Departments of Pharmacology,1 Genetics,2 Cell and Developmental Biology,4 Lineberger Comprehensive Cancer Center, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599-7365,6 Department of Pharmacology, University of Colorado Health Sciences Center, 4200 East Ninth Ave., Denver, Colorado 80262,3 Department of Pharmacology and Toxicology, University of Arizona College of Pharmacy, Tucson, Arizona 857215
Received 27 April 2005/ Returned for modification 23 May 2005/ Accepted 15 July 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Vertebrate development is orchestrated by cell-cell interactions and cytokine gradients that regulate intracellular signaling networks. We have discovered that MEKK4 expression is regulated during development and is a critical node for the control of neural tube closure and skeletal patterning in the developing mouse embryo. In this report, we investigated the function of MEKK4 in development by the targeted inhibition of MEKK4 kinase activity. The MEKK4 gene was altered by the targeted mutation of the active site lysine to an arginine, thereby eliminating phosphotransferase activity such that the expressed MEKK4K1361R protein is unable to activate MAP2Ks. Expression of kinase-inactive MEKK4 inhibited MKK3/6 and p38 signaling and enhanced apoptosis in the hindbrains of mutant mice. Recently, deletion of the MEKK4 gene has been shown to result in exencephaly and spina bifida (6). This phenotype was attributed to a modest decrease in phosphorylation of MKK4 in the hindbrains of knockout embryos (6). Similar to the MEKK4 knockout, MEKK4 kinase-inactive embryos exhibit exencephaly and spina bifida. However, loss of phosphorylation of MKK4 was not observed in MEKK4 kinase-inactive embryos or in fibroblasts derived from these embryos. Instead, we observed inhibition of MKK3 and MAPK-activated protein kinase 2 (MAPKAPK-2) in both mutant hindbrains and fibroblasts. Additional defects not observed in the MEKK4 knockout including rib and vertebral malformations and significant infertility were found with the kinase-inactive MEKK4 mice, consistent with the prediction that kinase-inactive MEKK4 would be able to influence signaling as an inhibitory mutant in a stronger and more dramatic way than a traditional knockout where the protein was not expressed. The findings uniquely define MEKK4 as a critical node required for normal development of the mouse embryo, and its kinase activity is important for regulation of the MKK3/p38/MAPKAPK-2 pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of MEKK4K1361R mice. Genomic DNA encoding exons 18 through 23 was PCR cloned from 129Sv wild-type (wt) mouse DNA. A 3.5-kb fragment encoding exons 18 to 21 was inserted at the 5' end of the targeting vector Osdupdel (a gift from O. Smithies). Two mutations were generated in exon 21. A silent mutation introduced an SacI site in codon 1357, from CTG to CTC. In codon 1361, a single-nucleotide change from AAG to AGG produced the replacement of the active site lysine by an arginine. A 2.5-kb fragment encoding exons 22 to 23 was inserted at the 3' end of the targeting vector. The neomycin resistance gene was in the reverse orientation. Outside the region of homology, the thymidine kinase gene was present for negative selection. The targeting construct was electroporated into 129Sv embryonic stem (ES) cells. Homologous recombination in two ES cell clones was confirmed by Southern blot analysis with a probe outside the region of homology and by PCR from outside the region of the targeting vector. Southern blot analysis was performed using standard techniques with a 500-bp probe to intron 23 using primers 5' CGTTCTGAGCAGTTGCACTGGAAG 3' and 5' CCTACAATCAACATGCACACCCATC 3'. ES cells were injected into C57BL/6 blastocysts. Founder males were mated with 129Sv females (Taconic), and heterozygotes were crossed. Germ line transmission was verified by Southern blot analysis as described above and by PCR. PCR primers in exons 21 and 22, respectively, were 5' GACACAGGGGAGCTGATGGCCATGAGGGAG 3' and 5' GTGAAGCTCCACGCCAAAATACCG 3'. Experiments were performed on embryos and mice generated from MEKK4K1361R heterozygote crosses in a mixed C57BL/6 x 129/SvE background. The neo cassette was not excised from the MEKK4K1361R germ line. Several studies have shown the ability of the neo cassette to disrupt gene splicing, thus abrogating expression of the protein. Western blotting of lysates from multiple primary cell types showed equal protein expression in MEKK4K1361R cells relative to that in the wild type, demonstrating that the neo cassette does not interfere with MEKK4K1361R expression. Further, total RNA was isolated from primary cells, and reverse transcription-PCR demonstrated no significant difference in message size in MEKK4K1361R cells relative to that of the wild type. All experiments using animals were performed in compliance with all federal and institutional policies.
Skeletal preparations. For staining of cartilage and bone, embryonic day 18.5 (E18.5) fetuses were prepared as previously described (7). Cartilage was detected with Alcian blue 8GX (Sigma) and bone was detected with Alizarin red S (Sigma).
Hindlimb micromass cultures. E11.5 embryos from MEKK4K1361R/wt crosses were isolated, and limbs were dissected and cultures prepared as previously described (3). Cultures were stained with Alcian blue to detect cartilage.
Preparation of E14.5 primary MEFs. Primary mouse embryo fibroblasts (MEFs) were prepared from embryos isolated at E14.5. Head, limbs, liver, and heart were removed. Embryos were dissociated by passage three times through an 18-gauge needle, followed by trypsinization at 37°C. Cells were cultured in Iscove's modified Dulbecco's medium containing 10% heat-inactivated fetal bovine serum, 1% penicillin, and 1% streptomycin. Experiments were performed with both primary and spontaneously immortalized cells. Fibroblasts from multiple wild-type and MEKK4K1361R littermate embryos were examined with nearly identical results. A total of 200 µg of MEF lysate was probed with an affinity-purified rabbit polyclonal antibody to full-length murine MEKK4.
Embryology and histology. Depending on the age of the embryo, tail or yolk sac samples were used to genotype embryos. For histology, fetuses were isolated at E18.5, fixed whole, paraffin embedded, sectioned, and stained with hematoxylin and eosin by standard methods. For terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) and phospho-antibody staining, embryos were isolated on E9.5 and fixed in 4% paraformaldehyde for 4 h. Embryos were processed as previously described for in situ hybridizations. TUNEL staining was performed on cryosections according to the manufacturer's specifications (Roche). For phospho-MKK3/6, phospho-MKK4, phospho-MEK1/2, and phospho-MAPKAPK-2 staining, cryosections were permeabilized for 10 min in 0.1% Triton in Tris-buffered saline, pH 7.4. Sections were washed, blocked in 10% donkey serum, and incubated overnight with anti-phospho-specific antibodies diluted 1:500 in Tris-buffered saline and 5% bovine serum albumin. Sections were washed and incubated with DAPI (4',6'-diamidino-2-phenylindole; 0.04 ng/ml) and Cy3 donkey anti-rabbit diluted 1:500. Imaging was performed using an Axiovert 200 M microscope from Zeiss (Germany) and imaging software from Intelligent Imaging Innovations (Denver, Colo.). To measure fluorescence intensity, autofluorescence was subtracted from all images. Then, the mean fluorescence intensity of each antibody staining was measured in the entire hindbrain along a two-cell thickness of the neuroepithelium lining the ventricles. Statistical significance was determined by Student's t-test analysis.
Western blot analysis, immunoprecipitations, and kinase assays.
MEFs were treated as described in the figure legends. For total-cell lysates, cells were lysed in buffer A containing 20 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton-X, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 0.05 mM dithiothreitol, 1 µg/ml leupeptin, and 17 µg/ml aprotinin. A total of 15 µg of lysate was subjected to Western blotting with phospho-specific antibodies against p38, JNK, ERK, MKK3/6, MKK4, MAPKAPK-2, and heat shock protein HSP-27 (Cell Signaling) or with antibodies recognizing total p38 (11), JNK (Cell Signaling), MKK3, MKK4, and HSP27 (Santa Cruz), and actin (Sigma). Tumor necrosis factor alpha (TNF-
) was used at a concentration of 5 ng/ml (R&D Systems). Densitometry was measured with NIH Image.
293 cells were cultured in Dulbecco's modified essential medium supplemented with 10% fetal bovine serum, 1% penicillin, and 1% streptomycin. Transfections were performed in 60-mm dishes using Lipofectamine Plus reagent (Invitrogen) according to the manufacturer's specifications for 24 to 36 h. cDNAs were as previously described (11). Cells were harvested as described above for MEFs in buffer A. A total of 500 µg of lysate was immunoprecipitated for 1 h with anti-HA (12CA5) antibody, followed by incubation with protein G-Sepharose (Zymed) for 1 h. Immunoprecipitates were washed three times with cold lysis buffer and once with cold kinase buffer containing 20 mM HEPES (pH 7.4), 10 mM MgCl2, 1 mM dithiothreitol, 0.1 mM sodium vanadate, 10 mM ß-glycerophosphate, and 0.5 mM ATP. Reaction mixtures were incubated at 30°C for 20 min. Lysates and immunoprecipitates were probed with anti-FLAG (Sigma), anti-HA (12CA5), anti-phospho-MKK3/6 antibody, and anti-phospho-MKK4 antibody.
Thermal challenge of primary fibroblasts. Primary wild-type and MEKK4K1361R fibroblasts between passages three and five were utilized. For analysis of MAPK and HSP27 phosphorylation, cells were incubated at 42°C for the indicated times. Cells were lysed and probed as described above. For analysis of cell morphology, cells were plated on glass coverslips for 24 h. Cells were either untreated or preconditioned by incubation at 42°C for 30 min and allowed to recover for 24 h. Then, cells were either untreated or exposed to lethal heat shock at 45°C for 45 min. Cells were fixed for 10 min in 3% paraformaldehyde, permeabilized in phosphate-buffered saline containing 0.1% Triton X for 6 min, and stained with rhodamine phalloidin and DAPI. Imaging was performed using an Axiovert 200 M microscope as described above. Imaging software from Intelligent Imaging Innovations was used to perform nearest-neighbor deconvolution on 0.1-µm sections.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
Upon activation by MKK3/6, p38 translocates to the nucleus where it phosphorylates multiple downstream targets, including the kinase MAPKAPK-2 (28). Perturbation of p38 activation in MEKK4K1361R embryos was further established by examination of phosphorylation by MAPKAPK-2, phosphorylation that occurs directly and exclusively via p38 (28). As shown in Fig. 5R to U, phosphorylation of MAPKAPK-2 was detected in cells lining the ventricles, neuroepithelial cells of the forebrain and hindbrain, and mesenchymal cells of wild-type embryos. Significantly, phosphorylation of MAPKAPK-2 was detected in cells located at the site of neural tube closure in the hindbrain (Fig.5RR). This phosphorylation was significantly decreased in MEKK4K1361R embryos (Fig. 5V and Y). Quantitation of phospho-MAPKAPK-2 fluorescence intensity in the hindbrain revealed a 35% decrease in exencephalic hindbrains (Fig. 5Z), and a 27.5% decrease in phospho-MAPKAPK-2 staining was measured in nonexencephalic MEKK4K1361R hindbrains (not shown). This result is consistent with the diminished MKK3/6 activity in both the exencephalic and nonexencephalic hindbrains; the MEKK4K1361R phenotype is characteristic of many mutations in the developing embryo that demonstrate incomplete penetrance.
Inhibition of the p38 pathway by endogenous MEKK4K1361R expression in mouse embryonic fibroblasts.
To confirm the role of MEKK4 in regulating the p38 pathway, we examined primary fibroblasts prepared from MEKK4K1361R and littermate wild-type embryos. A consistent and highly reproducible effect of MEKK4K1361R expression in multiple primary and immortalized MEF preparations was a marked inhibition of p38 activity in cycling cells (Fig. 6A). The inhibition of p38 activity in cycling cells in the presence of 10% serum indicates that p38 is chronically inhibited in nonstressed MEKK4K1361R cells. However, there was no difference in acute p38 stimulation by the inflammatory cytokine TNF-
that does not utilize MEKK4 for p38 activation (Fig. 6B) (38). Phosphorylation of the MAP2Ks MKK3, MKK4, and MKK6 that phosphorylate p38 were also measured. Phosphorylation of MKK4 was not inhibited in MEKK4K1361R cells and P-MKK6 levels were undetectable under these conditions in either wild-type or mutant MEFs (not shown). Similar to our findings with the hindbrains of MEKK4K1361R embryos, phosphorylation of MKK3 was completely inhibited in cycling MEKK4K1361R fibroblasts, whereas TNF-
-stimulated phospho-MKK3 was unaffected (Fig. 6C). These data demonstrate that p38 and MKK3 are chronically repressed in MEKK4K1361R fibroblasts. Reduced phosphorylation of p38 in cycling cells is not due to changes in MKK4 phosphorylation but is attributable to the decreased activation of MKK3 and possibly MKK6. Similar to findings in mutant hindbrains, phosphorylation of MAPKAPK-2 was also inhibited in mutant fibroblasts. There are two isoforms of MAPKAPK-2, a 370-amino-acid form and a larger 400-amino-acid form (28), and phosphorylation of both isoforms was decreased in primary MEKK4K1361R fibroblasts (Fig. 6D). However, phosphorylation of both JNK1/2 and ERK1/2 was similar in wild-type and kinase-inactive MEKK4 cells (Fig. 6D).
|
|
| DISCUSSION |
|---|
|
|
|---|
Inhibition of p38 activity in MEKK4K1361R cycling fibroblasts corroborates the studies in embryos that MEKK4 is a primary MAP3K for controlling endogenous p38 activity. MEKK4 is important for control of p38 by serum growth factors, independent of p38 stimulation by the inflammatory cytokine TNF-
. The mechanism for p38 inhibition in cycling cells is inhibition of the activation of MKK3/6, which are direct substrates for MEKK4.
HSP27, which is downstream of p38, is known to protect cells from apoptosis. HSP27 phosphorylation in cycling MEKK4K1361R cells is markedly inhibited, consistent with the reduced activation of p38 and MAPKAPK-2. Further, heat shock-induced phosphorylation of both p38 and HSP27 was reduced in MEKK4K1361R cells, suggesting an important role for MEKK4 in the heat shock-induced stress response. We could not detect phospho-HSP27 in embryo cryosections, due to the insensitivity of the available antibodies but not due to lack of expression, as HSP27 message is constitutively expressed in the developing central nervous system (21, 35). As an in vitro validation of MEKK4 regulation of HSP27, MEKK4K1361R MEFs exposed to heat shock demonstrated a reduction in the stability of actin microfilaments.
p38 knockout mice with distinctly different phenotypes have been created by multiple laboratories, but there have been no reports in these studies of neural tube closure defects (1, 2, 14, 23, 32). However, the existence of four p38 family members may allow redundant signaling pathways to compensate for the loss of a single p38 isoform. An antiapoptotic function for p38 has been shown in vitro for macrophages and differentiating neurons (20, 26). Cleavage of MKK3 by lethal factor induces macrophage apoptosis by inhibiting p38-dependent expression of selective NF-
B target genes that protect activated macrophages from apoptosis (26). During development of cerebellar granule neurons, calcium influx activates p38, leading to the activation of MEF2, MEF2-dependent gene transcription, and cell survival (20). Expression of a dominant negative p38 promoted apoptosis of differentiating neurons that was rescued by a constitutively activated form of MEF2C, consistent with a role for p38 in transcriptional control of antiapoptotic proteins (25). These studies are consistent with our findings that MEKK4 regulates MKK3/p38/MAPKAPK-2 during development, serving a protective, antiapoptotic role.
Concurrent loss of JNK1 and JNK2 protein expression has been shown to result in defective neural tube development manifested primarily as exencephaly (30). Significantly, this phenotype was not observed in single JNK knockout animals but required the deletion of isoforms 1 and 2 (18, 30). Exencephaly in the JNK1/2 dual-knockout embryos was due to enhanced apoptosis in the forebrain and decreased apoptosis in the hindbrain (18). In comparison, we observed increased apoptosis in the hindbrains of MEKK4K1361R mice, while MKK4 signaling was not inhibited in MEKK4K1361R fibroblasts or hindbrains. These differences clearly indicate that loss of MEKK4 kinase activity does not mimic the JNK knockout. The developmental defects observed with MEKK4K1361R mice are due to mechanisms, in part involving inhibited p38 activity. We cannot rule out a contribution of JNK dysregulation in the MEKK4K1361R phenotype, but there is no measurable loss of phospho-MKK4 in the developing neuroepithelium of MEKK4K1361R-expressing mice.
MEKK4 is a large 180-kDa protein with a single catalytic domain but with multiple interaction domains that have been shown to bind Rac, Cdc42, Ccd1, Axin, and GADD45
, -ß, and -
(11, 22, 37). To preserve protein interactions and preclude compensation by other proteins, we used a knock-in strategy to create a point mutation in MEKK4, substituting the active site lysine and selectively inhibiting kinase activity. This mutant mouse enables us to ascertain effects that are solely attributable to a loss of kinase activity, as opposed to deletion of the MEKK4 gene. As predicted, overlapping phenotypes were observed for the MEKK4 knockout and the MEKK4 kinase-inactive mouse. Common features are reduced phosphorylation of p38 in cycling fibroblasts and increased embryonic lethality with neural tube closure defects. Chi et al. attributed the neural tube defects to a very modest decrease in MKK4 phosphorylation without a change in JNK phosphorylation (5, 6). We observed a significantly stronger phenotype with additional defects in the MEKK4K1361R mouse. The dominant phenotype of MEKK4K1361R mice with severe skeletal patterning defects including rib malformations and scoliosis was not described for MEKK4 knockout mice. Also, MEKK4K1361R mice are infertile, unlike MEKK4 knockout mice, which have normal reproductive capacity (5). Some of the differences in the phenotypes of MEKK4K1361R knock-in and MEKK4 knockout mice may be due to differences in genetic backgrounds. Studies of MEKK4K1361R knock-in mice were performed with a mixed 129-C57BL/6 background; the studies of the MEKK4 knockout were performed on both a mixed 129-C57BL/6 background and a C57BL/6 background (5, 6). It is our belief that a kinase-inactive MEKK4 protein, expressed at levels similar to that of the wild-type kinase, is a better indicator of the function of MEKK4 kinase signaling than a null mutant. The behavior of the MEKK4K1361R mutant is much like that predicted for a high-affinity, selective inhibitor of MEKK4. The mutant MEKK4 protein occupies its space in the cell, and expression is from the endogenous gene by the MEKK4 promoter.
It is important to contrast the MEKK4 kinase-inactive phenotype to that of knockouts for downstream kinases controlled by MEKK4. MAP3Ks provide selectivity for activation of MAPKs by upstream stimuli, and there are multiple MAP3Ks that regulate the MKK3/MKK6/p38 pathway (15). The inhibition of serum, but not TNF-
activation of p38 in MEKK4K1361R fibroblasts, demonstrates the selective role of MEKK4 in regulating the p38 pathway. For this reason, the MEKK4K1361R phenotype will not be strictly mimicked by the MKK3/MKK6, p38, or MAPKAPK-2 knockouts. Similarly, MAPKAPK-2 is only one of many p38 substrates; therefore, the MAPKAPK-2 knockout is phenotypically different from the p38 knockout or MEKK4K1361R knock-in. For example, the MAPKAPK-2 knockout mouse shows protection from many pathophysiological stress stimuli that induce expression of TNF-
or interleukin-1 (17), but it is otherwise overtly normal and fertile. This contrasts with p38
knockouts that have vascular, hematopoietic, and placental defects (14), even though MAPKAPK-2 is clearly a p38 substrate. Similarly, kinase-inactive MEKK4 mice have both skeletal patterning and neurulation dysregulation, a phenotype not observed with any MAPK knockout but observed with the ablation of the scaffolding proteins TRAF4 and disheveled-2 (12, 27). Our results suggest that MAP3K kinase-inactive knock-ins will aid in defining the complexity of MAPK integration with developmental and physiological responses that are not readily apparent with ablation of MAPK expression (15).
| ACKNOWLEDGMENTS |
|---|
We have no financial conflicts of interest related to these studies.
We thank Pamela J. Cuevas for her expertise in evaluation of the X-ray images. We also acknowledge the technical assistance of Virginia Godfrey and the Lineberger Cancer Center Histopathology Core. We also thank Yongqin Wu for her work on E10.5 in situ hybridizations. We thank G. T. Rosenthal of the UCHSC for technical assistance with the mouse colony.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
MAP kinase in placental but not embryonic cardiovascular development. Mol. Cell 6:109-116.[CrossRef][Medline]
2. Allen, M., L. Svensson, M. Roach, J. Hambor, J. McNeish, and C. A. Gabel. 2000. Deficiency of the stress kinase p38
results in embryonic lethality: characterization of the kinase dependence of stress responses of enzyme-deficient embryonic stem cells. J. Exp. Med. 191:859-870.
3. Bhasin, N., E. Kernick, X. Luo, H. E. Seidel, E. R. Weiss, and J. M. Lauder. 2004. Differential regulation of chondrogenic differentiation by the serotonin 2B receptor and retinoic acid in the embryonic mouse hindlimb. Dev. Dyn. 230:201-209.[CrossRef][Medline]
4. Brancho, D., N. Tanaka, A. Jaeschke, J. J. Ventura, N. Kelkar, Y. Tanaka, M. Kyuuma, T. Takeshita, R. A. Flavell, and R. J. Davis. 2003. Mechanism of p38 MAP kinase activation in vivo. Genes Dev. 17:1969-1978.
5. Chi, H., B. Lu, M. Takekawa, R. J. Davis, and R. A. Flavell. 2004. GADD45ß/GADD45
and MEKK4 comprise a genetic pathway mediating STAT4-independent IFN
production in T cells. EMBO J. 23:1576-1586.[CrossRef][Medline]
6. Chi, H., M. R. Sarkisian, P. Rakic, and R. A. Flavell. 2005. Loss of mitogen-activated protein kinase kinase kinase 4 (MEKK4) results in enhanced apoptosis and defective neural tube development. Proc. Natl. Acad. Sci. USA 102:3846-3851.
7. Compagni, A., M. Logan, R. Klein, and R. H. Adams. 2003. Control of skeletal patterning by ephrin B1-EphB interactions. Dev. Cell 5:217-230.[CrossRef][Medline]
8. Copp, A. J., N. D. Greene, and J. N. Murdoch. 2003. The genetic basis of mammalian neurulation. Nat. Rev. Genet. 4:784-793.[CrossRef][Medline]
9. Garrido, C., S. Gurbuxani, L. Ravagnan, and G. Kroemer. 2001. Heat shock proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys. Res. Commun. 286:433-442.[CrossRef][Medline]
10. Garrington, T. P., and G. L. Johnson. 1999. Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr. Opin. Cell Biol. 11:211-218.[CrossRef][Medline]
11. Gerwins, P., J. L. Blank, and G. L. Johnson. 1997. Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. J. Biol. Chem. 272:8288-8295.
12. Hamblet, N. S., N. Lijam, P. Ruiz-Lozano, J. Wang, Y. Yang, Z. Luo, L. Mei, K. R. Chien, D. J. Sussman, and A. Wynshaw-Boris. 2002. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development 129:5827-5838.
13. Harris, M. J., and D. M. Juriloff. 1999. Mini-review: toward understanding mechanisms of genetic neural tube defects in mice. Teratology 60:292-305.[CrossRef][Medline]
14. Ihle, J. N. 2000. The challenges of translating knockout phenotypes into gene function. Cell 102:131-134.[CrossRef][Medline]
15. Johnson, G. L., H. G. Dohlman, and L. M. Graves. 2005. MAPK kinase kinases (MKKKs) as a target class for small-molecule inhibition to modulate signaling networks and gene expression. Curr. Opin. Chem. Biol. 9:325-331.[CrossRef][Medline]
16. Juriloff, D. M., and M. J. Harris. 2000. Mouse models for neural tube closure defects. Hum. Mol. Genet. 9:993-1000.
17. Kotlyarov, A., A. Neininger, C. Schubert, R. Eckert, C. Birchmeier, H. D. Volk, and M. Gaestel. 1999. MAPKAP kinase 2 is essential for LPS-induced TNF-alpha biosynthesis. Nat. Cell Biol. 1:94-97.[CrossRef][Medline]
18. Kuan, C. Y., D. D. Yang, D. R. Samanta Roy, R. J. Davis, P. Rakic, and R. A. Flavell. 1999. The Jnk1 and Jnk2 protein kinases are required for regional specific apoptosis during early brain development. Neuron 22:667-676.[CrossRef][Medline]
19. Lavoie, J. N., H. Lambert, E. Hickey, L. A. Weber, and J. Landry. 1995. Modulation of cellular thermoresistance and actin filament stability accompanies phosphorylation-induced changes in the oligomeric structure of heat shock protein 27. Mol. Cell. Biol. 15:505-516.[Abstract]
20. Mao, Z., A. Bonni, F. Xia, M. Nadal-Vicens, and M. E. Greenberg. 1999. Neuronal activity-dependent cell survival mediated by transcription factor MEF2. Science 286:785-790.
21. Michaud, S., R. Marin, and R. M. Tanguay. 1997. Regulation of heat shock gene induction and expression during Drosophila development. Cell. Mol. Life Sci. 53:104-113.[CrossRef][Medline]
22. Mita, H., J. Tsutsui, M. Takekawa, E. A. Witten, and H. Saito. 2002. Regulation of MTK1/MEKK4 kinase activity by its N-terminal autoinhibitory domain and GADD45 binding. Mol. Cell. Biol. 22:4544-4555.
23. Mudgett, J. S., J. Ding, L. Guh-Siesel, N. A. Chartrain, L. Yang, S. Gopal, and M. M. Shen. 2000. Essential role for p38
mitogen-activated protein kinase in placental angiogenesis. Proc. Natl. Acad. Sci. USA 97:10454-10459.
24. Neubuser, A., H. Koseki, and R. Balling. 1995. Characterization and developmental expression of Pax9, a paired-box-containing gene related to Pax1. Dev. Biol. 170:701-716.[CrossRef][Medline]
25. Okamoto, S., D. Krainc, K. Sherman, and S. A. Lipton. 2000. Antiapoptotic role of the p38 mitogen-activated protein kinase-myocyte enhancer factor 2 transcription factor pathway during neuronal differentiation. Proc. Natl. Acad. Sci. USA 97:7561-7566.
26. Park, J. M., F. R. Greten, Z. W. Li, and M. Karin. 2002. Macrophage apoptosis by anthrax lethal factor through p38 MAP kinase inhibition. Science 297:2048-2051.
27. Regnier, C. H., R. Masson, V. Kedinger, J. Textoris, I. Stoll, M. P. Chenard, A. Dierich, C. Tomasetto, and M. C. Rio. 2002. Impaired neural tube closure, axial skeleton malformations, and tracheal ring disruption in TRAF4-deficient mice. Proc. Natl. Acad. Sci. USA 99:5585-5590.
28. Roux, P. P., and J. Blenis. 2004. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol. Mol. Biol. Rev. 68:320-344.
29. Ruland, J., G. S. Duncan, A. Elia, I. del Barco Barrantes, L. Nguyen, S. Plyte, D. G. Millar, D. Bouchard, A. Wakeham, P. S. Ohashi, and T. W. Mak. 2001. Bcl10 is a positive regulator of antigen receptor-induced activation of NF-
B and neural tube closure. Cell 104:33-42.[CrossRef][Medline]
30. Sabapathy, K., W. Jochum, K. Hochedlinger, L. Chang, M. Karin, and E. F. Wagner. 1999. Defective neural tube morphogenesis and altered apoptosis in the absence of both JNK1 and JNK2. Mech. Dev. 89:115-124.[CrossRef][Medline]
31. Takekawa, M., F. Posas, and H. Saito. 1997. A human homolog of the yeast Ssk2/Ssk22 MAP kinase kinase kinases, MTK1, mediates stress-induced activation of the p38 and JNK pathways. EMBO J. 16:4973-4982.[CrossRef][Medline]
32. Tamura, K., T. Sudo, U. Senftleben, A. M. Dadak, R. Johnson, and M. Karin. 2000. Requirement for p38
in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell 102:221-231.[CrossRef][Medline]
33. Uhlik, M. T., A. N. Abell, N. L. Johnson, W. Sun, B. D. Cuevas, K. E. Lobel-Rice, E. A. Horne, M. L. Dell'Acqua, and G. L. Johnson. 2003. Rac-MEKK3-MKK3 scaffolding for p38 MAPK activation during hyperosmotic shock. Nat. Cell Biol 5:1104-1110.[CrossRef][Medline]
34. Wada, T., and J. M. Penninger. 2004. Mitogen-activated protein kinases in apoptosis regulation. Oncogene 23:2838-2849.[CrossRef][Medline]
35. Walsh, D., Z. Li, Y. Wu, and K. Nagata. 1997. Heat shock and the role of the HSPs during neural plate induction in early mammalian CNS and brain development. Cell. Mol. Life Sci. 53:198-211.[CrossRef][Medline]
36. Wilkinson, D. G., S. Bhatt, and B. G. Herrmann. 1990. Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343:657-659.[CrossRef][Medline]
37. Wong, C. K., W. Luo, Y. Deng, H. Zou, Z. Ye, and S. C. Lin. 2004. The DIX domain protein coiled-coil-DIX1 inhibits c-Jun N-terminal kinase activation by Axin and dishevelled through distinct mechanisms. J. Biol. Chem. 279:39366-39373.
38. Yang, J., Y. Lin, Z. Guo, J. Cheng, J. Huang, L. Deng, W. Liao, Z. Chen, Z. Liu, and B. Su. 2001. The essential role of MEKK3 in TNF-induced NF-
B activation. Nat. Immunol. 2:620-624.[CrossRef][Medline]
39. Zelzer, E., and B. R. Olsen. 2003. The genetic basis for skeletal diseases. Nature 423:343-348.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|