Nuclear Dynamics of PCNA in DNA Replication and Repair

The DNA polymerase processivity factor proliferating cell nuclearantigen (PCNA) is central to both DNA replication and repair.The ring-shaped homotrimeric PCNA encircles and slides alongdouble-stranded DNA, acting as a "sliding clamp" that localizesproteins to DNA. We determined the behavior of green fluorescentprotein-tagged human PCNA (GFP-hPCNA) in living cells to analyzeits different engagements in DNA replication and repair. Photobleachingand tracking of replication foci revealed a dynamic equilibriumbetween two kinetic pools of PCNA, i.e., bound to replicationfoci and as a free mobile fraction. To simultaneously monitorPCNA action in DNA replication and repair, we locally inflictedUV-induced DNA damage. A surprisingly longer residence timeof PCNA at damaged areas than at replication foci was observed.Using DNA repair mutants, we showed that the initial recruitmentof PCNA to damaged sites was dependent on nucleotide excisionrepair. Local accumulation of PCNA at damaged regions was observedduring all cell cycle stages but temporarily disappeared duringearly S phase. The reappearance of PCNA accumulation in discretefoci at later stages of S phase likely reflects engagementsof PCNA in distinct genome maintenance processes dealing withstalled replication forks, such as translesion synthesis (TLS).Using a ubiquitination mutant of GFP-hPCNA that is unable toparticipate in TLS, we noticed a significantly shorter residencetime in damaged areas. Our results show that changes in theposition of PCNA result from de novo assembly of freely mobilereplication factors in the nucleoplasmic pool and indicate differentbinding affinities for PCNA in DNA replication and repair.

INTRODUCTION

Top

Introduction

Proper duplication, maintenance, and repair of the genome areessential for ensuring genomic stability. Defects in any ofthese processes contribute to the onset and progression of cancer(9), because genomic DNA is subject to damage by both environmentalagents and endogenous metabolic processes. In addition, stallingof the DNA replication machinery, which occurs upon encounteringdamaged DNA, is a challenging problem for cells. A variety ofDNA damage bypass and repair mechanisms rescue replication afterencountering DNA lesions. Protein clamps on DNA have been implicatedin all processes of DNA metabolism, including DNA replicationand repair. The most extensively investigated protein clampin eukaryotes is the DNA polymerase processivity factor proliferatingcell nuclear antigen (PCNA).

PCNA is a central protein in both DNA replication and repair.PCNA encircles double-stranded DNA as a trimer, forming a slidingclamp that tethers proteins such as polymerases to DNA (5).PCNA is essential not only for DNA replication but also forseveral forms of DNA repair, including nucleotide excision repair(NER), the major pathway by which cells remove DNA damage introducedby UV light and a variety of chemical carcinogens (10). Afterrecognition of the lesion, the damaged strand is excised andresynthesized in a process requiring PCNA. However, some lesions,such as cyclobutyl pyrimidine dimers (CPDs), are repaired slowlyby NER, and unrepaired CPDs remain in the DNA (13). During replication,mammalian cells can circumvent this damage by using a groupof specialized polymerases, referred to as translesion synthesis(TLS) polymerases, which also require PCNA (16). Although TLSdoes not result in damage removal and can be mutagenic, damagebypass is an important component of the overall cellular responseto DNA damage and makes an important contribution to cellularsurvival. Replication of mildly damaged DNA can be advantageousto the cell because it provides a sister chromatid that canbe used as a template for repair by homologous recombination.

A central question is how eukaryotic cells accomplish the switchingfrom a high-fidelity replicative polymerase to a specializedTLS polymerase. A recent study demonstrated that in human cells,PCNA becomes monoubiquitinated at the lysine residue at position164 (K164) upon UV irradiation and that monoubiquitinated PCNAspecifically interacts with the TLS polymerase pol ${eta}$ (14). Therefore,it was suggested that the state of monoubiquitination of thesliding clamp, PCNA, might serve as a switch that enables orabrogates binding of PCNA to pol ${eta}$ . To obtain insight into themode of action of PCNA in living mammalian cells in DNA damageand repair, we generated cell lines expressing the human PCNAprotein tagged with green fluorescent protein (GFP-hPCNA). Usingtime-lapse microscopy and photobleaching studies, we analyzedthe dual involvement of PCNA in replication and repair. Furthermore,we tested the role of PCNA monoubiquitination in vivo by generatingcell lines stably expressing mutant GFP-hPCNA^K164R.

MATERIALS AND METHODS

Top

Materials and Methods

Cell culture and DNA constructs. CHO9 cells were cultured at 37°C in Dulbecco’s modifiedEagle’s medium (Gibco) supplemented with antibiotics and10% fetal calf serum under an atmosphere of 5% CO₂. A cDNA encodingGFP-hPCNA and yellow fluorescent protein-hPCNA was constructedby digesting the PT7 vector containing the entire 1.4-kb humanPCNA cDNA insert (kindly provided by Bruce Stillman, Cold SpringHarbor Laboratory, New York) with NdeI and BamHI to producea 900-bp fragment, which was isolated. DNA ends were bluntedand cloned in frame into the SmaI site of the eGFP-C1 and eYFP-C1vectors (Clontech). The mutant construct GFP-hPCNA^K164R wasgenerated using the QuikChange site-directed mutagenesis method(Stratagene) and the primers pcna-KR (5' AGATGCTGTTGTAATTTCCTGTGCACGTGACGGAGTGAAATTTTCTGCAAGT3') and pcna-KR-rev (5' ACTTGCAGAAAATTTCACTCCGTCACGTGCACAGGAAATTACAACAGCATCT3'). The constructs were sequenced to verify the presence ofthe K164R mutation. CHO9 cells stably expressing these cDNAswere generated by transfection using Lipofectamine 2000 (Invitrogen).Cells were further screened for the presence and proper expressionlevel of nuclear fluorescence by cell sorting with a FACSVantagecell sorter (Becton Dickinson) and immunoblot analysis usinga monoclonal anti-PCNA (DAKO) and anti-GFP antibodies (Roche).The generation of the CFP-hRAD51 construct has been describedelsewhere (27).

Cell cycle analysis. For cell cycle experiments, cells were irradiated with 10 J/m²of UV light (254 nm) 2 days after plating. The cells (5 x 10⁶)were trypsinized and fixed, using 70% ice-cold ethanol, at differenttime points after UV irradiation (0, 8, and 16 h). After beingwashed with phosphate-buffered saline, the cells were resuspendedin 400 µl of phosphate-buffered saline containing 0.1%Triton X-100, 8 µg propidium iodide, and 80 µg RNase.Cell suspensions were left for incubation overnight at 4°C,and the cell cycle profile was measured in the PE, TC channelon a FACScan instrument (Becton Dickinson).

Local UV irradiation and immunostaining. Local UV irradiation and immunostaining have been describedin detail previously (22).

Confocal microscopy. Cells were treated with UV radiation and subjected to photobleachingexperiments after irradiation. Confocal images of living cellsexpressing GFP-hPCNA were obtained using a Zeiss LSM 510 microscopeequipped with a 25-mW Ar laser at 488 nm and a 40x 1.3-numerical-apertureoil immersion lens. Images of single nuclei were taken at lateralsample intervals of 100 nm. GFP fluorescence was detected usinga dichroic beam splitter (HFT488), and an additional 505- to530-nm bandpass emission filter was placed in front of the photomultipliertube. Photobleaching experiments were performed and analyzedas described previously (6).

RESULTS AND DISCUSSION

Top

Results and Discussion

Imaging ongoing DNA replication in living cells. To visualize DNA replication in living cells, we generated CHOcells that stably express human PCNA tagged with GFP. Immunoblotanalysis of the cells expressing GFP-hPCNA with anti-PCNA antibodiesshowed that the expression levels of endogenous and GFP-hPCNAwere similar (Fig. 1A, left panel). Hybridization with anti-GFPantibodies revealed no GFP-hPCNA breakdown products, indicatingthat the fusion protein remained intact (Fig. 1A, right panel).The expression of GFP-hPCNA did not interfere with normal cellcycle progression or with cell cycle progression in responseto UV irradiation (Fig. 1B). In addition, cells were testedfor their UV sensitivities, and no significant difference insurvival rates was detected (data not shown). We then analyzedthe spatial and temporal organization of DNA replication sites.To analyze the large-scale relocalization of GFP-hPCNA, cellswere followed through mitosis by time-lapse imaging (Fig. 1C;see also online movie at http://www.erasmusmc.nl/oic/essers_pcna).GFP-hPCNA displayed the specific distribution patterns of PCNAthroughout the different stages of the cell cycle (17, 25).GFP-hPCNA was strictly localized in the nuclei of living cells,and the distinct focal distributions at early-, mid-, and late-S-phasereplication sites were clearly identified (Fig. 1C). Cells wereimaged every 10 min for 5 h. All four cells shown in Fig. 1Ccould be followed through mitosis while they underwent the characteristicrelocalization of PCNA as they progressed through the cell cycle.From these movies, we determined the average time spans of theG₁ phase (380 ± 250 min), the early S phase (266 ±26 min), the mid-S phase (323 ± 53 min), the late S phase(141 ± 39 min), and the G₂ phase (77 ± 19 min).This shows that the times needed to progress through one completecell cycle varied greatly in individual cells, with the largestvariation in the durations of the G₁ phase.

View larger version (30K):
[in this window]
[in a new window]
FIG. 1. Characterization of CHO9 cells expressing GFP-hPCNA. (A) Immunoblot analysis. Whole-cell extracts of CHO9 cells and CHO9 cells stably expressing GFP-hPCNA were analyzed for the presence of endogenous PCNA and GFP-hPCNA by immunoblotting using antibodies against PCNA (left panel) and GFP (right panel). (B) Cell cycle analyses. CHO9 cells and CHO9 cells expressing GFP-hPCNA were irradiated with UV light (10 J/m²). After the indicated time points, the cells were analyzed for DNA content using a fluorescence-activated cell sorter. In each histogram, the counted cells are plotted against the relative fluorescence intensities derived from the propidium iodide signal. (C) Time-lapse imaging of four cells expressing GFP-hPCNA. Cells were imaged every 10 min during a 5-h period. Shown are the images taken every 60 min. All four cells will go through cell division and follow the characteristic PCNA focal pattern. Small dots are characteristic for early S phase, staining at the periphery of the nucleus marks the mid-S phase, and big blobs mark the late S phase. The G₂ cell divided first and, depending on their stages in S phase, the other cells followed. (D) Analysis of movement of PCNA replication structures in living cells done by tracking individual PCNA replication structures in single cells. In the background, the PCNA staining pattern at time point zero is shown in grayscale. Positions of the centers of replication structures were determined in each frame of a movie from the focal plane of a cell, and consecutive positions were connected by lines. Cells were examined for 30 min using time-lapse video microscopy at intervals of 30 s. The coordinates of each focus in the cell were determined at every 30-s time interval (Volocity; Improvision). Each individually colored track represents the movement of a different focus during the period captured. The last image shows the zoom image of the mid-S-phase cell.

Replication of the mammalian genome starts at thousands of originsthat are activated at different times during S phase. Usingtracking of individual sites of replication foci representedby PCNA, we investigated how this replication program is coordinated.We analyzed the small-scale movement of replication foci duringearly and mid-S phase by imaging GFP-hPCNA every 30 secondsfor 30 min. Tracking of individual replication foci over timeshowed limited but asynchronous x and y axis shifts (Fig. 1D).This constrained motion in the microenvironment is most likelydue to the Brownian motion of the chromosome fiber and has alsobeen observed in other eukaryotes (2, 18). In these studies,the constrained diffusion of specific chromatin domains wasalso observed. When we analyzed the transition from early Sphase to mid-S phase, we were unable to track individual focitranslocating from the interior of the nucleus to the periphery.This is consistent with previously reported photobleaching experiments,which suggested that the transition from earlier to later repliconsoccurs by disassembly into a nucleoplasmic pool of highly mobilesubcomponents and subsequent reassembly at newly activated sites(26).

Accumulation of GFP-hPCNA at sites of local UV-induced DNA damage in different stages of the cell cycle. In addition to playing a pivotal role of PCNA in replication,this protein is also required for different DNA repair mechanisms,including DNA damage response towards the major UV-induced DNAlesions, i.e., CPDs and 6-4 photoproducts (1, 7, 23). To examinethe dual involvement of PCNA in the repair of UV-induced DNAdamage and DNA replication, we visualized both processes simultaneouslyin the same cells using time-lapse microscopy. To visually distinguishbetween repair and replication, we used a local UV irradiationtechnique. DNA damage was induced at restricted areas in thenucleus by covering cells with a UV-blocking membrane containingrandomly distributed pores with diameters of $~$ 5 µm andsubsequently UV irradiating them (21). Soon after UV irradiation(within $~$ 10 min), GFP-hPCNA accumulated in brightly fluorescentregions (7). This local accumulation could be detected in cellswith diffuse GFP-hPCNA staining, indicative of G₁ and G₂ cells,and in cells with the different S-phase-specific PCNA patterns.The presence and position of the UV-damaged DNA was confirmedand visualized in fixed cells by immunofluorescence using CPD-specificantibodies. The involvement of NER in the repair of this localUV-induced damage was shown by indirect immunofluorescence experimentsusing antibodies against CPD and the NER factor TFIIH. The TFIIHcomponent XPB concentrates in areas containing locally inducedUV-induced DNA damage (Fig. 2A, top row) (21, 28). Simultaneousvisualization of CPDs and PCNA by immunofluorescence revealedthat CPDs and PCNA colocalized (Fig. 2A, middle row). On topof the normal PCNA replication pattern, an accumulation of PCNAat the CPDs was observed. Eighty to 90% of the cells with localCPD accumulation also showed local PCNA accumulation 1 to 8h after local UV irradiation. The requirement of active NERfor confined PCNA accumulation was confirmed in a NER-deficientcell line, UV135 (Fig. 2A, bottom row, and B). Using this cellline, which is deficient in one of the incision nucleases ofNER, XPG, we found a significant reduction of the immediateaccumulation of PCNA on a locally UV-damaged area.

View larger version (30K):
[in this window]
[in a new window]
FIG. 2. Accumulation of DNA repair proteins at sites of local UV-induced damage. (A) Upper panels: XPB and CPDs colocalize. CHO cells deficient in XPB (27-1) complemented with XPB-GFP were locally UV irradiated (locally damaged cells are indicated with the arrows). One hour after UV irradiation, DNA damage was detected with antibodies against CPDs (shown in red), and XPB-GFP accumulation was detected with antibodies against GFP (shown in green). Colocalization of XPB and CPDs is demonstrated in the merged image. Middle panels: PCNA and CPDs display colocalization. CHO9 cells expressing GFP-hPCNA were locally UV irradiated. One hour after UV irradiation, cells were fixed, DNA was denatured, and DNA damage was detected by indirect immunofluorescence using antibodies against CPDs (shown in red). GFP-hPCNA was also detected by indirect immunofluorescence using antibodies against GFP (shown in green). Shown are three GFP-hPCNA-expressing cells in different stages of the cell cycle. On top of the replication pattern of PCNA, one cell shows local accumulation of GFP-hPCNA, which colocalizes with the CPD signal (shown in yellow in the merged image). Bottom panels: No colocalization of PCNA and CPDs in a NER-deficient cell line, UV135, which is deficient in XPG. Locally irradiated UV135 cells expressing GFP-hPCNA were fixed 1 hour after irradiation and stained using antibodies against GFP (in green) and CPDs (in red). The bottom cell shows local accumulation of CPDs but no accumulation of PCNA. (B) Quantitation of the results shown in Fig. 2A, middle and bottom panels. The percentages of local CPD accumulations that also show local PCNA accumulation after local UV irradiation were determined at the indicated time points for CHO9 and UV135 cells. For all cell lines, 65 to 70 cells were examined. (C) Time-lapse imaging of GFP-hPCNA in cells treated with local UV damage shows transient accumulation of GFP-hPCNA (indicated by the circles) at sites of local UV damage in different stages of the cell cycle. Based on the PCNA replication pattern, the upper cell was at the transition from the G₁ phase to the early S phase, and the lower cell was in the early S phase. In the upper cell, this local GFP-hPCNA accumulation disappeared for a short period during the early S phase but reappeared at the transition from the early S phase to the mid-S phase. In the lower cell, the local GFP-hPCNA accumulation disappeared in the G₂ phase and the subsequent G₁ phase in the daughter cells. Note the decrease in fluorescence signal around mitosis as a result of cells rounding up and detaching from the coverslips. (D) Colocalization of PCNA and Rad51 at site of local damage. Chinese hamster ovary cells stably expressing both YFP-hPCNA and CFP-hRAD51 were locally UV irradiated. Cells were fixed 1, 4, 8, and 16 h after UV irradiation, and local accumulation of PCNA and Rad51 was directly detected using the appropriate filter sets (Chroma) to discriminate between cyan fluorescent protein and yellow fluorescent protein. At all these different time points, we found examples of local accumulations of PCNA (shown in green) and Rad51 (shown in red) during S phase, where the focal pattern of PCNA partly colocalized with the focal pattern of Rad51 (shown in the merged image).

This information allowed us to follow the behavior of GFP-hPCNAin UV-damaged DNA repair and DNA replication. We performed time-lapseimaging of living locally irradiated CHO cells, in which UV-inducedCPDs are not effectively removed by nucleotide excision repair(13), to follow the fate of local UV-damaged areas through cellcycle progression. Figure 2C (and supplementary online movie2 at http://www.erasmusmc.nl/oic/essers_pcna) shows an exampleof two cells, one irradiated during G₁ phase and the other duringits transition from early S to mid-S phase. Both cells, showinglocal concentrations of PCNA at the sites of UV irradiation,were subsequently followed through their cell cycle progressionsat 10-min time intervals. Surprisingly, in the upper cell, imagedfrom G₁/early S to mid-S phase, the local PCNA accumulationwas present during the entire capturing period of 11 h but temporarilydisappeared in early S phase. In the lower cell, imaged fromearly/mid-S to G₁ phase, the local GFP-hPCNA accumulation waspresent until late S phase and disappeared in the G₂ phase.The initial local accumulation of PCNA that was observed duringthe G₁ phase shows a homogeneous pattern indicative of the participationof PCNA in active NER, since NER factor accumulations on damagedspots show a similar distribution pattern. However, the damage-dependentaccumulation temporarily disappeared during early S phase. Thereappearance of PCNA accumulation in discrete foci occurredat longer time points after irradiation, which likely reflectsengagements of PCNA in other genome maintenance processes dealingwith lesion-stalled replication forks, such as TLS or homologousrecombination. Indeed, we found that this focal distributionof PCNA at the site of the local damage during S phase partlycolocalized with the focal pattern of Rad51, a key protein implicatedin stalled replication fork repair through homologous recombination(Fig. 2D). Since these time-lapse experiments indicated thatthe behavior of PCNA molecules in the UV-damaged areas is dynamic,we analyzed the mobility of PCNA in the different stages ofthe cell cycle and in DNA repair.

Mobility of GFP-hPCNA in the nucleus. To analyze the diffusion properties of GFP-hPCNA within thedifferent stages of the cell cycle in nuclei of living cells,fluorescence redistribution after photobleaching (FRAP) wasused (12, 20, 30). In the applied FRAP variant, we irreversiblyquenched the fluorescence of a small strip spanning the entirenucleus and subsequently recorded the recovery of fluorescenceover a time period of 6 seconds. From these recovery curves,both the immobile fraction and the effective diffusion coefficient(D_eff) of PCNA were determined (4, 11). The fluorescence recoveredto 65% for cells in the G₁/G₂ phase of the cell cycle (since35% of the total pool was permanently bleached), which was similarto that for free GFP in our experimental setup and indicatesthat the vast majority of the detected GFP-hPCNA molecules weremobile at these stages in the cell cycle (Fig. 3A) (6). However,when PCNA started forming replication foci in early S phase,about half the GFP-hPCNA molecules became (transiently) immobilized.Furthermore, a (transiently) immobile PCNA fraction was alsodetected in mid- and late-S-phase cells. When we analyzed themobile fraction as shown in Fig. 3A to determine the D_eff ofGFP-hPCNA in the nucleoplasm during the different stages ofthe cell cycle, we found no significant differences in the velocitiesof the mobile fraction of GFP-hPCNA (Fig. 3B).

View larger version (52K):
[in this window]
[in a new window]
FIG. 3. Fluorescence redistribution after photobleaching analyses of GFP-hPCNA before DNA damage induction. Cells stably expressing PCNA fused to GFP were subjected to a local bleach pulse, and the kinetics of fluorescence recovery in the bleached area was determined. (A) The fluorescence in a small strip spanning the entire nucleus was bleached with a 200-ms high-intensity laser pulse. The recovery of fluorescence in the strip was monitored at intervals of 100 ms, and the measured fluorescence intensities over time were plotted. This photobleaching protocol was applied to GFP-hPCNA-expressing cells in the different stages of the cell cycle. To determine the immobile fractions, the final measured fluorescence intensity was normalized to the prebleaching pulse fluorescence intensity. (B) Diffusion coefficient of GFP-hPCNA in different stages of the cell cycle. To determine the D_eff, the fluorescence intensity immediately after bleaching and the final postbleaching pulse fluorescence intensity measured were normalized between zero and one. The D_effs in the different stages of the cell cycle were determined by fitting the experimentally obtained curves to a mathematical model describing diffusion (6). Measurements were performed in triplicate, and consistent results were obtained among different sets of experiments. Error bars indicate twice the standard errors of the mean. (C) Fluorescence loss in photobleaching and fluorescence redistribution after photobleaching of GFP-hPCNA in different stages of the cell cycle. The lower region of a cell containing replication foci was bleached by a single laser pulse. The cell was imaged at the indicated times after bleaching. FLIP was measured in the unbleached half of the cell, while FRAP was measured in the bleached half of the same cell. The same experimental protocol was applied to cells in the early, mid-, and late S and G₁/G₂ phases of the cell cycle. (D) Quantitation of the simultaneous FRAP and FLIP experiment on GFP-hPCNA replication foci. "n" represents the number of cells examined.

Dynamics of replication foci. Next, we analyzed the mobility of PCNA in replication foci.Attempts to determine whether replication foci are static ordynamic structures in which PCNA shows turnover have producedconflicting conclusions (24, 26). One study reported that theDNA polymerase clamp shows no turnover at established replicationsites (26), while the other reported that replication foci exhibitedPCNA turnover with a relatively short half-life ( $~$ 25 s) (24).However, differences in the experimental setups of these reportsmay account for their conflicting conclusions. Some featuresof PCNA assembly and disassembly into replication foci appearnot to be in dispute. Both reports agree that the transitionfrom earlier to later replicons occurs by the dissociation ofPCNA into a nucleoplasmic pool of rapidly diffusing subcomponentsand reassembly at newly activated sites. The controversy ariseswhen considering the stability of PCNA assembled into individualreplication foci. Sporbert et al. bleached a small area in amid-S-phase cell containing $~$ 10 replication foci and comparedtime overlays of the prebleaching image and the images afterrecovery. They concluded that the bleached foci reappear atadjacent spots. This qualitative analysis does not take intoaccount the Brownian motion of replication foci as observedin the research presented here (Fig. 1D). Solomon et al. bleacheda large area of the nucleus and measured the average recoveryin the bleached area. To unambiguously determine whether PCNAis contained within established replication foci by long-livedprotein interactions or in a more dynamic fashion in which PCNAproteins turn over, we combined a FRAP and a fluorescence-loss-in-photobleaching(FLIP) experiment, which was previously developed to study thedynamics of RAD52 group proteins and telomeres (6, 19). Halfof a nucleus containing replication structures was bleached,and the recovery of fluorescence was subsequently monitoredin the bleached part of the nucleus during a time period of1,000 s. At the same time, the fluorescence loss in the unbleachedpart of the nucleus was monitored until a new equilibrium influorescence distribution was reached between the bleached andthe unbleached regions. We performed this FLIP/FRAP analysisin the three recognizable S-phase stages: the early, mid-, andlate S phases. In all three stages, the exchange of PCNA proteinin the replication structures was observed (Fig. 3C). The changein fluorescence intensity over time, indicative of PCNA turnover,was quantitated. On average, the FLIP and FRAP curves convergedafter 570 ± 140 s, indicating that after this period,a new equilibrium between the bleached and the unbleached regionswas reached (Fig. 3D). Moreover, the curves converged completely,showing an absence of a detectable stably associated PCNA fractionpresent in the replication foci. Note that the high mobilityof the free GFP-hPCNA analyzed in Fig. 3A was not detected bythis FLIP/FRAP analysis because of the time interval of 10 s,while the recovery of the free GFP-hPCNA presented in Fig. 3Ahad already been completed within 2 seconds.

Mobility of GFP-hPCNA at sites of local UV damage. It is not known what factors signal PCNA to relocate to sitesof damage or whether it remains attached once associated. Therefore,we wanted to analyze the residence time of PCNA on UV damage.After induction of local UV damage and recruitment of GFP-hPCNA,we performed a combined FLIP/FRAP experiment (Fig. 4A). As theGFP-hPCNA is diffuse and highly mobile in untreated G₁ or G₂cells, we first analyzed the residence time on the site of localdamage in G₁/G₂ cells. When we plotted the recovery and lossof fluorescence for the local damage area in these cells, wefound that the curves converged after 1,200 ± 400 s,or approximately 20 min (Fig. 4B). Compared to the residencetime of PCNA in replication, this suggests that the PCNA proteinis engaged at least two times longer in areas undergoing repairthan in replication. Next, we determined residence times inreplication and repair simultaneously. We combined a FLIP/FRAPexperiment on locally damaged cells that were in early S phase(Fig. 4A). After photobleaching, a new equilibrium in fluorescencein the replication area was established, while the redistributionof GFP-hPCNA in the damaged area was still ongoing. This exampleshows at the single-cell level that the turnover of PCNA inthe damaged area is slower than in the area undergoing replicationonly.

View larger version (51K):
[in this window]
[in a new window]
FIG. 4. Fluorescence redistribution after photobleaching analyses of GFP-hPCNA in locally UV-irradiated cells. (A) Example of FLIP/FRAP analysis in locally irradiated cells. The upper panel represents a cell in the G₁ or G₂ phase of the cell cycle and shows local accumulation of GFP-hPCNA in the damaged area. The lower part of the cell, including half of the site of local damage, was photobleached, and the cell was imaged every 30 s. A similar experiment (lower panel) was done on a cell that was, based on the PCNA staining pattern, in the early S phase of the cell cycle. (B) Quantitation of the simultaneous FRAP and FLIP experiments on GFP-hPCNA after local UV damage on G₁/G₂-phase cells. "n" represents the number of cells examined.

Kinetics of TLS-deficient PCNA. It has recently been demonstrated that in yeast cells, PCNAbecomes ubiquitinated at lysine 164 following treatment withthe DNA-damaging agent methyl methanesulfonate and that a yeaststrain mutant in PCNA at K164 is UV sensitive (8). In addition,the monoubiquitination of PCNA appeared to be the major PCNAmodification after DNA damage in mammals (14, 29). MonoubiquitinatedPCNA specifically interacts with one of the TLS polymerases,pol ${eta}$ . To test the importance of this PCNA modification in vivo,we generated cell lines stably expressing mutant GFP-hPCNA^K164R.We confirmed that after UV treatment, GFP-hPCNA^K164R could nolonger be ubiquitinated (Fig. 5A) (24). Next, we analyzed cellsexpressing mutant PCNA by time-lapse microscopy (Fig. 5B) andfound distribution patterns for mutant PCNA similar to thosefound for the wild-type GFP-hPCNA construct in DNA replication.To analyze the behavior in DNA repair, we applied local UV damageand found that the protein still relocalized to the site oflocal damage and, as for wild-type GFP-hPCNA, this local damagetemporarily disappeared in early S phase. Solomon et al. previouslyreported that 4 h after treatment of cells with the chemotherapeuticagent cis-diammine-dichloroplatinum or UV light, wild-type GFP-hPCNAaccumulates in numerous subnuclear foci, but mutant GFP-hPCNA^K164Rdoes not accumulate in nuclear foci upon treatment with cis-diammine-dichloroplatinum(24). It is unlikely that the DNA-damage-induced foci reportedby Solomon et al. represented active NER, as the immediate repairof UV damage by NER is a pannuclear event and factors involvedin NER (in contrast to factors involved in DNA double-strandbreak repair) have not been reported to assemble into nuclearfoci after damage (3, 7, 15, 21, 22, 28). However, time-lapseexperiments on locally irradiated cells reveal a diffuse accumulationof GFP-hPCNA immediately after UV damage, which changes intoa focal pattern after longer periods (see Fig. 2C). This possiblyrepresents the involvement of PCNA in active NER immediatelyafter DNA damage and in other DNA repair processes (TLS, homologousrecombination) at later time points. In the CHO9 cell line thatwe used, most cells are in S phase, and GFP-hPCNA thereforealready shows a focal pattern in most of the untreated cells,which makes PCNA a less suitable marker for the detection ofdamage in the form of overall nuclear foci in our cells (27).However, regardless of the method of DNA damage detection, wefind, in contrast to Solomon et al., that mutant GFP-hPCNA^K164Rcan still efficiently relocalize to the damaged areas. As immunoprecipitationexperiments showed that both wild-type and mutant GFP-hPCNAinteract with the endogenous wild-type PCNA (data not shown)and as it has been demonstrated that PCNA is present in solutionand functions as a trimeric ring, both wild-type and mutantGFP-hPCNA probably relocalize to damaged areas as a part ofthe trimeric ring.

View larger version (30K):
[in this window]
[in a new window]
FIG. 5. Characterization of mutant GFP-hPCNA^K164R localization and kinetics in DNA replication and repair. (A) Substitution of the lysine residue at position 164 for arginine (K164R) results in defective monoubiquitination of GFP-hPCNA. Cells expressing GFP-hPCNA or GFP-hPCNA^K164R were treated with 10 J/m² (lanes 1 and 2) or 20 J/m² (lanes 3 and 4) UV, and cell lysates were prepared after 4 h (lanes 1 and 3) or 6 h (lanes 2 and 4). The protein blot shows total cell lysates of UV-treated and untreated cells probed with anti-PCNA antibodies (upper blot) and GFP antibodies (lower blot). Indicated are the positions of endogenous PCNA, GFP-hPCNA, and monoubiquitinated GFP-hPCNA (*). (B) Time-lapse imaging experiments on GFP-hPCNA^K164R-expressing cells. Upper panels: time-lapse imaging of untreated cells expressing GFP-hPCNA^K164R. An example of a cell imaged from the mid-S phase to the G₂ phase of the cell cycle is shown. Lower panels: time-lapse imaging of locally irradiated cell (indicated with the circle) showing transient accumulation of GFP-hPCNA^K164R at sites of UV damage. (C to E) Fluorescence redistribution after photobleaching analyses of mutant GFP-hPCNA^K164R-expressing cells. (C) Quantitative FLIP/FRAP analysis of mutant GFP-hPCNA^K164R replication foci in the early, mid-, and late S phases of the cell cycle. (D) Examples of FLIP/FRAP analysis in locally irradiated mutant cells. The upper panel represents a GFP-hPCNA^K164R-expressing cell, which, based upon the diffuse PCNA pattern, is in the G₁ or G₂ phase of the cell cycle and shows local accumulation of GFP-hPCNA^K164R in the damaged area. The lower part of this cell, including half of the site of local damage, was photobleached, and the cell was imaged every 30 s. A similar experiment (lower panel) was done on a cell that was, based on the peripheral PCNA staining pattern, in the mid-S phase of the cell cycle. (E) Quantitation of the simultaneous FRAP and FLIP experiment on GFP-hPCNA^K164R after local UV damage in G₁/G₂ cells as shown in Fig. 5D, upper panel. "n" represents the number of cells examined.

Next, we analyzed the kinetics of mutant PCNA in DNA replicationand repair. The turnover rate of GFP-hPCNA^K164R in DNA replicationfoci was not significantly affected by the K164R mutation, sincethe FLIP/FRAP curves converged after 485 ± 218 s (Fig.5C). In contrast, the residence time for mutant PCNA in DNA-damagedareas was much shorter than that for the wild type (Fig. 5D).The FLIP/FRAP analysis in Fig. 5E shows that the residence timefor GFP-hPCNA^K164R in DNA-damaged areas decreased to 300 ±90 s, or 5 min, compared to 20 min for the wild-type GFP-hPCNAprotein (Fig. 4B). Thus, although the mutant PCNA protein canstill localize to the UV-damaged sites, the residence time issignificantly affected. Possibly, the mutated PCNA, which isunable to load TLS polymerases, loses its affinity for stalledreplication forks, and this leads to the reduced residence time.However, the mutated protein also shows reduced residence timein G₁/G₂ cells. As there is presumably no TLS polymerase presentin these stages, the mutation is also important for PCNA dynamicsat sites of local damage, independent of the TLS polymerase.

In conclusion, we found that PCNA transiently accumulates atsites of DNA damage and that PCNA has different residence timesin DNA replication and repair. In addition, we found that theresidence times of wild-type PCNA and of PCNA bearing the K164Rmutation are similar in terms of replication but not in termsof local damage repair. This shows that one function of themonoubiquitination of PCNA is to modulate the residence timeof PCNA at sites of DNA damage.

ACKNOWLEDGMENTS

This work was supported by NWO grants 805-47-193, 912-03-012,and 917-03-012 and investment grants NWO 903-68-370 and 901-01-229from the Netherlands Organization for Scientific Research andby EC grants HPRN-CT-2002-00240 and MRTN-CT-2003-503618.

FOOTNOTES

* Corresponding author. Mailing address: Dept. of Cell Biology and Genetics, Erasmus MC, Dr. Molenwaterplein 50, PO Box 1738, Rotterdam 2015GE, The Netherlands. Phone: 31104087158. Fax: 31104089468. E-mail: j.essers{at}erasmusmc.nl.

REFERENCES

Top