefore, that the effects of SNURF on LHß gene transcription are in fact through ER ubiquitylation whose increased association with the preinitiation complex, and specifically Pitx1, facilitates competition of the latter with androgen receptor for binding to the putative ligand binding domain of Sf-1 (see reference 59).

Given the fact that GnRH activates a number of factors which bind the proximal LHß promoter, we initially hypothesized that GnRH exposure would facilitate formation of this complex and thus would shorten the cycling time of ER on and off the LHß gene promoter. Our results show that this is not the case and that ER is, in fact, associated with the promoter for longer cycles following GnRH treatment. This is concomitant with an increase in transactivation of the LHß gene, possibly suggesting a change in rate of the stochastic reactions involved in the recruitment of regulatory factors to the promoter. The GnRH exposure also increases the amount of LHß gene promoter associated with ER, indicating an increase in its affinity, presumably as a result of stronger interaction with the gene-specific and preinitiation transcriptional complexes. This is at least partly due to ubiquitylation, as ubc4 overexpression increases ER association with the promoter and increases synergistic actions of the three transcription factors on LHß promoter activity. Conversely, blocking ubc4 expression reduces the ability of ER to associate with the promoter and also virtually abolishes the GnRH effect on promoter activity, indicating not only that ubc4 is required for ER activity but also that ER is crucial in mediating the GnRH effect on the LHß gene.

Our results thus present a scenario in which the level of ER ubiquitylation is directly regulated by the signaling pathway of a cell membrane-bound hormone and so increases transactivation of the target gene. This provides a new form of cross talk in hormonally stimulated regulation of gene expression which may be widespread while also revealing novel aspects to the molecular mechanisms regulating gonadotropin synthesis.

	ACKNOWLEDGMENTS

 
We thank J. Drouin, F. Pakdel, and K. Parker for the Pitx1, hER, and Sf-1 expression vectors and P. Mellon for the LßT2 cells.

This research was supported by the Academic Research Fund and the Office of Life Sciences, National University of Singapore. M.K. is a recipient of a Singapore Millennium Foundation scholarship, and P.M. is a recipient of the Young Investigator Award, Office of Life Sciences, National University of Singapore.

	FOOTNOTES

 
* Corresponding author. Mailing address: Functional Genomics Laboratories, Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117542, Singapore. Phone: (65) 68741882. Fax: (65) 68722013. E-mail: dbsmp{at}nus.edu.sg.

Authors contributed equally.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Anan, T., Y. Nagata, H. Koga, Y. Honda, N. Yabuki, C. Miyamoto, A. Kuwano, I. Matsudam, F. Endo, H. Saya, and M. Nakao. 1998. Human ubiquitin-protein ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitin-conjugating enzymes. Genes Cells 3:751-763.[Abstract]

2. Brower, C. S., S. Sato, C. Tomomori-Sato, T. Kamura, A. Pause, R. Stearman, R. D. Klausner, S. Malik, W. S. Lane, I. Sorokina, R. G. Roeder, J. W. Conaway, and R. C. Conaway. 2002. Mammalian mediator subunit mMED8 is an Elongin BC-interacting protein that can assemble with Cul2 and Rbx1 to reconstitute a ubiquitin ligase. Proc. Natl. Acad. Sci. USA 99:10353-10358.[Abstract/Free Full Text]

3. Brown, P., and A. S. McNeilly. 1999. Transcriptional regulation of pituitary gonadotrophin subunit genes. Rev. Reprod. 4:117-124.[Abstract]

4. Colin, I. M., and J. L. Jameson. 1998. Estradiol sensitization of rat pituitary cells to gonadotropin-releasing hormone: involvement of protein kinase C- and calcium-dependent signaling pathways. Endocrinology 139:3796-3802.[Abstract/Free Full Text]

5. Conaway, R. C., C. S. Brower, and J. W. Conaway. 2002. Gene expression—emerging roles of ubiquitin in transcription regulation. Science 296:1254-1258.[Abstract/Free Full Text]

6. Cowley, M. A., C. Chen, and I. J. Clarke. 1999. Estrogen transiently increases delayed rectifier, voltage-dependent potassium currents in ovine gonadotropes. Neuroendocrinology 69:254-260.[CrossRef][Medline]

7. Curtin, D., H. A. Ferris, M. Hakli, M. Gibson, O. A. Janne, J. J. Palvimo, and M. A. Shupnik. 2004. Small nuclear RING finger protein stimulates the rat luteinizing hormone ß promoter by interacting with Sp1 and steroidogenic factor-1 and protects from androgen suppression. Mol. Endocrinol. 18:1263-1276.[Abstract/Free Full Text]

8. de Jager, T., T. Pelzer, S. Muller-Botz, A. Imam, J. Muck, and L. Neyses. 2001. Mechanisms of estrogen receptor action in the myocardium. Rapid gene activation via the ERK1/2 pathway and serum response elements. J. Biol. Chem. 276:27873-27880.[Abstract/Free Full Text]

9. Demay, F., M. De Monti, C. Tiffoche, C. Vaillant, and M. L. Thieulant. 2001. Steroid-independent activation of ER by GnRH in gonadotrope pituitary cells. Endocrinology 142:3340-3347.[Abstract/Free Full Text]

10. Di Fiore, P. P., S. Polo, and K. Hofmann. 2003. When ubiquitin meets ubiquitin receptors: a signalling connection. Nat. Rev. Mol. Cell Biol. 4:491-497.[CrossRef][Medline]

11. Dorn, C., Q. L. Ou, J. Svaren, P. A. Crawford, and Y. Sadovsky. 1999. Activation of luteinizing hormone ß gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. J. Biol. Chem. 274:13870-13876.[Abstract/Free Full Text]

12. Fan, M. Y., R. M. Bigsby, and K. P. Nephew. 2003. The NEDD8 pathway is required for proteasome-mediated degradation of human estrogen receptor (ER) and essential for the anti proliferative activity of ICI 182,780 in ER -positive breast cancer cells. Mol. Endocrinol. 17:356-365.[Abstract/Free Full Text]

13. Fan, M. Y., H. Nakashatri, and K. P. Nephew. 2004. Inhibiting proteasomal proteolysis sustains estrogen receptor- activation. Mol. Endocrinol. 18:2603-2615.[Abstract/Free Full Text]

14. Ferdous, A., F. Gonzalez, L. P. Sun, T. Kodadek, and S. A. Johnston. 2001. The 19S regulatory particle of the proteasome is required for efficient transcription elongation by RNA polymerase II. Mol. Cell 7:981-991.[CrossRef][Medline]

15. Gharib, S. D., M. E. Wierman, M. A. Shupnik, and W. W. Chin. 1990. Molecular biology of the pituitary gonadotropins. Endocr. Rev. 11:177-199.[Medline]

16. Gonzalez, F., A. Delahodde, T. Kodadek, and S. A. Johnston. 2002. Recruitment of a 19S proteasome subcomplex to an activated promoter. Science 296:548-550.[Abstract/Free Full Text]

17. Grossman, S. R., M. E. Deato, C. Brignone, H. M. Chan, A. L. Kung, H. Tagami, Y. Nakatani, and D. M. Livingston. 2003. Polyubiquitination of p53 by a ubiquitin ligase activity of p300. Science 300:342-344.[Abstract/Free Full Text]

18. Hakli, M., K. L. Lorick, A. M. Weissman, O. A. Janne, and J. H. Palvimo. 2004. Transcriptional coregulator SNURF (RNF4) possesses ubiquitin E3 ligase activity. FEBS Lett. 560:56-62.[CrossRef][Medline]

19. Hall, J. M., J. F. Couse, and K. S. Korach. 2001. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J. Biol. Chem. 276:36869-36872.[Free Full Text]

20. Halvorson, L. M., M. Ito, J. L. Jameson, and W. W. Chin. 1998. Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone ß-subunit gene expression. J. Biol. Chem. 273:14712-14720.[Abstract/Free Full Text]

21. Hicke, L. 2001. Protein regulation by monoubiquitin. Nat. Rev. Mol. Cell Biol. 2:195-201.[CrossRef][Medline]

22. Hirvonen-Santti, S. J., V. Sriraman, M. Anttonen, S. Savolainen, J. J. Palvimo, M. Heikinheimo, J. S. Richards, and O. A. Janne. 2004. Small nuclear RING finger protein expression during gonad development: regulation by gonadotropins and estrogen in the postnatal ovary. Endocrinology 145:2433-2444.[Abstract/Free Full Text]

23. Jorgensen, J. S., and J. H. Nilson. 2001. AR suppresses transcription of the LHß subunit by interacting with steroidogenic factor-1. Mol. Endocrinol. 15:1505-1516.[Abstract/Free Full Text]

24. Kawakami, T., T. Chiba, T. Suzuki, K. Iwai, K. Yamanaka, N. Minato, H. Suzuki, N. Shimbara, Y. Hidaka, F. Osaka, M. Omata, and K. Tanaka. 2001. NEDD8 recruits E2-ubiquitin to SCF E3 ligase. EMBO J. 20:4003-4012.[CrossRef][Medline]

25. Keri, R. A., M. W. Wolfe, T. L. Saunders, I. Anderson, S. K. Kendall, T. Wagner, J. Yeung, J. Gorski, T. M. Nett, S. A. Camper, and J. H. Neilson. 1994. The proximal promoter of the bovine luteinizing hormone ß-subunit gene confers gonadotrope-specific expression and regulation by gonadotropin-releasing hormone, testosterone, and 17ß-estradiol in transgenic mice. Mol. Endocrinol. 8:1807-1816.[Abstract]

26. Koegl, M., T. Hoppe, S. Schlenker, H. D. Ulrich, T. U. Mayer, and S. Jentsch. 1999. A novel ubiquitylation factor, E4, is involved in multiubiquitin chain assembly. Cell 96:635-644.[CrossRef][Medline]

27. Le Dréan, Y., D. Liu, A. O. L. Wong, F. Xiong, and C. L. Hew. 1996. Steroidogenic factor 1 and estradiol receptor act in synergism to regulate the expression of the salmon gonadotropin IIß subunit gene. Mol. Endocrinol. 10:217-229.[Abstract]

28. Le Dréan, Y., D. Liu, F. Xiong, and C. L. Hew. 1997. Presence of cis-acting elements on gonadotropin gene promoters in diverse species dictates the selective recruitment of different transcription factors by steroidogenic factor-1. Mol. Cell. Endocrinol. 135:31-40.[CrossRef][Medline]

29. Li, M. Y., C. L. Brooks, F. Wu-Baer, D. L. Chen, R. Baer, and W. Gu. 2003. Mono- versus polyubiquitylation: differential control of p53 fate by Mdm2. Science 302:1972-1975.[Abstract/Free Full Text]

30. Lipford, J. R., and R. J. Deshaies. 2003. Diverse roles for ubiquitin-dependent proteolysis in transcriptional activation. Nat. Cell Biol. 5:845-850.[CrossRef][Medline]

31. Liu, D., F. Xiong, and C. L. Hew. 1995. Functional analysis of estrogen responsive elements in Chinook salmon (Oncorhynchus tschawytscha) gonadotropin IIß subunit gene. Endocrinology 136:3486-3493.[Abstract]

32. Lonard, D. M., Z. Nawaz, C. L. Smith, and B. W. O'Malley. 2000. The 26S proteasome is required for estrogen receptor and coactivator turnover and for efficient estrogen receptor transactivation. Mol. Cell 5:939-948.[CrossRef][Medline]

33. Lu, Q., H. Ebling, J. Mittler, W. E. Baur, and R. H. Karas. 2002. MAP kinase mediates growth factor-induced nuclear translocation of estrogen receptor . FEBS Lett. 516:1-8.[CrossRef][Medline]