B56 Regulatory Subunit of Protein Phosphatase 2A Mediates Valproic Acid-Induced p300 Degradation

Transcriptional coactivator p300 is required for embryonic developmentand cell proliferation. Valproic acid, a histone deacetylaseinhibitor, is widely used in the therapy of epilepsy and bipolardisorder. However, it has intrinsic teratogenic activity throughunidentified mechanisms. We report that valproic acid stimulatesproteasome-dependent p300 degradation through augmentation ofgene expression of the B56 ${gamma}$ regulatory subunits of protein phosphatase2A. The B56 ${gamma}$ 3 regulatory and catalytic subunits of protein phosphatase2A interact with p300. Overexpression of the B56 ${gamma}$ 3 subunit leadsto proteasome-mediated p300 degradation and represses p300-dependenttranscriptional activation, which requires the B56 ${gamma}$ 3 interactiondomain of p300. Conversely, silencing of the B56 ${gamma}$ subunit expressionby RNA interference increases the stability and transcriptionalactivity of the coactivator. Our study establishes the functionalinteraction between protein phosphatase 2A and p300 activityand provides direct evidence for signal-dependent control ofp300 function.

INTRODUCTION

Top

Introduction

Activation of gene expression is a dynamic and complex processin which the functional transcription machinery is recruitedand assembled at target promoters (24, 45). An essential componentof many transcription complexes is the transcriptional coactivatorp300 (12). Structurally and functionally related to CREB bindingprotein (CBP), p300 has been implicated in regulating a broadarray of cellular activities (10, 25, 26). Embryonic developmentin mice is very sensitive to gene dosage of the coactivator,and p300 knockout mice exhibit neural tube defects (51). Recentstudies have demonstrated multiple molecular mechanisms of p300function, as the coactivator has intrinsic histone acetyltransferase(HAT) and ubiquitin ligase activities (13, 37). However, thestimuli, signaling cascades, and proteins that regulate thesep300 activities are poorly understood.

Degradation through the 26S proteasome pathway involves covalentmodification of the target protein with multiple ubiquitin moietiesprior to the destruction of the tagged protein (7, 20, 22).A growing body of evidence suggests that the 26S proteasomeis not only responsible for eliminating misfolded and damagedintracellular proteins but is also responsible for selectivedegradation of many transcriptional activators and coactivators,including p300 (29, 34, 35, 40). During retinoic acid-induceddifferentiation of F9 embryonal carcinoma cells, the level ofp300 was dramatically reduced as a result of the proteasome-mediateddegradation (3). It has also been suggested that ubiquitinationcan serve as a signal for augmenting the transcriptional activationand destruction of some activator proteins via the 26S proteasome(41). Phosphorylation is known to enhance degradation of someproteins through the 26S proteasome pathway, but the regulatorysignals that target each individual protein for ubiquitinationremain unclear (7).

Reversible phosphorylation is critical for regulating a diversearray of cellular processes. One of the major serine-threoninephosphatases, protein phosphatase 2A (PP2A) is a heterotrimericcomplex consisting of a structural subunit, a catalytic subunit,and a variable regulatory subunit. There are three distinctclasses of regulatory subunits, B/B55, B'/B56, and B"/B72, whichmodulate substrate selectivity and intracellular localizationof PP2A (49). B56 is the most diverse PP2A regulatory subunitwith five isoforms ( ${alpha}$ , ß, ${gamma}$ , ${delta}$ , and ${varepsilon}$ ) and three splicevariants of the ${gamma}$ isoform ( ${gamma}$ 1, ${gamma}$ 2, and ${gamma}$ 3), which are widely expressedbut are generally expressed at low levels (32, 47). Among thedifferent isoforms of B56 regulatory subunits, B56 ${gamma}$ 1, B56 ${gamma}$ 2, B56 ${gamma}$ 3,and B56 ${delta}$ have nuclear localization, while B56 ${alpha}$ , B56ß,and B56 ${varepsilon}$ are cytoplasmic (31, 47). Various B56 subunits of PP2Ahave been shown to regulate cell growth, apoptosis, and neoplasticprogression (16, 28).

Valproic acid is widely used for treatment of epilepsy, bipolardisorder, and neuropathic pain, migraine prophylaxis, and thecontrol of a variety of seizures (17, 30). However, pregnantwomen treated with valproic acid early in their pregnancy cangive birth to children with defects in neural tube closure (36).It has been difficult to elucidate the molecular and biochemicalmechanisms underlying these therapeutic as well as teratogeniceffects of valproic acid. The discovery in recent years thatvalproic acid acts as a histone deacetylase (HDAC) inhibitorhas allowed insight into the mode of action of this short-chainedfatty acid, which not only affects class 1 HDACs by inhibitingtheir catalytic activity but also induces proteasome-mediatedHDAC2 degradation (21, 39). Therefore, alteration of gene expressionthrough HDAC inhibition has become an interesting avenue forunderstanding how valproic acid affects cell differentiationand teratogenicity.

In this work, we demonstrate that the B56 ${gamma}$ 3 regulatory subunitof PP2A targets the transcriptional coactivator p300 for degradationthrough the 26S proteasome pathway and define the molecularmechanisms regulating this process. Valproic acid stimulatesthe proteasome-mediated p300 degradation by augmenting geneexpression of the B56 ${gamma}$ 3 regulatory subunits of PP2A. Moreover,the selective p300 degradation is mediated by PP2A through aninteraction between the B56 ${gamma}$ 3 regulatory subunit and the transcriptionalcoactivator p300.

MATERIALS AND METHODS

Top

Materials and Methods

Plasmids and reagents. The plasmids for B56 ${gamma}$ 2 and B56 ${gamma}$ 3 subunits (47), glutathione S-transferase(GST)-p300 (15), wild-type p300, p300 ${Delta}$ C (46), p300N, p300C (37),ßRE3-Luc reporter (38) and the antibody specific tothe B56 ${gamma}$ 2 and B56 ${gamma}$ 3 subunits (47) have been described previously.MG132 and valproic acid were purchased from Sigma. Okadaic acidwas from Calbiochem. Antibodies against p300, SRC, p53, andretinoic acid receptor ß (RARß) were fromSanta Cruz.

Cell culture and transfection. Tissue culture cells were maintained in Dulbecco's modifiedEagle medium (DMEM) supplemented with 10% fetal bovine serum(FBS) (HyClone). Transient transfection was performed with theamount of plasmid DNA indicated in the figure legends usingExGen 500 (27). Luciferase assay was performed as previouslydescribed (5). The luciferase activities are expressed as foldinduction (normalized to ß-galactosidase activity)relative to untreated controls. All assays were performed intriplicate for a minimum of three times.

Whole-cell extracts and immunoprecipitation. Cells were washed with phosphate-buffered saline (PBS), harvested,and centrifuged. The pellet was then resuspended and incubatedat 4°C for 30 min in whole-cell extraction (WCE) buffercontaining 50 mM Tris-HCl (pH 7.6), 400 mM NaCl, 10% glycerol,1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and1% Nonidet P-40 (NP-40). Lysate was centrifuged at 14,000 xg at 4°C for 10 min. Protein concentration was determinedby a Bradford assay (Bio-Rad) using bovine serum albumin asthe standard. For immunoprecipitation, the NaCl concentrationof whole-cell extracts was adjusted to 150 mM and the NP-40concentration was adjusted to 0.1%. Extracts were incubatedwith protein A agarose and the indicated antibodies at 4°Cfor 2 h, washed, and subjected to Western blot analysis accordingly.All experiments were performed in duplicate at least three times.

Pulse-chase. Cells were cultured in DMEM supplemented with 10% FBS overnightand treated with valproic acid or sodium butyrate for 6 h orleft alone. The medium was then replaced with methionine-freemedium, and the cells were pulsed for 3 h with [³⁵S]methionine(100 µCi/ml) and chased for 7 h in regular medium in thepresence or absence of valproic acid or sodium butyrate. Thecells were then harvested for the preparation of whole-cellextracts and immunoprecipitation with a p300 antibody. The immunopurifiedp300 was separated by sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE) and analyzed with a PhosphorImager.The experiment was performed in duplicate three times.

Quantitative RT-PCR. Total RNA from HeLa cells was isolated by using the RNeasy Minikit (QIAGEN). Reverse transcription was performed with 1 µgof RNA and 200 U of Superscript II (Invitrogen) for 50 min at42°C. From the resulting cDNA, 1 µl was amplifiedby PCR using 2.5 U of Taq DNA polymerase (Invitrogen) for 30cycles. Primers F-1252 (GCTATTTGATGACTGTACACAAC) and R-1509(TCCTTCTTCGGATCTTTCTGTG) were specific for B56 ${gamma}$ 3 and B56 ${gamma}$ 2 subunits,respectively, and resulted in products of different sizes. Inorder to quantify the PCR products, 18S rRNA (Ambion) primersand competitors were used as internal control in all PCRs toaccount for mRNA input and reverse transcription-PCR (RT-PCR)variations. PCR products were run on 1.5% agarose gels stainedwith Vistra Green (Amersham), and quantified with the Typhoon8600 Variable Mode Imager using ImageQuant software (MolecularDynamics).

RNA interference. The small interfering RNA (siRNA) experiments were performedas previously described (11). A 21-bp siRNA corresponding tonucleotides 238 to 258 of the B56 ${gamma}$ cDNA (accession no.U37352)(AAGUGACCUAAAGUGGAAGGA) was synthesized and annealed by QIAGEN,which also supplied a nonsilencing control siRNA. The siRNA(50 and 200 nM) were transfected twice at 20-h intervals usingOligofectamine according to the manufacturer's recommendation(Invitrogen). Cells were harvested for analysis 20 h after thesecond transfection. All experiments were performed a minimumof three times.

Immunofluorescence microscopy. Cells were cultured on coverslips in six-well dishes. Aftertransfections, the coverslips were washed with cold PBS supplementedwith 0.05% Tween 20. The cells were fixed on ice with 4% paraformaldehydeand permeabilized at room temperature with 0.2% NP-40. The coverslipswere incubated on ice for 1 h in PBS supplemented with 10% milkand 0.2% Tween 20 and then incubated at 4°C overnight withM2 antibody (1:500). The coverslips were incubated the nextday first with fluorescent anti-mouse antibody (1:10,000) atroom temperature for 30 min and then with PBS supplemented withHoechst (0.5 µg/ml) for 10 min at room temperature intotal darkness. The coverslips were then drained, mounted with90% glycerol on slides, and visualized by fluorescence microscopy.

RESULTS

Top

Results

Valproic acid induces selective p300 degradation through the 26S proteasome. It has been reported that sodium butyrate, a HDAC inhibitor,blocks the steroid hormone action (33) and induces p300 degradationthrough the 26S proteasome pathway (27). To study the molecularmechanisms of selective p300 degradation, we examined the effectsof sodium butyrate and other HDAC inhibitors, such as valproicacid, on the activity of the transcriptional coactivator p300in some detail. As with the butyrate, the level of p300 proteinremained constant for up to 8 h of treatment with valproic acid,whereas the level of p300 was reduced to about 30% of that inthe control HeLa cells upon 16 h of exposure to valproic acid(Fig. 1A, B, C, and D). The negative effect of valproic acidon the steady-state level of p300 was similar in cells treatedwith valproic acid at concentrations of 1, 2, or 5 mM (Fig.1B and data not shown). The abundance of SRC protein, however,was not affected by treatment with valproic acid or butyrate(Fig. 1A and B).

View larger version (44K):
[in this window]
[in a new window]
FIG. 1. Valproic acid induces p300 degradation through the 26S proteasome. (A) Western blot analysis of endogenous p300 in extracts (50 µg) from HeLa cells treated with sodium butyrate (NaB) (5 mM) and/or MG132 (MG) (5 µM). The blot was then stripped and reprobed for protein loading with an anti-SRC antibody. The treatment time (in hours) is indicated above the gel. (B) The experimental procedure was as described for panel A except that valproic acid (VPA) (2 mM) was used. (C and D) Quantitative analysis of Western blot results is expressed as fold variation compared to the values for untreated controls after the values were normalized to those of the loading controls. Values are means ± standard deviations (error bars) from a minimum of three independent experiments with each experiment performed in duplicate. (E) Cells were pretreated with valproic acid or sodium butyrate for 6 h, then pulsed for 3 h, and chased for 7 h in the different treatment conditions. The endogenous p300 protein was immunoprecipitated with a p300 antibody, separated by SDS-PAGE, and analyzed with a PhosphorImager. (F) The relative stability of p300 in cells treated with valproic acid or sodium butyrate, upon 7 h of chase (lanes 5 and 6), is presented as a percentage of the labeled p300 in untreated cells (lane 4) after being normalized to nonchased cells in the different treatment conditions (as in lanes 1 to 3 of panel E). Values are means ± standard deviations (error bars) from a minimum of three independent experiments with each experiment performed in duplicate.

Treatment of cells with a 26S proteasome inhibitor, MG132 (23),attenuated the valproic acid-induced p300 reduction, indicatingthat the reduction of the coactivator may be due to proteindegradation in which the 26S proteasome is likely involved (Fig.1B). A pulse-chase protocol was also employed to compare therelative stability of p300 in the presence or absence of valproicacid or sodium butyrate. The relative half-life of endogenousp300 in HeLa cells is about 11 h (5), which is similar to thosein other cell types (1, 50), and the selective p300 reductioninduced by valproic acid or butyrate was observed after 16 hof treatment, but not after 8 h (Fig. 1A and B). Therefore,we devised a pretreatment protocol in which the cells were treatedwith valproic acid or butyrate for 6 h prior to a 3-h pulsein the presence of valproic acid or butyrate to prime the cellsso that the selective p300 degradation could be observed inthe next 7-h chase under treatment with valproic acid or butyrate.As shown in Fig. 1E and F, the metabolic stability of endogenousp300 was reduced to about half in cells treated with valproicacid or butyrate compared to that in untreated cells. Takentogether, these results suggest that valproic acid down-regulatesendogenous p300 protein mainly through the 26S proteasome-mediateddegradation.

Okadaic acid reverses the valproic acid-induced p300 degradation. The degradation of endogenous p300 induced by valproic acidor sodium butyrate requires prolonged treatment, namely, 16h of incubation (Fig. 1), suggesting that this might be an indirecteffect, i.e., mediated through activation of a negative factorto enhance p300 turnover. The transcriptional coactivator p300is a nuclear protein that can be massively phosphorylated atserine and threonine residues (19, 42, 50), while sodium butyrateis able to increase the cellular activity of serine-threoninephosphatase (9). These observations promoted us to investigatepotential roles of serine-threonine phosphatase in the controlof p300 activity. HeLa cells were treated with okadaic acid,a cell-permeable serine-threonine phosphatase inhibitor (8),for various times at different concentrations. The cellularproteins were then isolated to assess the abundance of endogenousp300 protein by Western blot analysis. As shown in Fig. 2A,the electrophoretic mobility of endogenous p300 was significantlyreduced during SDS-PAGE after 1 h of okadaic acid treatmentat concentrations of 0.4 and 0.8 µM, whereas the levelof p300 protein was augmented notably upon 1 h of treatmentat 0.8 µM, indicating that protein phosphatase may beinvolved in controlling p300 stability. Therefore, we wishedto establish whether the effect of valproic acid or sodium butyrateon p300 degradation is mediated through activation of proteinphosphatase.

View larger version (21K):
[in this window]
[in a new window]
FIG. 2. Protein phosphatases play an important role in the control of the steady-state level of p300. (A) Equal amounts (50 µg) of whole-cell extracts from HeLa cells were used for Western blot analysis of endogenous p300 after treatment with okadaic acid (OA) (0.4 µM [+] or 0.8 µM [++]). The treatment time (in hours) is indicated above the lanes. The blot was then stripped and reprobed with a p53 antibody. (B) The same experimental setup as in panel A, except the cells were treated with okadaic acid (OA) (0.2 µM) in the presence or absence of valproic acid (VPA) (2 mM) or sodium butyrate (NaB) (5 mM) for 16 h. (C) The same procedure as in panel B, except the blot was probed with p300 antibody, stripped, and reprobed with a RAR antibody. A protein band cross-reacting with the RAR antibody is shown as a control (Ctl).

To this end, we examined the ability of okadaic acid to counteractthe valproic acid- or butyrate-induced p300 degradation. Cellswere treated with 0.2 µM okadaic acid in the absence ofvalproic acid or butyrate for 16 h, which reduced the electrophoreticmobility of p300 (Fig. 2B) as effectively as in shorter treatmentsat higher concentrations (Fig. 2A). More importantly, cotreatmentwith okadaic acid prevented the selective p300 degradation inducedby valproic acid or sodium butyrate, which also resulted inthe retardation of p300 mobility (Fig. 2B). Interestingly, theabundance of RAR was not affected by the okadaic acid treatment,whereas a protein that cross-reacts with the RAR antibody onthe Western blot was destabilized (Fig. 2C), suggesting thatprotein degradation pathways are active under okadaic acid treatment.Taken together, these data demonstrate that serine-threoninephosphatase plays an important role in controlling the metabolicstability of transcriptional coactivator p300 and that valproicacid induces p300 degradation through the activation of phosphataseactivity.

Valproic acid augments expression of the B56 regulatory subunit of PP2A. The phosphorylation status of a protein can serve as a signalfor regulation through the 26S proteasome pathway. Multipleserine-threonine phosphorylation sites are present in p300,but the physiological significance of these modifications isnot clear (19, 50). Therefore, we wished to identify the proteinphosphatase activity that controls p300 function. Microarrayanalysis of gene expression was performed to screen potentialcandidates, and quantitative RT-PCR analysis confirmed thattranscription of B56 ${gamma}$ 3 and B56 ${gamma}$ 2 regulatory subunits of PP2A wasup-regulated in cells subjected to 8 and 16 h of valproic acidor sodium butyrate treatment (Fig. 3A and B). Western blot analysisshowed that the protein levels of the B56 ${gamma}$ 3 and B56 ${gamma}$ 2 subunitswere increased moderately upon 16 h of treatment with valproicacid or sodium butyrate (Fig. 3C). We hypothesize that the B56 ${gamma}$ subunit may be involved in valproic acid-induced p300 degradationand wished to determine whether the B56 ${gamma}$ regulatory subunit ofPP2A is in fact responsible for the selective p300 degradation.

View larger version (20K):
[in this window]
[in a new window]
FIG. 3. Valproic acid and sodium butyrate augment the expression of the B56 regulatory subunits of PP2A. (A) Cells were treated with valproic acid (VPA) (2 mM) or sodium butyrate (NaB) (5 mM) for 4, 8, and 16 h. Total RNA was isolated, and the mRNA levels of B56 ${gamma}$ 3 ( ${gamma}$ 3) were assessed by quantitative RT-PCR. Results show fold variations of the treated cells compared to those of untreated control (Ctl). Values are means ± standard deviations (error bars) from a minimum of three independent experiments with each experiment performed in duplicate. (B) The experimental setup was as in panel A, except the mRNA level of B56 ${gamma}$ 2 was examined. (C) Cells were treated as in panel A. Equal amounts of whole-cell extract (50 µg) were used for Western blotting. The blot was probed with an antibody specific to endogenous B56 ${gamma}$ 2 and B56 ${gamma}$ 3 and with an anti-RAR antibody for loading control.

B56 ${gamma}$ regulatory subunit of PP2A enhances selective p300 degradation. Western blotting analysis was used to assess the abundance ofendogenous p300 protein in cells overexpressing the B56 ${gamma}$ 3 andB56 ${gamma}$ 2 regulatory subunits. Endogenous p300 was very sensitiveto the protein dosage of the B56 ${gamma}$ 3 subunit but not to the dosageof the B56 ${gamma}$ 2 subunit (Fig. 4A and B). The level of p300 was reducedsignificantly even with moderate expression of the B56 ${gamma}$ 3 subunit.This negative effect of B56 ${gamma}$ 3 on the steady-state level of p300was reversed by treating the cells with the proteasome inhibitor,MG132, indicating that the 26S proteasome is involved in theB56 ${gamma}$ 3-mediated p300 degradation (Fig. 4A). On the other hand,moderate overexpression of the B56 ${gamma}$ 2 subunit had no effect onthe level of p300 protein, and high-level expression of theB56 ${gamma}$ 2 subunit was observed only in the presence of MG132 (Fig.4B), suggesting that the B56 ${gamma}$ 2 subunit itself is tightly regulatedby the 26S proteasome pathway.

View larger version (27K):
[in this window]
[in a new window]
FIG. 4. The B56 ${gamma}$ 3 regulatory subunit of PP2A inhibits p300 activity. (A) HeLa cells were transfected with increasing amounts of B56 ${gamma}$ 3 ( ${gamma}$ 3) expression plasmid (1, 1.5, and 2 µg in lanes 2, 3, and 4, respectively; 2 µg in lanes 6 to 8) and treated with MG132 (MG) (5 µM) for 16 h or left alone. The abundance of endogenous p300 protein was analyzed on a Western blot. The blot was then stripped and reprobed for the B56 ${gamma}$ 3 subunit. (B) The experimental procedure was as in panel A, except the cells were transfected with increasing amounts of expression plasmid for the B56 ${gamma}$ 2 subunit (1, 2, and 4 µg). (C) Cells were transfected with RAR luciferase reporter (0.3 µg), respiratory syncytial virus ß-galactosidase (RSV-ß-Gal) (0.3 µg), and increasing amounts of B56 ${gamma}$ 3 expression plasmid (0.5 and 2.0 µg). The cells were then induced with arotinoid acid (AA) (1 µM) for 24 h and assayed for luciferase (Luc) assay. Values shown were normalized to ß-galactosidase activity and are expressed as the fold induction relative to the values for untreated controls. Values are means ± standard deviations (error bars) of triplicates within the representative experiments. (D) Western blot analysis of RARß from cells transfected with 2 µg of B56 ${gamma}$ 3 expression plasmid. (E) siRNA (100, 150, and 200 nM [lanes 2, 3, and 4, respectively]) specific for the B56 subunits was transfected twice at 20-h intervals. Cells were then harvested and subjected to Western blot analysis for the abundance of p300 and B56 ${gamma}$ 3 and B56 ${gamma}$ 2 subunits. A protein band that cross-reacts with the p300 antibody is used for a loading control (Ctl). (F) Cells were first transfected with RAR luciferase reporter (0.3 µg), RSV-ß-Gal (0.3 µg), and B56 siRNA (100 and 150 nM), followed by a second transfection of the siRNA alone 24 h later. The cells were then induced with arotinoid acid (AA) (1 µM) for 20 h and subjected to luciferase (Luc) assay. ß-Galactosidase activity was used as an internal control. Values are means ± standard deviations (error bars) of three experiments.

Numerous studies, including those involving p300 null mouseembryos, have established that p300 is required for the transcriptionalactivation mediated by RAR (4, 18, 51). Therefore, we investigatedwhether the p300-dependent RAR signaling was also affected bythe B56 ${gamma}$ 3 subunit using a retinoic acid-responsive reporter (ßRE3-Luc)and a synthetic RAR-specific ligand, arotinoid acid. As shownin Fig. 4C, arotinoid acid-induced transcription was inhibitedby cotransfection of B56 ${gamma}$ 3 in a concentration-dependent manner.The level of endogenous RAR protein, however, was unchangedupon overexpression of B56 ${gamma}$ 3, as assessed by the Western blotanalysis (Fig. 4D). In addition, overexpression of B56 ${gamma}$ 2 subunitdid not inhibit RAR signaling, and the B56 ${gamma}$ 3 subunit did notaffect the transcriptional activation mediated by Gal4 (datanot shown). These data suggest that the down-regulation of p300-dependentRAR signaling by the B56 ${gamma}$ 3 subunit may be attained through selectivep300 degradation through the 26S proteasome pathway.

siRNA of the B56 ${gamma}$ subunit augments p300 activity. To further determine whether the B56 ${gamma}$ subunit is a decisive determinantfor targeting p300 degradation through the proteasome pathway,we designed an siRNA to knock down the endogenous B56 ${gamma}$ protein.Western blot analysis demonstrated that introducing the B56 ${gamma}$ siRNA into cells elevates the level of endogenous p300 proteinwhile knocking down the levels of endogenous B56 ${gamma}$ proteins (Fig.4E). The transfection of B56 ${gamma}$ siRNA did not alter the abundanceof endogenous RAR protein or a protein that cross-reacts withthe p300 antibody on the Western blot (Fig. 4E and data notshown). In addition, transfection of a nonsilencing controlsiRNA did not affect the level of endogenous B56 ${gamma}$ or p300 protein(data not shown). These results indicate that the B56 ${gamma}$ subunitof PP2A is required for down-regulation of endogenous p300 protein.

Next, we examined the effect of B56 ${gamma}$ siRNA on p300-dependentRAR signaling. Cells were first transfected with the RAR reporterand B56 ${gamma}$ siRNA. On the following day, the cells were again transfectedwith the B56 ${gamma}$ siRNA and induced with arotinoid acid to activatethe p300-dependent transcription mediated by RAR. As shown inFig. 4F, increasing amounts of B56 siRNA enhanced the RAR-mediatedtranscription, which is likely accomplished through augmentationof the level of p300 protein.

The B56 ${gamma}$ 3 regulatory subunit interacts with p300. To determine the precise role of the B56 subunit in the selectivep300 turnover, we examined whether PP2A forms an interactioncomplex with the transcriptional coactivator p300. To this end,p300 antibody was utilized to immunoprecipitate the endogenousp300 from HeLa cell extracts, and an antibody against the catalyticsubunit of PP2A was used for Western blot analysis. As shownin Fig. 5A, the endogenous catalytic subunit of PP2A was coprecipitatedwith p300 from nontransfected cells maintained in regular medium,indicating that p300 is able to associate with PP2A under physiologicalconditions.

View larger version (42K):
[in this window]
[in a new window]
FIG. 5. The B56 ${gamma}$ 3 regulatory subunit of PP2A associates with p300. (A) Equal amounts of whole-cell extracts were used for immunoprecipitation (IP) with a p300 antibody (lanes 2 and 3) or protein A agarose alone (lane 1) as a negative control. The precipitations were then analyzed sequentially with the antibody specific to the catalytic subunit (C) of PP2A and p300 on Western blots. Portions (10%) of the extracts used in the immunoprecipitation were subjected to Western blot analysis (lanes 4 to 6) as input control. (B) GST pull-down assays were performed with 500 µg of cell lysate from HeLa cells expressing the B56 ${gamma}$ 3 subunit and the indicated GST-p300 fusion proteins spanning the full length of p300 (p300-1, amino acids 1 to 672; p300-2, amino acids 672 to 1193; p300-3, amino acids 1069 to 1459; p300-4, amino acids 1459 to 1892; p300-5, amino acids 1893 to 2414). The blot was probed sequentially for the B56 ${gamma}$ 3 ( ${gamma}$ 3) subunit and GST tag. (C) Cells were transfected with expression plasmid for the Flag-tagged N terminus of p300 (p300N, amino acids 1 to 670; 10 µg) or the C terminus of p300 (p300C, amino acids 1135 to 2414; 10 µg). The truncated forms of p300 were purified with anti-Flag affinity gel and subjected to Western blotting with anti-Flag antibody. The blot was then stripped and reprobed for the B56 ${gamma}$ subunits of PP2A. (D) Cells were transfected with plasmids encoding either wild-type p300 (p-WT) (0.2 µg) or p300 in which the C terminus had been deleted (p- ${Delta}$ C) (2 µg) and allowed to express for 36 h. The cells were then stained with specific anti-Flag antibody and fluorophore-labeled secondary antibody for immunofluorescence microscopy. (E) Cells were transfected with RAR luciferase reporter (0.3 µg), RSV-ß-Gal (0.3 µg), B56 ${gamma}$ 3 (0.3 µg), and the wild-type p300 or p300 ${Delta}$ C (0.2 µg) for luciferase (Luc) assay. Values shown were normalized to ß-galactosidase activity and expressed as the fold induction relative to the values for untreated controls (P < 0.001 as measured by repeated analysis of variance tests). Values are means ± standard deviations (error bars) of triplicates within the representative experiments.

Next, we performed GST pull-down assays to assess whether thereis an interaction between p300 and the B56 ${gamma}$ 3 subunit of PP2A.Different purified truncated forms of GST-p300 fusion proteinspanning the full length of p300 were used to pull down transientlyexpressed B56 ${gamma}$ 3 protein. As shown in Fig. 5B, the B56 ${gamma}$ 3 subunitwas pulled down by GST-p300 containing amino acids 1459 to 1892,but not with any other GST-p300 fusion proteins tested. Theinteraction was specific to this region of p300 and was notdue to the lack of GST-p300 or B56 ${gamma}$ 3 expression, since the samecell lysate was used in each pull-down assay. Purified GST proteinwas used as a negative control in these experiments (data notshown).

To verify the interaction domain of p300 with the B56 ${gamma}$ 3 regulatorysubunit, we performed the coimmunoprecipitation experiment withFlag-tagged truncated forms of p300. The N terminus of p300was expressed in abundance, whereas only moderate levels ofthe C terminus of p300 were detected in the transfected cells(Fig. 5C). Most importantly, the B56 ${gamma}$ 3 regulatory subunit ofPP2A was copurified with the Flag-tagged C terminus, but notwith the N terminus of p300 (Fig. 5C), whereas the B56 ${gamma}$ 2 subunitwas not detected.

The B56 ${gamma}$ 3 interaction region of p300 was mapped to the C terminus(Fig. 5B and C). Therefore, we performed a transcriptional rescueassay with a p300 mutant lacking the C-terminal domain to assessthe functional significance of the interaction of p300 withthe B56 ${gamma}$ 3 regulatory subunit of PP2A. Both the wild-type andtruncated forms of p300 were localized in the nucleus and wereexpressed at comparable levels judging from the immunofluorescencestaining of an antibody directed against the Flag-tagged p300protein (Fig. 5D). The RAR reporter, the B56 ${gamma}$ 3 expression plasmid,and plasmids encoding either the wild-type p300 or the truncatedform of p300 were then cotransfected into cells. As shown inFig. 5E, the B56 ${gamma}$ 3 subunit inhibited the p300-dependent RAR signaling,whereas the coexpression of the p300 mutant lacking the B56 ${gamma}$ 3interaction region rescued the repression of the RAR-mediatedtranscription by the B56 ${gamma}$ 3 subunit, but not the coexpressionof the wild-type p300, suggesting that the negative effect ofthe B56 ${gamma}$ 3 subunit on the RAR signaling requires the C terminusof p300. In conclusion, our data suggest that the control ofp300 activity by PP2A is mediated through an interaction betweenthe B56 ${gamma}$ 3 regulatory subunit of PP2A and the coactivator.

DISCUSSION

Top

Discussion

The major conclusions from this work are that the activity ofthe transcriptional coactivator p300 is dynamically regulatedby signaling transduction and that the B56 ${gamma}$ 3 regulatory subunitof PP2A mediates valproic acid-induced p300 degradation.

Reversible phosphorylation can selectively designate proteinsfor degradation through the 26S proteasome pathway. Serine-threoninephosphorylation of I ${kappa}$ B ${alpha}$ , p27^kip1, and Jak2 promotes proteasome-mediateddegradation of these proteins (6, 48). Although phosphorylationoften triggers protein degradation, it can also be importantfor maintaining protein stability. For example, phosphorylationby mitogen-activated protein kinase increases the steady-statelevel of c-Jun and Bcl-2 (2, 35). Interestingly, HDAC inhibitorsodium butyrate has been reported to have a stimulatory effecton the enzymatic activity of protein phosphatases (9). We foundthat valproic acid, also an HDAC inhibitor, induces p300 degradationthrough increasing gene expression of the B56 ${gamma}$ subunit of PP2A(Fig. 1 and 3). Okadaic acid, a protein phosphatase inhibitor,reduces the electrophoretic mobility of p300 and augments thesteady-state level of the coactivator (Fig. 2). In addition,okadaic acid effectively reverses the negative effect of valproicacid on the level of endogenous p300 protein (Fig. 2). Takentogether, these data suggest that protein phosphatase playsan important role in the control of p300 stability and thatvalproic acid induces p300 degradation through activation ofPP2A activity.

A role for the B56 subunit of PP2A in the 26S proteasome pathwaywas first revealed for ß-catenin (44). All five B56isoforms activate glycogen synthase kinase 3ß (GSK3ß),which phosphorylates ß-catenin, targeting it for degradation.It is currently thought that various regulatory subunits ofPP2A distribute the enzyme to distinct subcellular compartments(31), which argues against a substantial overlap in localization.However, other than the B56 ${gamma}$ subunit, the spatial distributionsof the other isoforms have not been thoroughly characterized.Our results indicate that the B56 ${gamma}$ 3 subunit, not the B56 ${gamma}$ 2 subunit,is an important physiological determinant for regulation ofp300 activity (Fig. 4 and data not shown). Overexpression ofthe B56 ${gamma}$ 3 regulatory subunit of PP2A targets p300 for degradationthrough the 26S proteasome and inhibits the transcriptionalactivity of the coactivator (Fig. 4). Conversely, siRNA knockdownof the endogenous B56 ${gamma}$ of PP2A increases p300 activity (Fig.4).

Our study also revealed an interaction between p300 and thecatalytic subunit of PP2A (Fig. 5). The interaction of p300with the B56 ${gamma}$ 3 regulatory subunit is mapped to the C terminusof p300, which contains an Akt/protein kinase B phosphorylationsite (Fig. 5). Akt activity is required to maintain p300 activity(5). Reversible phosphorylation might serve as a potential molecularswitch to control p300 activity. Unlike ß-catenin,which is indirectly targeted by PP2A for ubiquitination throughGSK3ß (44), direct dephosphorylation of p300 by PP2Acould be the signal designating the coactivator for proteasome-mediateddegradation.

The extent of serine-threonine phosphorylation of p300 can bemassive (19, 42), and previously identified phosphorylationsites have been mostly tied to the transcriptional activitybut not to the metabolic stability of p300 (14, 43, 52). Okadaicacid significantly reduces the electrophoretic mobility of p300while augmenting the abundance of the coactivator (Fig. 2).However, the retardation of p300 mobility was not observed byknocking down B56 ${gamma}$ expression with siRNA, even with increasedp300 abundance (Fig. 4). This discrepancy may arise from thedifferent specificities in terms of phosphatases targeted byokadaic acid and B56 ${gamma}$ siRNA. It is possible that depending onthe cellular environment, various phosphatases are involvedin the regulation of p300 activities. Okadaic acid inhibitsa broad spectrum of phosphatases and accumulates p300 in a stateof massive phosphorylation, which results in significant retardationof its mobility on SDS-polyacrylamide gels. On the other hand,B56 ${gamma}$ siRNA specifically inhibits the activity of the B56 ${gamma}$ regulatorysubunit whose target seems to be the C terminus of p300 (Fig.5). Therefore, knocking down the B56 ${gamma}$ subunit would not affectthe global phosphorylation of p300 and therefore not its mobilityin general, which also supports a high specificity of the B56 ${gamma}$ regulatory subunit in the control of p300 activity.

Taken together, our data suggest a direct role for the B56 ${gamma}$ 3regulatory subunit of PP2A in the control of p300 function andillustrate a molecular mechanism for valproic acid-induced p300degradation. The transcriptional coactivator p300 is essentialfor embryonic development and cell proliferation (51). The levelof p300 protein in the nucleus is tightly regulated to maintainnormal development and cell proliferation (3, 51). Effectivetermination of its activity after transcriptional activationis essential for cells to ensure precisely controlled gene expression,whereas deregulation of p300 turnover would impose obstaclesfor embryonic development and an array of cellular processes.Selective p300 degradation may cause some of the side effectsof valproic acid when used in early pregnancy. Future studiesshould elucidate the extra- and intracellular signals that determinethe regulatory activity of the B56 ${gamma}$ 3 subunit on the transcriptionalcoactivator p300.

ACKNOWLEDGMENTS

We thank V. Giguere, M. O. Hottiger, M. A. Ikeda, and T. Perlmannfor plasmids. We also thank C. Kamibayashi for antibody andM. A. R. Abed for expertise.

This work was supported in part by operating grants from CanadianInstitutes of Health Research (CIHR) and The Cancer ResearchSociety, Inc. During the course of this study, Q.L. was supportedby scholarships from CIHR.

FOOTNOTES

* Corresponding author. Mailing address: Ottawa Health Research Institute, 725 Parkdale Ave., Ottawa, Ontario, Canada K1Y 4E9. Phone: (613) 798-5555, ext. 13454. Fax: (613) 761-5036. E-mail: qli{at}ohri.ca.

REFERENCES

Top