Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Park, J. Articles by Choe, J. Search for Related Content PubMed PubMed Citation Articles by Park, J. Articles by Choe, J.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, September 2005, p. 8202-8214, Vol. 25, No. 18
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.18.8202-8214.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Sumoylation of the Novel Protein hRIPß Is Involved in Replication Protein A Deposition in PML Nuclear Bodies

Junsoo Park, Taegun Seo, Hakzoo Kim, and Joonho Choe^*

Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejon 305-701, South Korea

Received 24 January 2005/ Returned for modification 28 February 2005/ Accepted 15 June 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
Replication protein A (RPA) is a single-stranded-DNA-binding protein composed of three subunits with molecular masses of 70, 32, and 14 kDa. The protein is involved in multiple processes of eukaryotic DNA metabolism, including DNA replication, repair, and recombination. In Xenopus, Xenopus RPA-interacting protein has been identified as a carrier molecule of RPA into the nucleus. In this study, human RPA-interacting protein (hRIP) and five novel splice isoforms (named hRIP, hRIPß, hRIP, hRIP1, hRIP2, and hRIP3 according to the lengths of their encoding peptides) were cloned. Among hRIP isoforms, hRIP and hRIPß were found to be the major splice isoforms and to show different subcellular localizations. While hRIP localized to the cytoplasm, hRIPß was found in the PML nuclear body. Modification of hRIPß by sumoylation was found to be required for localization to the PML nuclear body. The results of the present work demonstrate that hRIPß transports RPA into the PML nuclear body and releases RPA upon UV irradiation. hRIPß thus plays an important role in RPA deposition in PML nuclear bodies and thereby supplements RPA for DNA metabolism.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Replication protein A (RPA) (also known as replication factor A) is a single-stranded-DNA-binding protein that is composed of three subunits of 70, 32, and 14 kDa and involved in multiple processes of eukaryotic DNA metabolism, including DNA replication, repair, and recombination (10, 39, 40). RPA binds tightly to single-stranded DNA but also interacts with double-stranded DNA with much lower affinity (21, 41). This binding activity of RPA has been localized to the 70-kDa subunit (20, 25, 41).

Several groups have reported the 32-kDa subunit of RPA to be phosphorylated in a cell cycle-dependent manner (8, 11) or in response to DNA-damaging reagents such as ionizing radiation, UV radiation, and camptothecin (5, 23, 26, 29, 33, 37, 38). The cyclin-dependent kinase family plays a central role in phosphorylating RPA p32 for the regulation of DNA replication and for progression through the cell cycle (9, 11, 12). Several protein kinases, including DNA-dependent protein kinase and ataxia-telanogiectasia mutated, have been implicated in the DNA damage-induced phosphorylation of RPA p32 (3, 4, 13, 24, 26, 29).

Since RPA localizes primarily to the nucleus, RPA should be transported into the nucleus by the cellular transport machinery. Yeast two-hybrid screening identified Xenopus RPA-interacting protein (xRIP) as a carrier molecule for the import of RPA into the nucleus (19). Specifically, xRIP was found to serve as an adapter molecule, linking RPA to importin ß just as importin links nuclear localization signal-containing proteins to importin ß.

The xRIP protein can be divided into three subdomains (19): the N-terminal domain (amino acids 1 to 45) is rich in basic residues, the central domain (amino acids 46 to 140) is acidic, and the C terminus contains a putative zinc finger domain (amino acids 141 to 226). While the N-terminal domain is responsible for interaction with importin ß, the central region interacts with RPA (19).

Because xRIP is conserved among higher eukaryotes but not in yeast, higher eukaryotes and yeast employ divergent pathways for the import of RPA. In yeast, Msn5p protein was identified as a carrier molecule that imports RPA into the nucleus but is also involved in the export of other cargo molecules (42).

The nucleus is compartmentalized into highly organized structures, with numerous subnuclear structures identified by their biochemical function (44). The PML (promyelocytic leukemia) nuclear body is one of these subnuclear structures and has a diameter of between 0.2 and 1 µm (44). Cells generally contain 10 to 30 PML bodies per nucleus. The formation of PML nuclear bodies is dependent on the PML gene, with inactivation of the PML gene resulting in complete disruption of PML nuclear bodies (18, 43). Several PML nuclear body components have recently been identified.

While PML nuclear bodies are present in many cells, they are not essential for cell survival. The nonessential nature of the PML nuclear bodies suggests that they are regulated depots in the nucleus (28). Negorev and Maul postulated a nuclear defense mechanism whereby PML nuclear bodies recruit specific proteins and release them upon an external stress such as heat shock or UV irradiation (28). Supporting this hypothesis of a defensive role for PML nuclear bodies, Bischof et al. (2) found them to contain several proteins associated with DNA metabolism and, specifically, with DNA repair and recombination.

The PML nuclear body is considered to be a nuclear organelle, although it is more accurately described as an aggregate of PML-associated proteins and its formation is dependent on the specific interactions of these aggregated proteins. Sumoylation plays an important role in PML nuclear body formation, as demonstrated by a PML-3K mutant lacking SUMO modification sites (43). The PML-3K mutant aberrantly localizes to the nucleus and fails to recruit nuclear body proteins such as Sp100. Sumoylation of PML bodies is further associated with release of various proteins from the PML nuclear body. Such external stressors as heat shock induce the desumoylation of PML nuclear body proteins and lead to their release (27). A SUMO isopeptidase, SENP-1, has been identified as one component of PML-associated proteins (14). SENP-1 removes SUMO-1 conjugates from PML body-associated proteins and releases them from the PML nuclear body (27, 28).

Recently, it was reported that a fraction of RPA localizes to the PML nuclear body with other components of the DNA repair machinery (1, 2, 31). Additionally, DNA-damaging agents such as ionizing radiation and UV were shown to lead to the translocation of RPA to the site of DNA damage (1, 45). The present study demonstrated that the hRIP gene encodes human RIP (hRIP) and that alternative splicing leads to multiple isoforms of this protein. Further, the splice isoforms of hRIP were found to deposit RPA into PML nuclear bodies and then release RPA upon UV irradiation.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell culture and transfection. HeLa, HEK293T, U2OS, and COS cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum; Jurkat and BJAB cells were grown in RPMI medium also supplemented with 10% fetal bovine serum. Transfections of HEK293T and COS cells were carried out using the standard calcium phosphate method (15). Leptomycin B and actinomycin D were purchased from Sigma (St. Louis, MO) and used at final concentrations of 20 nM and 5 µg/ml, respectively. Jurkat cell synchronization was performed by the thymidine double block as shown previously (17). For UV treatment, cells were irradiated with 254-nm UV light from a Spectrolinker XL-1000 (Spectroline, Westbury, NY). Because UV light of this wavelength penetrates poorly into water, the medium was replaced with a thin layer of phosphate-buffered saline (PBS) during UV irradiation.

Immunofluorescence and confocal microscopy. Cells were grown on sterilized glass coverslips, fixed with 4% paraformaldehyde, and blocked with 0.1% bovine serum albumin in PBS. Cells were stained with 1:500-diluted primary antibody in PBS and then reacted with 1:5,000-diluted Alexa 488-conjugated or Alexa 568-conjugated secondary antibody (Vector, Burlingame, CA). Finally, slides were washed three times with PBS and mounted in mounting medium (Vector). Images were captured with a Zeiss confocal microscope (Oberkochen, Germany). For counterstaining, slides were incubated in 100 µg/ml DNase-free RNase for 30 min at room temperature and then stained with 500 nM propidium iodide (Sigma) in PBS.

cDNA cloning and plasmid construction. Reverse transcription-PCR (RT-PCR) was used to amplify the entire coding region of hRIP and its splicing variants from Jurkat-T RNA, using the 5' primer GGGCTCGAGATGGCGGAGTCGTTGAGGTCTC and the 3' primer GGGTCTAGACTAGAGGATCACAGCCCAAG. The amplified cDNA fragments were ligated into pcDNA3/HA and completely sequenced. After sequencing, cDNA for hRIP or hRIPß was subcloned into pGEX4T-1 and pEBG plasmids. Point mutants of hRIP and hRIPß were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), and each mutant was completely sequenced to verify the presence of the intended mutation and the absence of any others.

Human RPA p70 cDNA was kindly provided by M. S. Wold (16). To generate FLAG-tagged RPA p70, RPA p70 cDNA was amplified by PCR and subcloned into pME18S plasmids (34). The plasmid encoding His-tagged SENP1 was provided by C. Y. Choi (SKKU, Korea), the importin ß cDNA was provided by D. Gorlich (22), and SENP1 small interfering RNA (siRNA) was provided by E. T. Yeh (6, 7).

Antibody production, immunoprecipitation, and immunoblotting. Glutathione S-transferase (GST)-hRIP fusion protein was used as a source antigen for anti-hRIP antibody production. The GST fusion protein was prepared as described previously (35) and used to immunize rabbits with mixed Freund's adjuvant (Sigma). Nonspecific antibodies were removed from anti-hRIP antibody to produce a purified mechanism for the detection of the endogenous protein. Anti-hRIP antibody was mixed with GST protein-bound beads for 10 min at 4°C. After brief centrifugation, the supernatant was transferred and used for immunostaining. Anti-hRIPAS (alpha-specific) antibody was generated using an GST-hRIP deletion mutant (amino acids 107 to 219), and the antibody, which recognized GST-hRIPß recombinant protein, was removed to obtain specificity to hRIP as described above. Antibodies for RPA p70 and p32 were generously provided by B. Stillman (8), while antibodies for PML and lamin were purchased from Santa Cruz (Santa Cruz, CA) and antibody for SENP1 was purchased from IMGENEX (San Diego, CA).

For immunoprecipitation, cells were harvested and resuspended in lysis buffer (150 mM NaCl, 50 mM HEPES [pH 8.0], 0.5% NP-40) containing a protease inhibitor cocktail (Roche, Germany). Immunoprecipitated proteins from precleared cell lysates were used for immunoblotting. Immunoblot detection was performed with a 1:1,000 or 1:2,000 dilution of primary antibody and an enhanced chemiluminescence system (ECL; Amersham, Chicago, IL). To detect the sumoylated protein, cells were washed with PBS and directly lysed with sodium dodecyl sulfate (SDS) loading buffer (100 mM Tris-HCl [pH 6.8], 20% glycerol, 4% SDS, 0.001% bromophenol blue) supplemented with 20 µM N-ethylmaleimide (Sigma). Finally, cell lysates were boiled for 5 min, spun in a centrifuge for 10 min at 13,000 rpm, and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE).

Subcellular fractionation. Cells were harvested with 500 µl CLB buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 1 mM KH₂PO₄, 5 mM NaHCO₃, 1 mM CaCl₂, 0.5 mM MgCl₂) with a protease inhibitor cocktail. Cells were allowed to swell for 5 min and were then homogenized 50 times using a Dounce homogenizer (Wheaton, Millville, IL). Cell lysates were spun for 10 min at 7,500 rpm in a centrifuge at 4°C, and the cytoplasmic fraction was transferred to a clean tube. The nuclear pellet was washed once with CLB buffer before being lysed by addition of SDS loading buffer.

Nucleotide sequence accession numbers. The nucleotide and deduced amino acid sequences of the seven novel cDNAs identified in this study have been registered in GenBank (accession numbers AY680654 to AY680660).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of hRIP and its isoforms. Searches of the expressed sequence tag database identified the hRIP protein as a human homologue of xRIP, with the two proteins displaying similar domain structures (19). hRIP cDNA was obtained by RT-PCR using RNA extracted from Jurkat cells as a template and primers complementary to the 5' and 3' ends of the hRIP open reading frame, which encodes the full-length hRIP protein (Fig. 1A).

View larger version (64K): [in this window] [in a new window]

FIG. 1. hRIP gene structure and alternative splicing. (A) Schematic diagram of the hRIP gene and the alternative splicing that leads to its multiple isoforms. Coding exons are indicated by black boxes, as mapped on bacterial artificial chromosome (BAC) clone HCIT524C5. (B) Alternative splicing of the hRIP gene. The mRNA transcripts of hRIP were analyzed by reverse transcription-PCR using total RNA from the indicated human cell lines. (C) Structure of alternative splicing products of the hRIP gene. Exons are shown as boxes, while introns have been omitted. The protein products are shown as arrows under each isoform. Seven novel cDNAs were identified, and their GenBank accession numbers are indicated. aa, amino acids. (D) Alignment of hRIP and its isoforms. hRIP, hRIPß, hRIP, hRIP1, hRIP2, and hRIP3 were aligned using the CLUSTALW multiple-alignment program. Identical sequences are shaded. N-terminal sequences (residues 1 to 104) are conserved among all isoforms.

RT-PCR analysis revealed that hRIP yields seven splice isoforms, and various cell lines, including HeLa, U2OS, BJAB, Jurkat, and HEK293T, were employed to verify expression of the alternatively spliced mRNAs (Fig. 1B). Characterization of the splice isoforms of hRIP was accomplished by cloning the various PCR products into a hemagglutinin (HA)-tagged eukaryotic expression vector (pcDNA3/HA) and obtaining their nucleotide sequences by standard methods. Seven isoforms were cloned, and nucleotide sequencing indicated that each was derived from a unique combination of hRIP exons 1 through 7 (Fig. 1B and C).

Any one of the seven clones can potentially encode the polypeptide, and further analysis was necessary. The present work yielded seven different cDNA clones, but two of these (hRIP1a and hRIP1b) were found to encode the same polypeptide (hRIP1). Thus, a total of six polypeptides were produced through alternative splicing of the hRIP gene (Fig. 1B and C). The longest gene product was the hRIP protein, and the smaller polypeptides were named hRIPß, hRIP, hRIP1, hRIP2, and hRIP3 in order of decreasing length. While hRIP and hRIPß are terminated by the same codon, the termination codons of the remaining clones are produced by a frameshift within their cDNA sequences. hRIP1, hRIP2, and hRIP3 have been grouped into the hRIP family, as they differ by only 2 or 3 amino acids while sharing 104 amino acids (Fig. 1D).

hRIPß localizes to the PML nuclear body. In order to determine which of the splice variants indeed encode the protein of interest, hRIP and its various splice isoforms were expressed in rabbit reticulocytes in the presence of [³⁵S]methionine. PAGE revealed that hRIP and all of its isoforms could be translated into a protein of the appropriate size in vitro (Fig. 2A). Their expression in the eukaryotic cell was verified by transfection of plasmids encoding hRIP and its isoforms into HEK293T cells and subsequent immunoblot analysis with anti-HA antibody. While hRIP and hRIPß proteins were readily detected, the expression of other isoforms was low, indicating that hRIP and hRIPß are the major splice isoforms in vivo (Fig. 2B). Frequently throughout the experiment reported here, hRIPß expression resulted in a shifted band at around 45 kDa that will be discussed further in the next section.

View larger version (50K): [in this window] [in a new window]

FIG. 2. Expression analysis of hRIP and its isoforms and differential localization of hRIP and hRIPß. (A) In vitro translation of hRIP and its isoforms. hRIP and its isoforms were translated in vitro using [35S]methionine and analyzed by 15% SDS-PAGE. (B) Transient expression of hRIP and its isoforms. Plasmids encoding hRIP and its isoforms were transiently transfected into HEK293T cells. Equal amounts of protein were subjected to SDS-PAGE, and hRIP and its isoforms were identified by immunoblotting (IB) with anti-HA antibody. Nontransfected cell lysate was also probed with anti-hRIP antibody and anti-hRIPAS antibody to show expression of the endogenous proteins. The star indicates nonspecific bands. (C) Differential localization of hRIP and hRIPß. HEK293T cells or COS cells were transiently transfected with plasmids encoding hRIP or hRIPß. The transfected cells were fixed and then immunostained with anti-hRIP or anti-HA antibody. DNA was visualized using propidium iodide staining. Bars, 10 µm. (D) Subcellular fractionation of hRIP- and hRIPß-transfected cells. Extracts from transfected cells were fractionated to give cytoplasmic (C) and nuclear (N) fractions as described in Materials and Methods. Aliquots of 5% of each fraction were immunoblotted with anti-HA (upper panel) and antilamin (bottom panel) antibodies. (E) hRIPß localizes to the PML nuclear body. Cells were prepared as for panel A and immunostained with anti-hRIP antibody (green) and anti-PML antibody (red).

Endogenous expression of hRIP and hRIPß was demonstrated by generating a rabbit polyclonal antibody against bacterially expressed GST-hRIP recombinant protein that contained full-length hRIP and was named hRIP antibody. Additionally, an hRIP-specific antibody was generated using hRIP-specific exon 6 domain to recognize the endogenous hRIP expression and was named hRIPAS (alpha-specific) antibody. A GST-hRIP deletion mutant (amino acid 107 to 219) was used to immunize rabbits, and the antibody, which recognized GST-hRIPß recombinant protein, was removed to obtain specificity to hRIP as described in Materials and Methods. Immunoblotting with the hRIP antibody revealed that it could recognize the double bands near 30 kDa as well as the 45-kDa band. The larger band is consistent with the shifted band of HA-hRIPß, while the two smaller bands approximate HA-hRIP and HA-hRIPß. Finally, immunoblotting with the hRIPAS antibody demonstrated that the upper of the smaller two bands is hRIP. These findings strongly support hRIP and hRIPß as the major translation products of the hRIP gene (Fig. 2B).

Since hRIP and hRIPß are predominantly expressed in eukaryotic cells, the initial focus here was on the subcellular localization of these two isoforms. Plasmids encoding HA-hRIP and HA-hRIPß were transiently expressed in HEK293T cells, which were then immunostained with anti-hRIP antibody. Confocal microscopy revealed hRIP to be localized primarily in the cytoplasm but also detectable in the nucleus. By contrast, the majority of hRIPß was localized to the nucleus with a dot-like staining pattern (Fig. 2C). These results were confirmed in an analogous experiment with COS cells and anti-HA antibody (Fig. 2C). The distinct subcellular localizations of hRIP and hRIPß were corroborated by transient expression of hRIP and hRIPß in cells that were subjected to cellular fractionation to give cytoplasmic and nuclear fractions. While the majority of hRIP proteins were detected in the cytoplasmic fraction, hRIPß proteins were mostly found in the nuclear fraction (Fig. 2D). Taken together, these results indicate that hRIP and hRIPß indeed display distinct subcellular localization patterns.

After observing the dot-like localization of hRIPß in the nucleus, investigation shifted to further characterizing these dot-like structures. Previous studies had documented that RPA, the binding partner of hRIP, was often found in PML nuclear bodies (1, 2, 31), and because of this finding it was postulated here that the observed nuclear spots may have indeed been PML nuclear bodies. This hypothesis was tested by transfecting plasmids encoding hRIP and hRIPß into HEK293T cells and then double immunostaining with anti-hRIP antibody (rabbit, green) and anti-PML antibody (mouse, red). Confocal microscopy revealed that more than 90% of hRIPß foci were completely associated with PML spots in the transiently transfected cells, indicating that hRIPß localized to the PML nuclear body (Fig. 2E).

Sumoylation of hRIPß. When hRIPß was transiently expressed in HEK293T cells, there was repeated detection of a more slowly migrating form of hRIPß (slower by 20 kDa). This band was also detected by anti-hRIP blotting using endogenous proteins (Fig. 2B). Because many proteins in the PML nuclear body are modified by sumoylation (28, 44), it was assumed that the larger band was the sumoylated form of hRIPß. This hypothesis was investigated by determining whether hRIPß was in fact sumoylated in vivo.

Transfections were performed that paired plasmids encoding HA-hRIP and HA-hRIPß with plasmids for FLAG-SUMO-1 and thus revealed if conjugation was taking place. Figure 3A shows that the more slowly migrating form of hRIPß was detected by both anti-HA and anti-FLAG antibodies but was not detected with anti-FLAG antibody in the absence of FLAG-SUMO-1 expression. These findings indicate that the slower-migrating hRIPß band is the sumoylation product of the protein.

View larger version (64K): [in this window] [in a new window]

FIG. 3. Sumoylation of hRIPß and generation of SUMO-deficient hRIPß mutants. (A) Sumoylation of hRIPß. HEK293T cells were transiently transfected with plasmids encoding hRIP or hRIPß in combination with a plasmid encoding FLAG-SUMO-1. Cell lysates were probed with anti-HA antibody (upper panel) and anti-FLAG antibody (lower panel). IB, immunoblotting. (B) Immunoprecipitation (IP) of FLAG-SUMO-1-conjugated HA-hRIPß protein. Cells were transfected with hRIPß in combination with a plasmid encoding FLAG-SUMO-1, and the lysates were boiled and immunopurified with anti-FLAG antibody. FLAG-SUMO-1-conjugated HA-hRIPß protein was probed with anti-HA antibody. WCL, whole-cell lysate. (C) Generation of SUMO-deficient hRIPß mutants. Cells were transfected with plasmids encoding hRIP, hRIPß, hRIPß KM-1 (K103N), hRIPß KM-2 (K114R), hRIPß KM-3 (K121R), hRIPß 2KM-1 (K103N and K114R), hRIPß 2KM-2 (K103N and K121R), and hRIPß 4KM (K103N, K114R, K121R, and K142R). Cell lysates were immunoblotted with anti-HA antibody. (D) hRIPß colocalizes with GFP-SUMO-1. Panels i to iii, cells were transfected with hRIP, hRIPß, and hRIPß 4KM in combination with GFP-SUMO-1 (green) and immunostained with anti-HA antibody (red). Panel iv, colocalization of GFP-SUMO-1 with PML body was also shown. Bars, 10 µm.

So as to provide further evidence for the sumoylation of hRIPß in vivo, sumoylated hRIPß was immunopurified. SUMO protease is capable of readily cleaving the isopeptide bond between SUMO and the target protein, so the cell lysate was boiled to inactivate SUMO protease (32). The denatured cell lysates were incubated with anti-FLAG antibody in order to purify proteins conjugated to FLAG-SUMO-1, and the resulting precipitates were probed with anti-HA antibody for detection of HA-hRIPß. The band corresponding to FLAG-SUMO-1-conjugated HA-hRIPß was purified and positively identified by anti-HA antibody (Fig. 3B). hRIPß was thus shown to be a substrate for sumoylation.

The obvious extension of showing that hRIPß can be sumoylated was to determine the significance of such a modification to the protein. To this end, a SUMO-deficient mutant of hRIPß was generated: the lysine residue of the sumoylation consensus sequence (IKQE) was replaced with asparagine (30). Yet sumoylation of hRIPß was not completely diminished by the K103N mutation (hRIPß KM-1) (Fig. 3C), and the other lysine residues were replaced by arginine so as to generate additional mutants. As shown in Fig. 3C, sumoylation of hRIPß 2KM-2 (carrying both the K103N and K121R mutations) was significantly reduced, and the sumoylated form was completely lost for hRIPß 4KM, modified by the K103N and K114,121,142R mutations. This strongly implicates the multiple lysine residues as the acceptor site of sumoylation (Fig. 3C).

Establishment of the sumoylation-deficient mutants of hRIPß led to an examination of the role of hRIPß sumoylation. Plasmids encoding hRIP, hRIPß, and hRIPß 4KM were transiently transfected with GFP-SUMO-1, whose expression showed dense spots, which indicate PML nuclear bodies (Fig. 3D, panel iv). More than 90% of hRIPß foci showed complete association with GFP-SUMO-1 spots, while none of the hRIP was colocalized with GFP-SUMO-1 (Fig. 3D, panels i and ii). In contrast, 70% of hRIPß 4KM exhibited spots with no association or only adjacent localization with GFP-SUMO-1 (Fig. 3D, panel iii). The remaining hRIPß 4KM was diffusely dispersed in the nucleus. These results suggest that hRIPß must be sumoylated in order to localize to the PML nuclear body.

Interaction between RPA and hRIP splice isoforms. Jullien et al. (19) reported that RPA p70 is the binding partner of hRIP and that the acidic-residue-rich domain of hRIP is the binding region for RPA p70. Because both hRIP and hRIPß contain this acidic domain, we examined whether hRIPß could interact with the RPA p70 protein. The interaction between RPA and hRIPß was probed by transfecting HEK293T cells with plasmids encoding FLAG-tagged RPA p70 (FLAG-RPA) in the presence or absence of GST-hRIP and GST-hRIPß. Forty-eight hours after transfection, GST, GST-hRIP, and GST-hRIPß were precipitated with glutathione beads. Bead-bound FLAG-RPA proteins were probed with anti-FLAG antibodies. A binding assay revealed that both hRIP and hRIPß interacted with the RPA protein in vivo (Fig. 4A). Because RPA p70 is one subunit of the RPA complex, it was demonstrated that the transiently expressed FLAG-RPA p70 was associated with endogenous RPA p32 in vivo (Fig. 4B). A coimmunoprecipitation assay with endogenous proteins provided yet more evidence for the interaction between RPA and hRIP/hRIPß. This coimmunoprecipitation assay with HEK293T cells also showed interactions of RPA with endogenous hRIP and hRIPß (Fig. 4C).

View larger version (38K): [in this window] [in a new window]

FIG. 4. Interaction between RPA and hRIPß. (A) hRIP and hRIPß interact with RPA in HEK293T cells. Cells were transiently transfected with a plasmid encoding FLAG-RPA in combination with GST, GST-hRIP, or GST-hRIPß. Whole-cell lysates (WCL) were precipitated with glutathione-Sepharose beads. The bead-bound proteins were eluted and immunoblotted (IB) with anti-FLAG antibody (upper panel) or anti-GST antibody (lower panel). (B) Interaction between FLAG-RPA p70 and endogenous (Endo.) RPA p32. Cells were transfected with either blank vector (lane 1) or a plasmid encoding FLAG-RPA p70 (lane 2). FLAG-RPA p70 was immunopurified (IP) with anti-FLAG antibody. To roughly compare the amount of bound RPA p32 protein with that of FLAG-RPA p70, the blotted membrane was simultaneously probed with anti-FLAG and anti-RPA p32 antibodies. IgG, immunoglobulin G. (C) Interaction of RPA with endogenous hRIP and hRIPß. HEK293T cells were immunoprecipitated with either anti-HA antibody (control) or anti-RPA p70 antibody, followed by immunoblotting with anti-hRIP antibody (upper panel), anti-RPA p32 antibody (middle panel), and anti-RPA p70 antibody (lower panel). (D) Identification of the regions of hRIP required for RPA interaction. GST and GST-RPA protein were used for GST pull-down assays with 35S-labeled, in vitro-translated hRIP constructs. Bead-bound proteins were eluted and visualized by autoradiography. GST and GST-RPA proteins were visualized by Coomassie brilliant blue staining.

In order to elucidate the interactions between RPA and the many splice isoforms of hRIP, a GST pull-down assay was performed. GST-RPA p70 recombinant protein was produced in bacteria (Fig. 4D), and the in vitro binding assays used in vitro-translated forms of hRIP, hRIPß, and hRIP3. While the last of these, hRIP3, interacted with the RPA protein, the hRIP mutant (amino acids 1 to 84) devoid of the acidic domain lacked binding affinity to RPA (Fig. 4D), as shown previously by (19). An hRIP3 mutant (amino acids 45 to 106) lacking the basic domain required for interaction with importin ß was also constructed. While the hRIP3(45-106) mutant did not interact with importin ß in vitro (data not shown), an interaction with RPA was identified that was slightly weaker than that of normal hRIP and its splicing variants (Fig. 4D). These results indicate that the splice isoforms of hRIP, as well as hRIP, interact with RPA.

Nuclear export signal sequence of hRIP. Based on an in vitro transport assay, Jullien et al. (19) reported that xRIP transports RPA into the nucleus, but the detailed mechanism of the process was not known at the time. Because hRIP localizes primarily to the cytoplasm, it is supposed that hRIP shuttles between the nucleus and the cytoplasm and thereby transports RPA into the nucleus. This hypothesis was supported by identifying the region of hRIP required for nuclear export. Because hRIP and hRIPß share the majority of their peptide sequences yet display different subcellular localizations, it was supposed that the additional hRIP-specific domain (amino acids 164 to 210) induced nuclear export of that protein (Fig. 5A). To verify this hypothesis, several deletion mutants that displayed differential localization were generated (Fig. 5A).

View larger version (30K): [in this window] [in a new window]

FIG. 5. hRIP contains the specific domain for cytoplasmic localization. (A) Schematic diagram of hRIP, its isoforms, and deletion mutants. Numbers correspond to the amino acid sequence. Note the presence or absence of the indicated region (amino acids 163 to 180) in each construct. (B) hRIP contains the specific domain (amino acids 164 to 180) required for cytoplasmic retention. The constructs shown in panel A were transiently expressed in HEK293T cells and stained with anti-hRIP antibody (green).

Confocal microscopy data revealed that hRIPß, hRIP, and hRIP3 generally localized to the nucleus in a dot-like pattern (Fig. 5B). Because hRIPß, hRIP, and hRIP3 lack the hRIP-specific domain (amino acids 164 to 210), however, one can conclude that the hRIP-specific domain is required for nuclear export. Moreover, two hRIP deletion mutants (amino acids 1 to 180 and 1 to 200) localized to the cytoplasm (Fig. 5C), indicating that the 17-amino-acid region from amino acid 164 to 180 was sufficient for nuclear export of hRIP.

Interaction with importin ß is also important for nuclear import, as illustrated by an hRIP3 mutant that does not interact with importin ß and localizes to the cytoplasm. On the other hand, an hRIP(1-84) mutant that does not interact with RPA localizes to both the nucleus and cytoplasm. The above results indicate that hRIP indeed harbors the specific domain (amino acids 164 to 180) required for its nuclear export.

hRIPß targets RPA to the PML nuclear body. Previous studies documented that RPA protein was mainly or partially localized to the PML nuclear body and that colocalization with the PML nuclear body was dependent on cell type (1, 2, 31). Little is known, however, about the transport of RPA into the PML nuclear body. As hRIPß is associated with RPA and also localizes in the PML nuclear body, we postulated that hRIPß was the carrier molecule for the targeting of RPA to the PML nuclear body.

To assess whether hRIPß indeed targets RPA to the PML nuclear body, RPA was transiently expressed in HEK293T cells with either blank vector or a plasmid encoding hRIP isoforms and mutants. After 24 h, the transfected cells were fixed and double immunostained with anti-hRIP antibody (rabbit, green) and anti-FLAG antibody (mouse, red). While ectopic expression of FLAG-RPA alone induced accumulation of FLAG-RPA protein in the cytoplasm, expression of hRIP, hRIPß, and hRIP3 led to the transport of RPA protein into the nucleus (Fig. 6).

View larger version (26K): [in this window] [in a new window]

FIG. 6. hRIPß transports RPA into the PML nuclear body. HEK293T cells were transfected with a plasmid encoding FLAG-RPA in combination with either blank vector or hRIP constructs. After 24 h, the cells were fixed and stained with anti-hRIP antibody (green) and anti-FLAG antibody (red). (B) Colocalization of RPA with hRIP. HEK293T cells were stained with anti-hRIP antibody (green) and anti-RPA p32 antibody. To remove the background, anti-hRIP antibody was purified as described in Materials and Methods. Bars, 10 µm.

The nuclear distribution pattern of RPA with hRIPß differs from the pattern of RPA with hRIP. While RPA localizes throughout the entire nucleus when hRIP is expressed, hRIPß expression leads to a dot-like staining pattern of RPA. Previous microscopy data suggest that these dots are PML nuclear bodies. Moreover, hRIPß was tightly associated with RPA, and hRIP did not colocalize with RPA. While a fraction of the hRIPß 4KM mutant colocalized with RPA, the level of this colocalization was weaker than that for wild-type hRIPß. In the case of the hRIP(1-84) mutant, which was devoid of the RPA binding region, localization was limited to the cytoplasm, indicating that the interaction between RPA and hRIP or its isoforms is required for the transport of RPA into the nucleus.

hRIPß is desumoylated upon UV irradiation and during S phase of the cell cycle. Negorev and Maul (28) postulated that the PML nuclear body acts as a nuclear depot and can recruit specific proteins and release them upon external stress. Furthermore, regulated recruitment into the PML nuclear body, as well as controlled release, is closely related to sumoylation of the proteins. Because hRIPß can transport RPA into the PML nuclear body and because this process is dependent on the sumoylation of hRIPß, it is supposed that hRIPß recruits RPA into the PML nuclear body and releases RPA upon external stress. UV irradiation was used to determine if the hRIPß protein would be desumoylated by an external stressor.

HA-hRIPß was transiently expressed in HEK293T cells, and the cells were either left untreated or irradiated with 50 J/m² of UV light. After UV irradiation, the cells were harvested and subjected to direct lysis. The sumoylation status of hRIPß was examined by immunoblot analysis with anti-HA antibody. As shown in Fig. 7A, the sumoylated hRIPß band was reduced to less than half that for untreated cells at 1 h postirradiation. By 2 h postirradiation, sumoylated hRIPß was hardly detected, although the amount of unmodified hRIPß had not been significantly altered (Fig. 7A, panel i). A similar experiment with the endogenous proteins was performed to provide more evidence, and the results with the endogenous hRIPß were identical to those with the transiently expressed hRIPß (Fig. 7B, panel ii). These results indicate that UV light desumoylates hRIPß in vivo.

View larger version (55K): [in this window] [in a new window]

FIG. 7. Sumoylation of hRIPß is regulated by UV irradiation and the normal cell cycle. (A) Panel i, UV irradiation desumoylates hRIPß. HA-hRIPß was transiently expressed in HEK293T cells. After 24 h, the cells were either left untreated (lane 1) or irradiated with 50 J/m2 of UV (lanes 2 and 3). The irradiated cells were harvested at the indicated times and the cell lysates blotted with anti-HA antibody. Panel ii, the sumoylation of endogenous (endo.) hRIPß upon UV irradiation was measured to confirm the results. (B) SENP1 desumoylates hRIPß. Panel i, cells were transfected with a plasmid encoding HA-hRIPß in the presence or absence of a plasmid encoding His-SENP1. After 48 h, the cells were collected and the cell lysates blotted with anti-HA antibody (upper panel) or anti-His antibody (lower panel). Panel ii, the transiently expressed SENP1 desumoylated the endogenous hRIPß. Panel iii, SENP1 siRNA was used to inhibit SENP1-mediated desumoylation of hRIPß. Panel iv, SENP1 siRNA treatment decreased the endogenous SENP1 protein. (C) UV irradiation disrupts the interaction between hRIPß and RPA. hRIPß and RPA were expressed in HEK293T cells grown on glass coverslips. After 24 h, the cells were either left untreated or irradiated with 50 J/m2 of UV. Two hours after UV irradiation, the cells were fixed and stained with anti-hRIP antibody (green) and anti-FLAG antibody (red). The second and fourth rows show higher magnifications of the areas indicated by the white dotted boxes in the respective panels of the first and third rows. Bars, 10 µm. UV irradiation also disrupts the association of hRIPß with PML protein. (D) U2OS cells were used to show the colocalization of endogenous hRIPß with RPA. Cells were either left untreated or irradiated with 50 J/m2 of UV and were stained with anti-hRIP antibody or anti-hRIPAS antibody together with anti-RPA antibody. M, merge. (E) Cell cycle analysis of Jurkat cell synchronization. Jurkat cells were synchronized by the thymidine double-block method. After removal of thymidine, the cells were harvested at the indicated times and subjected to cell cycle analysis. The cell cycle index was calculated by cell numbers in G1, S, and G2/M phases. (F) Sumoylation of hRIPß is downregulated during S phase. The synchronized cells were harvested, and equal amounts of the cell lysates were blotted with anti-hRIP and antiactin antibodies.

Recently, the SUMO isopeptidase SENP1 was identified (14). SENP1 is responsible for the desumoylation of the proteins in the PML nuclear body upon external stress (27, 28). Because hRIPß is desumoylated by UV irradiation, it is supposed that SENP1 removes SUMO from hRIPß. This hypothesis was tested by expressing HA-hRIPß in HEK293T cells in the presence or absence of His-SENP1. Figure 7B, panel i, shows that transient expression of SENP1 results in a dramatic reduction of sumoylated hRIPß. The same results were obtained with the endogenous hRIPß (Fig. 7B, panel ii). To further confirm the effect of SENP1 on regulation of hRIPß desumoylation, a SENP1 siRNA plasmid was used to silence endogenous SENP1 in HEK293T cells. Cheng et al. (6, 7) reported that SENP1 siRNA treatment decreases the endogenous SENP1 mRNA. As expected, the desumoylation of hRIPß upon UV irradiation was decreased in SENP1 siRNA-treated cells (Fig. 7B, panels iii and iv). Consequently, SENP1 is responsible for the desumoylation of hRIPß.

Next, the localization of hRIPß and RPA upon UV irradiation was examined. hRIPß and FLAG-RPA were expressed in HEK293T cells, and these cells were either left untreated or irradiated with 50 J/m2 of UV light. At 2 h postirradiation, the cells were fixed and reacted with anti-hRIP antibody (green) and anti-FLAG antibody (red). While hRIPß showed obvious colocalization with RPA without UV treatment (Fig. 7C, upper panels), UV irradiation led to the dissociation of RPA from hRIPß (Fig. 7C, lower panels). hRIPß still showed dot-like patterns in the nucleus, but the spots were enlarged and the level of colocalization with RPA was much weaker than it was without UV treatment. RPA also exhibited smaller nuclear foci, which were believed to be the sites of DNA damage and repair as had been previously reported (1). These results indicate that UV light disrupts the interaction between hRIPß and RPA, with this process accompanied by the desumoylation of hRIPß.

Further demonstration of the localization change of RPA with hRIPß upon treatment with UV light was accomplished through immunohistochemistry with endogenous RPA and hRIPß protein in U2OS cells. Background interference was reduced by using the more sensitive anti-RPA p32 antibody and the purified anti-hRIP antibody to detect the endogenous protein. It should be recognized that all of the hRIPß amino acid sequences are also included in hRIP sequences. This redundancy contributed to difficulties when attempting to immunostain hRIPß with the endogenous proteins. Purified anti-hRIP antibody detects the splice isoforms of hRIP as well as hRIPß. For this reason, anti-hRIPAS antibody was used to stain endogenous hRIP as a control. As shown in Fig. 7D, anti-hRIP antibody reacts with the spots in the nucleus, and anti-RPA also reacts with the same spots. As a control, anti-hRIPAS antibody was used to detect the endogenous hRIP, and anti-hRIPAS antibody does not react with the spots whereas anti-RPA antibody does. These data strongly support the supposition that hRIPß transports RPA into the PML nuclear body.

In the same way, the localization of endogenous hRIPß and RPA upon UV irradiation was examined. After UV irradiation, endogenous RPA was translocated to small and abundant spots (Fig. 7D). While a fraction of RPA spots were colocalized with hRIP spots, the rest of them were not colocalized with hRIP spots, indicating that the level of colocalization of RPA with hRIPß was reduced upon UV irradiation. Taken together with the transient-expression data, these results indicate that UV light induces the dissociation of RPA from hRIPß.

Finally, changes in hRIPß sumoylation status were tracked throughout the cell cycle. Jurkat cells were synchronized using the thymidine double-block method (17). After thymidine removal, the cells were harvested at the indicated times and subjected to cell cycle analysis (Fig. 7D). Immunoblotting with anti-hRIP antibody showed that sumoylation of endogenous hRIPß was lowered during early and full S phase (4 h and 8 h after thymidine removal, respectively) and that sumoylation was increased during G₂/M phase (Fig. 7E). These findings show that sumoylation of hRIPß varies during the cell cycle.

Top Abstract Introduction Materials and Methods Results Discussion References

 
hRIP and hRIPß are expressed primarily among six splice isoforms of hRIP. hRIP has been identified as a human analog of xRIP, the nuclear transporter of RPA in Xenopus (19). Here, the splice isoforms of hRIP were cloned and designated hRIP, hRIPß, hRIP, hRIP1, hRIP2, and hRIP3 according to the sizes of their encoding polypeptides. Among six splice isoforms, hRIP and hRIPß appear to be the major splice products; several lines of evidence support this conclusion.

First, hRIP and hRIPß are easily detected by anti-hRIP immunoblotting, while hRIP and hRIP1 to -3 are hardly detected. Because they are easily detected after in vitro translation, it is likely that low levels of hRIP and hRIP1 to -3 are due to low protein stability. Second, hRIP and hRIPß share the same termination codon, while other splice isoforms use a termination codon formed by a frameshift in the middle of the combined exon sequences. This frameshift implies that hRIP and hRIP1 to -3 are by-products as opposed to the major products of this particular pathway. In contrast to hRIP and hRIPß, the hRIP and hRIP1 to -3 cDNAs contain the untranslated exons 5, 6, and 7. The low-level expression of hRIP and hRIP is likely due to the lack of translation of exons 5 through 7. Despite their minimal expression, hRIP and hRIP1 to -3 may later be found to have as-yet-unknown functions. The main focus of the present study was on the characterization of hRIPß. Further study will be required for elucidation of the exact roles of these other isoforms.

Sumoylation of hRIPß is required for localization in the PML nuclear body. In the present report, it has been demonstrated that hRIPß is a novel substrate for SUMO modification. hRIPß has a sumoylation consensus sequence (IKQE/KXE) (30), and the replacement of four lysines, including the consensus lysine, resulted in the complete loss of hRIPß sumoylation. The 103rd (consensus) and 121st lysines in hRIPß were found to be the major sites for sumoylation: the expression of hRIPß 2KM-2, carrying K103N and K121R mutations, revealed a dramatic reduction in sumoylated protein compared to the sumoylation level of wild-type protein. The data collected so far suggest that hRIPß is sumoylated at one of the four lysine residues in hRIPß, as a shifted band was repeatedly detected in hRIPß immunoblotting. It is also possible, however, that multiply sumoylated hRIPß was not detected owing to a low level of multiple sumoylation.

Sumoylation has recently emerged as an important regulatory mechanism for protein localization, and several studies have demonstrated the close relation between the sumoylation of PML-associated proteins and their localization to the PML nuclear body (44). In one such study, the transcription repressor Bach2 was sumoylated and targeted to the PML nuclear body by oxidative stress, while a SUMO-deficient Bach2 mutant showed no association or only adjacent localization with PML nuclear bodies (36). Similarly, it was demonstrated here that hRIPß localizes to the PML nuclear body and that a SUMO-deficient mutant, hRIPß 4KM, exhibits a localization pattern similar to that of the Bach2 mutant. These findings are not completely analogous, however, because Bach2 is the functional protein itself, while hRIPß has only a regulatory role in RPA localization to the PML nuclear body. To the best of our knowledge, hRIPß is the first regulatory protein whose sumoylation has been found to control the PML localization of the target protein.

hRIP and hRIPß transport RPA to distinct locations. It has been reported, based on an in vitro nuclear import assay, that xRIP transports RPA into the nucleus (19), and the present study yielded results in agreement with this finding. Transient expression of FLAG-RPA in HEK293T cells induced cytoplasmic accumulation of FLAG-RPA. In contrast, expression of hRIP or hRIPß clearly shifted the localization of FLAG-RPA into the nucleus, indicating that both hRIP and hRIPß can transport RPA into the nucleus. Because the RPA protein was localized predominantly to the cytoplasm when transporter proteins were not expressed, the level of endogenous RPA nuclear transporter is likely insufficient for transporting the transiently expressed RPA protein into the nucleus, It is of particular interest that the localization patterns of transported RPA are different for hRIP and hRIPß. While hRIP transports RPA close to the nuclear membrane, hRIPß targets RPA to the PML nuclear body. Moreover, hRIP returns to the cytoplasm due to an hRIP-specific domain required for efficient nuclear export, while hRIPß is colocalized with RPA in the PML nuclear body. These results led us to propose that hRIP and hRIPß have different roles in the nuclear transport of RPA; that is, hRIP simply transports RPA into the nucleus, but hRIPß deposits RPA in the PML nuclear body. Because RPA is involved in DNA repair, recombination, and replication, which require DNA machinery including RPA, it is possible that hRIPß deposits RPA into PML nuclear bodies because of RPA insufficiency.

RPA is stored in PML nuclear bodies as a nuclear defense against external insults. Several studies suggest that RPA is transported to DNA damage sites and is involved in DNA repair and recombination (1, 45, 46). In this report, it was demonstrated that RPA is stored in the PML nuclear body by its interaction with hRIPß and that RPA is released from hRIPß upon UV irradiation. It is postulated that sumoylation of hRIPß is involved in RPA transport from the PML nuclear body to DNA damage sites. In addition to the sumoylation of hRIPß, ATR protein kinase activity plays an important role in the translocation of RPA upon exposure to a DNA-damaging agent (1), and many other DNA repair proteins are required for the full response to DNA damage. For this reason, it is possible that the deposition of RPA in PML nuclear bodies contributes to the coordinated action of DNA repair processes with other repair machinery in PML nuclear bodies. If this is true, the deposition of RPA in PML nuclear bodies by hRIPß sumoylation is a novel nuclear defense mechanism for the protection of cellular DNA from external stresses.

In summary, hRIPß was cloned as a novel splice isoform of hRIP, and hRIPß was found to be modified by sumoylation. This sumoylation was found to be required for localization to the PML nuclear body. Furthermore, hRIPß was shown to transport RPA into the PML nuclear body and to release RPA upon UV irradiation. Taken together, the findings of this study indicate that hRIPß regulates RPA storage in the PML nuclear body and supplements RPA in cases of RPA insufficiency.

 
We especially thank B. Stillman for providing anti-RPA antibody and M. S. Wold for providing RPA p70 clones.

This work was supported in part by grants from the National Research Laboratory Program of the Korea Institute of Science and Technology Evaluation and Planning (KISTEP) and from the Korea Science and Engineering Foundation (KOSEF) through the Protein Network Research Center at Yonsei University.

 
* Corresponding author. Mailing address: Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejon 305-701, South Korea. Phone: 82-42-869-2630. Fax: 82-42-869-5630. E-mail: jchoe{at}kaist.ac.kr.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Barr, S. M., C. G. Leung, E. E. Chang, and K. A. Cimprich. 2003. ATR kinase activity regulates the intranuclear translocation of ATR and RPA following ionizing radiation. Curr. Biol. 13:1047-1051.[CrossRef][Medline]
2
2. Bischof, O., S. H. Kim, J. Irving, S. Beresten, N. A. Ellis, and J. Campisi. 2001. Regulation and localization of the Bloom syndrome protein in response to DNA damage. J. Cell Biol. 153:367-380.[Abstract/Free Full Text]
3
3. Boubnov, N. V., and D. T. Weaver. 1995. scid cells are deficient in Ku and replication protein A phosphorylation by the DNA-dependent protein kinase. Mol. Cell. Biol. 15:5700-5706.[Abstract]
4
4. Brush, G. S., C. W. Anderson, and T. J. Kelly. 1994. The DNA-activated protein kinase is required for the phosphorylation of replication protein A during simian virus 40 DNA replication. Proc. Natl. Acad. Sci. USA 91:12520-12524.[Abstract/Free Full Text]
5
5. Brush, G. S., D. M. Morrow, P. Hieter, and T. J. Kelly. 1996. The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast. Proc. Natl. Acad. Sci. USA 93:15075-15080.[Abstract/Free Full Text]
6
6. Cheng, J., N. D. Perkins, and E. T. Yeh. 2005. Differential regulation of c-Jun-dependent transcription by SUMO-specific proteases. J. Biol. Chem. 280:14492-14498.[Abstract/Free Full Text]
7
7. Cheng, J., D. Wang, Z. Wang, and E. T. Yeh. 2004. SENP1 enhances androgen receptor-dependent transcription through desumoylation of histone deacetylase 1. Mol. Cell. Biol. 24:6021-6028.[Abstract/Free Full Text]
8
8. Din, S., S. J. Brill, M. P. Fairman, and B. Stillman. 1990. Cell-cycle-regulated phosphorylation of DNA replication factor A from human and yeast cells. Genes Dev. 4:968-977.[Abstract/Free Full Text]
9
9. Dutta, A., and B. Stillman. 1992. cdc2 family kinases phosphorylate a human cell DNA replication factor, RPA, and activate DNA replication. EMBO J. 11:2189-2199.[Medline]
10
10. Fairman, M. P., and B. Stillman. 1988. Cellular factors required for multiple stages of SV40 DNA replication in vitro. EMBO J. 7:1211-1218.[Medline]
11
11. Fang, F., and J. W. Newport. 1993. Distinct roles of cdk2 and cdc2 in RP-A phosphorylation during the cell cycle. J. Cell Sci. 106:983-994.[Abstract]
12
12. Fotedar, R., and J. M. Roberts. 1992. Cell cycle regulated phosphorylation of RPA-32 occurs within the replication initiation complex. EMBO J. 11:2177-2187.[Medline]
13
13. Gately, D. P., J. C. Hittle, G. K. Chan, and T. J. Yen. 1998. Characterization of ATM expression, localization, and associated DNA-dependent protein kinase activity. Mol. Biol. Cell 9:2361-2374.[Abstract/Free Full Text]
14
14. Gong, L., S. Millas, G. G. Maul, and E. T. Yeh. 2000. Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J. Biol. Chem. 275:3355-3359.[Abstract/Free Full Text]
15
15. Graham, F. L., and A. J. van der Eb. 1973. Transformation of rat cells by DNA of human adenovirus 5. Virology 54:536-539.[CrossRef][Medline]
16
16. Henricksen, L. A., C. B. Umbricht, and M. S. Wold. 1994. Recombinant replication protein A: expression, complex formation, and functional characterization. J. Biol. Chem. 269:11121-11132.[Abstract/Free Full Text]
17
17. Hiroi, N., H. Maruta, and S. Tanuma. 1999. Fas-mediated apoptosis in Jurkat cells is suppressed in the pre-G2/M phase. Apoptosis 4:255-261.[CrossRef][Medline]
18
18. Ishov, A. M., A. G. Sotnikov, D. Negorev, O. V. Vladimirova, N. Neff, T. Kamitani, E. T. Yeh, J. F. Strauss III, and G. G. Maul. 1999. PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J. Cell Biol. 147:221-234.[Abstract/Free Full Text]
19
19. Jullien, D., D. Gorlich, U. K. Laemmli, and Y. Adachi. 1999. Nuclear import of RPA in Xenopus egg extracts requires a novel protein XRIPalpha but not importin alpha. EMBO J. 18:4348-4358.[CrossRef][Medline]
20
20. Kenny, M. K., U. Schlegel, H. Furneaux, and J. Hurwitz. 1990. The role of human single-stranded DNA binding protein and its individual subunits in simian virus 40 DNA replication. J. Biol. Chem. 265:7693-7700.[Abstract/Free Full Text]
21
21. Kim, C., R. O. Snyder, and M. S. Wold. 1992. Binding properties of replication protein A from human and yeast cells. Mol. Cell. Biol. 12:3050-3059.[Abstract/Free Full Text]
22
22. Kutay, U., E. Izaurralde, F. R. Bischoff, I. W. Mattaj, and D. Gorlich. 1997. Dominant-negative mutants of importin-beta block multiple pathways of import and export through the nuclear pore complex. EMBO J. 16:1153-1163.[CrossRef][Medline]
23
23. Liu, J. S., S. R. Kuo, M. M. McHugh, T. A. Beerman, and T. Melendy. 2000. Adozelesin triggers DNA damage response pathways and arrests SV40 DNA replication through replication protein A inactivation. J. Biol. Chem. 275:1391-1397.[Abstract/Free Full Text]
24
24. Liu, V. F., and D. T. Weaver. 1993. The ionizing radiation-induced replication protein A phosphorylation response differs between ataxia telangiectasia and normal human cells. Mol. Cell. Biol. 13:7222-7231.[Abstract/Free Full Text]
25
25. Marton, R. F., P. Thommes, and S. Cotterill. 1994. Purification and characterisation of dRP-A: a single-stranded DNA binding protein from Drosophila melanogaster. FEBS Lett. 342:139-144.[CrossRef][Medline]
26
26. Morgan, S. E., and M. B. Kastan. 1997. Dissociation of radiation-induced phosphorylation of replication protein A from the S-phase checkpoint. Cancer Res. 57:3386-3389.[Abstract/Free Full Text]
27
27. Nefkens, I., D. G. Negorev, A. M. Ishov, J. S. Michaelson, E. T. Yeh, R. M. Tanguay, W. E. Muller, and G. G. Maul. 2003. Heat shock and Cd2+ exposure regulate PML and Daxx release from ND10 by independent mechanisms that modify the induction of heat-shock proteins 70 and 25 differently. J. Cell Sci. 116:513-524.[Abstract/Free Full Text]
28
28. Negorev, D., and G. G. Maul. 2001. Cellular proteins localized at and interacting within ND10/PML nuclear bodies/PODs suggest functions of a nuclear depot. Oncogene 20:7234-7242.[CrossRef][Medline]
29
29. Oakley, G. G., L. I. Loberg, J. Yao, M. A. Risinger, R. L. Yunker, M. Zernik-Kobak, K. K. Khanna, M. F. Lavin, M. P. Carty, and K. Dixon. 2001. UV-induced hyperphosphorylation of replication protein A depends on DNA replication and expression of ATM protein. Mol. Biol. Cell 12:1199-1213.[Abstract/Free Full Text]
30
30. Rodriguez, M. S., C. Dargemont, and R. T. Hay. 2001. SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J. Biol. Chem. 276:12654-12659.[Abstract/Free Full Text]
31
31. Sanz, M. M., M. Proytcheva, N. A. Ellis, W. K. Holloman, and J. German. 2000. BLM, the Bloom's syndrome protein, varies during the cell cycle in its amount, distribution, and co-localization with other nuclear proteins. Cytogenet. Cell Genet. 91:217-223.[CrossRef][Medline]
32
32. Sapetschnig, A., G. Rischitor, H. Braun, A. Doll, M. Schergaut, F. Melchior, and G. Suske. 2002. Transcription factor Sp3 is silenced through SUMO modification by PIAS1. EMBO J. 21:5206-5215.[CrossRef][Medline]
33
33. Shao, R. G., C. X. Cao, H. Zhang, K. W. Kohn, M. S. Wold, and Y. Pommier. 1999. Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissociates RPA:DNA-PK complexes. EMBO J. 18:1397-1406.[CrossRef][Medline]
34
34. Shiio, Y., T. Yamamoto, and N. Yamaguchi. 1992. Negative regulation of Rb expression by the p53 gene product. Proc. Natl. Acad. Sci. USA 89:5206-5210.[Abstract/Free Full Text]
35
35. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31-40.[CrossRef][Medline]
36
36. Tashiro, S., A. Muto, K. Tanimoto, H. Tsuchiya, H. Suzuki, H. Hoshino, M. Yoshida, J. Walter, and K. Igarashi. 2004. Repression of PML nuclear body-associated transcription by oxidative stress-activated Bach2. Mol. Cell. Biol. 24:3473-3484.[Abstract/Free Full Text]
37
37. Wang, H., J. Guan, A. R. Perrault, Y. Wang, and G. Iliakis. 2001. Replication protein A2 phosphorylation after DNA damage by the coordinated action of ataxia telangiectasia-mutated and DNA-dependent protein kinase. Cancer Res. 61:8554-8563.[Abstract/Free Full Text]
38
38. Wang, Y., X. Y. Zhou, H. Wang, M. S. Huq, and G. Iliakis. 1999. Roles of replication protein A and DNA-dependent protein kinase in the regulation of DNA replication following DNA damage. J. Biol. Chem. 274:22060-22064.[Abstract/Free Full Text]
39
39. Wold, M. S. 1997. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu. Rev. Biochem. 66:61-92.[CrossRef][Medline]
40
40. Wold, M. S., and T. Kelly. 1988. Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc. Natl. Acad. Sci. USA 85:2523-2527.[Abstract/Free Full Text]
41
41. Wold, M. S., D. H. Weinberg, D. M. Virshup, J. J. Li, and T. J. Kelly. 1989. Identification of cellular proteins required for simian virus 40 DNA replication. J. Biol. Chem. 264:2801-2809.[Abstract/Free Full Text]
42
42. Yoshida, K., and G. Blobel. 2001. The karyopherin Kap142p/Msn5p mediates nuclear import and nuclear export of different cargo proteins. J. Cell Biol. 152:729-740.[Abstract/Free Full Text]
43
43. Zhong, S., S. Muller, S. Ronchetti, P. S. Freemont, A. Dejean, and P. P. Pandolfi. 2000. Role of SUMO-1-modified PML in nuclear body formation. Blood 95:2748-2752.[Abstract/Free Full Text]
44
44. Zhong, S., P. Salomoni, and P. P. Pandolfi. 2000. The transcriptional role of PML and the nuclear body. Nat. Cell Biol. 2:85-90.
45
45. Zou, L., and S. J. Elledge. 2003. Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 300:1542-1548.[Abstract/Free Full Text]
46
46. Zou, L., D. Liu, and S. J. Elledge. 2003. Replication protein A-mediated recruitment and activation of Rad17 complexes. Proc. Natl. Acad. Sci. USA 100:13827-13832.[Abstract/Free Full Text]

---

Molecular and Cellular Biology, September 2005, p. 8202-8214, Vol. 25, No. 18
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.18.8202-8214.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Park, J., Kim, K., Lee, E.-J., Seo, Y.-J., Lim, S.-N., Park, K., Rho, S. B., Lee, S.-H., Lee, J.-H. (2007). Elevated level of SUMOylated IRF-1 in tumor cells interferes with IRF-1-mediated apoptosis. Proc. Natl. Acad. Sci. USA 104: 17028-17033 [Abstract] [Full Text]  
• Mohan, R. D., Rao, A., Gagliardi, J., Tini, M. (2007). SUMO-1-Dependent Allosteric Regulation of Thymine DNA Glycosylase Alters Subnuclear Localization and CBP/p300 Recruitment. Mol. Cell. Biol. 27: 229-243 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Park, J. Articles by Choe, J. Search for Related Content PubMed PubMed Citation Articles by Park, J. Articles by Choe, J.