Previous Article | Next Article ![]()
Molecular and Cellular Biology, November 2005, p. 10079-10086, Vol. 25, No. 22
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.22.10079-10086.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Division of Oncology Research, Mayo Clinic and Foundation, Rochester, Minnesota 55905,1 Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892,2 Department of Medical Oncology, Mayo Clinic and Foundation, Rochester, Minnesota 55905,3 Department of Comparative Medicine, Mayo Clinic and Foundation, Rochester, Minnesota 55905,4 Genetics Branch, Center for Cancer Research, NCI, NIH, 50 South Dr., Bethesda, Maryland 208925
Received 3 May 2005/ Returned for modification 6 June 2005/ Accepted 17 August 2005
|
|
|---|
|
|
|---|
Defects in DNA damage checkpoint control were also observed in cells derived from 53BP1 knockout mice (13); however, the more striking observations obtained with these mice were of sensitivity towards ionizing radiation and greatly impaired class switch recombination (CSR) combined with immunodeficiency and an increased lymphoma predisposition (23, 24, 33, 34). Since CSR involves the generation and rejoining of DNA DSBs, a function of 53BP1 in DSB repair has been proposed (23, 34). It is well established that defects in the joining of DSBs can lead to chromosome translocations and gene amplifications that promote tumorigenesis, particularly in the context in which p53-dependent apoptosis is abrogated (11, 37). In this study, we address how 53BP1 contributes to genomic stability by analyzing tumorigenesis in p53-null mice that express various amounts of 53BP1.
|
|
|---|
Characterization of tumors. Tissues from solid tumors were analyzed by standard histological analysis. Lymphomas were characterized by flow cytometry using anti-CD3, -CD4, -CD8, -CD19, -B220, -Thy1.2, and -immunoglobulin M (IgM) antibodies (Pharmingen).
SKY and FISH.
Spectral karyotype analysis (SKY) was performed as described previously (22). For fluorescence in situ hybridization (FISH) analyses, metaphases were hybridized with bacterial artificial chromosome probes specific for IgHc
, c-myc, TCRc
, and TCRv
together with chromosome-specific probes (11).
Centrosome staining.
Immortalized p53/ mouse embryonic fibroblasts (MEFs) as well as primary 53BP1+/+ and 53BP1/ MEFs were grown on coverslips, fixed with ice-cold methanol, and stained with antibodies against
-tubulin and
-tubulin (Sigma). Similarly, cells derived from a 53BP1/ p53+/+ thymoma and a 53BP1+/+ p53/ thymoma were fixed, cytospun on slides, and stained with the anti-
-tubulin and anti-
-tubulin antibodies. Mitotic cells were identified by DAPI (4',6'-diamidino-2-phenylindole) staining on a Nikon Eclipse E800 microscope (100x objective) equipped with a SPOT RT digital camera (Diagnostic Instruments, Inc.).
DNA repair and genomic instability assays. For the DNA repair assay, primary MEFs or stable MEF cell lines were plated onto coverslips. Once the cells had reached confluence and stopped dividing, they were irradiated with 2 Gy and allowed to recover for 27 h prior to immunostaining with anti-phospho H2AX antibodies (26). For the genomic instability assay, splenocytes were stimulated for 48 h with 100 U/ml interleukin 2 (Research Diagnostics, Inc.) and 4 µg/ml concanavalin A (Pharmacia) prior to exposure to 0 or 1 Gy of IR. After a recovery period of 30 min, Colcemid was added and metaphase spreads were prepared 3 h later according to a standard protocol.
Western blot analysis. Thymocytes were isolated from 53BP1+/+ and 53BP1/ littermates and cultured overnight in Dulbecco modified Eagle medium containing 100 U/ml interleukin 2 (Research Diagnostics, Inc.) and 4 µg/ml concanavalin A (Pharmacia). Aliquots of the cell suspensions were irradiated with either 0, 0.5, 2, or 5 Gy and lysed 2 h later in TNG buffer (50 mM Tris-HCl, pH 7.5, 200 mM NaCl, 50 mM ß-glycerophosphate, 1% Tween 20, 0.2% Nonidet NP-40) containing protease inhibitors. Equal amounts of protein were separated on a 7.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, transferred to a polyvinylidene difluoride membrane, and blotted with antibodies against p53 (FL-393-G; Santa Cruz), phosphorylated ATM (Ser1981) (10H11.E12; Cell Signaling), Chk2 (33), and ß-actin (Sigma).
Real-time PCR analysis. Total RNA was isolated from untreated or irradiated (10-Gy) splenocytes using Trizol (Invitrogen). Following treatment with RNase-free DNase (Invitrogen), RNA was reverse transcribed using Superscript II reverse transcriptase (Invitrogen). Real-time PCR was performed on a ABI PRISM 7700 sequence detection system (Applied Biosystems) with SYBR green PCR master mix (Applied Biosystems) and the following primer sets: 5' p21, CCTGGTGATGTCCGACCTGTT; 3' p21, GAGCGGCCTGAAGATTCCCC; 5' mdm2 CAGCTTCGGAACAAGAGACTC; and 3' mdm2, CTGCTCTCA CTCAGCGATGT. PCR conditions consisted of a 2-min 50°C cycle followed by 10 min at 95°C and 40 cycles of 95°C for 15 s and 55°C for 1 min. The average threshold cycle for each gene was determined from triplicate reactions, and the levels of gene expression were determined relative to that of ß-actin (5' ß-actin, TGGGCCGCTCTAGGCACCA; 3' ß-actin, CCCCTGAACCCTAAGGCCA).
|
|
|---|
![]() View larger version (18K): [in a new window] |
FIG. 1. Survival of 53BP1-deficient mice in a p53 wild-type or p53-null background. (A) Survival of a cohort of 53BP1+/+ 53BP1+/ and 53BP1/ mice observed for 25 months. (B) 53BP1 and p53 synergize in tumor suppression. Survival analysis of 53BP1+/+ p53/, 53BP1+/ p53/, 53BP1/ p53/, and 53BP1/ p53+/+ mice. Percent survival is plotted as a function of time as indicated. N represents the number of mice analyzed.
|
|
View this table: [in a new window] |
TABLE 1. Spectrum of spontaneous tumors in 53BP1+/+, 53BP1+/, and 53BP1/ mice between 12 months and 25 months of life
|
Loss of both alleles of 53BP1 greatly accelerated the tumor development of p53/ mice (53BP1/ p53/ mice versus 53BP1+/+ p53/ mice; P < 0.0001) (Fig. 1B). While 53BP1+/+ p53/ mice (n = 12) had an average life span of 26 weeks before they became moribund with lymphoma or other types of tumors, the median survival time of 53BP1/ p53/ mice (n = 50) was only 12 weeks. Double-knockout mice succumbed to lymphomas as early as 7 weeks, and within 18 weeks all animals had died. Of the 50 53BP1/ p53/ mice analyzed, 46 developed thymic lymphomas, while 3 mice succumbed to B-lineage lymphomas, and 1 had both a thymic lymphoma and a pro-B cell lymphoma. Flow cytometric analysis revealed that the thymic lymphomas were of immature T-cell origin, with the majority of tumors being CD3 negative and either CD4/CD8 double positive or CD8 single positive. Three of the B-lineage lymphomas were B220+ CD19+/IgM, while one was B220+ CD19+/IgM+.
Loss of only one allele of 53BP1 also significantly accelerated the tumor onset in p53-null mice, albeit to a lesser degree than complete 53BP1 deficiency (53BP1+/ p53/ versus 53BP1+/+ p53/ mice; P < 0.0001) (Fig. 1B). 53BP1+/ p53/ mice (n = 37) became moribund with tumors as early as 11 weeks, with a median survival time of 17.8 weeks and a maximum survival time of 33 weeks. The tumor spectrum in these mice was broader than in the double-knockout mice, with only 26 of the animals developing lymphomas and 11 animals developing solid tumors, including five sarcomas. Two of the 22 lymphomas analyzed were B220/CD19+/IgM+ B-lineage lymphomas, while the 20 others were thymic lymphomas that expressed various amounts of CD3, CD4, and/or CD8. The increase in tumor predisposition observed in 53BP1/ p53/ and 53BP1+/ p53/ mice indicates that loss of 53BP1 synergizes with p53 inactivation in tumorigenesis.
Normal p53 activation in 53BP1/ p53+/+ thymocytes. The observed synergism of 53BP1 and p53 suggests that they have different functions in tumor suppression. To test this hypothesis, we assessed p53 accumulation in 53BP1-deficient thymocytes 2 h after exposure of cells to 0.5 Gy, 2 Gy, or 5 Gy of IR. Compared to wild-type controls, 53BP1/ thymocytes showed normal p53 stabilization in response to low-dose as well as high-dose irradiation (Fig. 2A). Moreover, levels of phosphorylation of ATM at Ser 1981 were very similar in wild-type and mutant cells, although we did see slightly impaired Chk2 phosphorylation upon low-dose IR in the 53BP1/ thymocytes, as reported previously (33) (Fig. 2A). Consistent with these findings, p53 accumulation was readily observed in two thymoma samples derived from 53BP1-null mice (Fig. 2B). Since 53BP1 has been proposed to act as a transcriptional coactivator of p53, we also quantified the expression of the p53-dependent target genes mdm2 and p21 using real-time PCR. As shown in Fig. 2C, induction of mdm2 and p21 mRNA in response to IR was normal or somewhat increased in 53BP1-deficient thymocytes, suggesting that 53BP1 is not essential for p53 transactivation activity in murine thymocytes.
![]() View larger version (30K): [in a new window] |
FIG. 2. p53 stabilization and p53-dependent transcription in primary 53BP1+/+ and 53BP1/ cells. (A) Levels of p53, phosphorylated ATM, and Chk2 in normal 53BP1+/+ and 53BP1/ thymocytes before and 2 h after irradiation with 0.5, 2, and 5 Gy. (B) p53 levels in 53BP1/ tumor cells derived from two thymic lymphomas. The time points after treatment with 10 Gy are indicated at the top. (C) Quantitative RT-PCR analysis of p21 and mdm2 mRNA levels in 53BP1+/+ and 53BP1/ splenocytes before and after irradiation with 10 Gy. The mRNA levels in the untreated 53BP1+/+ cells are set to 1 after standardization of all values relative to the mRNA levels of actin.
|
locus (Fig. 3A). In addition, one of one IgM+ B-lineage lymphoma analyzed contained a T(12;15) translocation that juxtaposed the distal part of the c-myc oncogene on chromosome 15 to the IgHc alpha locus on chromosome 12 (Fig. 3B). Therefore, it is likely that some of the thymic lymphomas as well as B-lineage lymphomas in 53BP1/ p53/ mice arise during antigen receptor rearrangements.
![]() View larger version (22K): [in a new window] |
FIG. 3. Chromosomal translocations involving antigen receptor loci in 53BP1/ p53/ lymphomas. (A) SKY (top panel) and FISH (bottom panel) of a thymic lymphoma harboring two T(14;4) translocations and a T(12;14) translocation in which the breakpoint was near the T-cell receptor alpha locus (TCRc ; red, indicated by an arrow). Chromosome 14 and 4 painting probes were used for FISH analysis together with a TCRc bacterial artificial chromosome probe. The TCRv locus is deleted in this tumor (not shown). (B) SKY (top panel) and FISH (bottom panel) analyses of a B-cell lymphoma harboring a T(12;15) translocation that juxtaposes IgHc (red) and c-myc (green) (indicated by arrows).
|
|
View this table: [in a new window] |
TABLE 2. Karyotype of 53BP1/ p53+/+ and 53BP1/ p53/ lymphomas observed by Sky and FISH
|
![]() View larger version (19K): [in a new window] |
FIG. 4. Normal centrosome duplication in 53BP1-deficient cells. 53BP1+/+, 53BP1/, and p53/ MEFs were immunostained for -tubulin, a component of centrosomes (red), and -tubulin, a component of microtubules (green, here shown merged with red). Mitotic p53-deficient MEFs, but not 53BP1-deficient MEFs, frequently show centrosome hyperamplification and abnormal mitotic spindle.
|
-H2AX) focus analysis. Nonreplicating G0/G1 53BP1 wild-type cells showed an average of 4.4 residual
-H2AX foci 27 h after 2 Gy of IR, with the majority of cells having 0 to 3 foci (Fig. 5A). In contrast, 53BP1/ MEFs exhibited a significantly higher number of unrepaired DSBs (on average, 9.5 foci per cell), while irradiated 53BP1+/ MEFs showed an intermediate phenotype, with an average of 6.5 residual
-H2AX foci per cell (53BP1+/+ versus 53BP1+/ cells, P < 0.001; 53BP1+/ versus 53BP1/ cells, P < 0.001) (Fig. 5A). No repair defect was detected in 53BP1+/+ p53/ MEFs (Fig. 5B).
![]() View larger version (27K): [in a new window] |
FIG. 5. Genomic instability in 53BP1/ in 53BP1+/ cells. (A) Numbers of -H2AX foci/cell in primary 53BP1+/+, 53BP1+/, and 53BP1/ MEFs 27 h following 2 Gy. (B) Immunofluorescence analysis of residual -H2AX foci in 53BP1+/+, 53BP1/, and p53/ MEF lines 27 h after 2 Gy. (C) Average number of chromosome breaks per cell in 53BP1+/+, 53BP1+/, and 53BP1/ splenocytes before and after irradiation with 1 Gy. The error bars represent the standard deviations from at least 30 metaphase spreads. (D) Percentages of splenocytes (n = 30) with gains or losses of chromosomes before and after irradiation with 1 Gy.
|
0.2). Upon treatment with 1 Gy of IR, the average number of chromosome breaks in 53BP1+/ splenocytes (3.2 ± 1.2) was intermediate between that found in 53BP1+/+ cells (2.4 ± 0.69; 53BP1+/ versus 53BP1+/+ cells, P < 0.005) and 53BP1/ cells (5.9 ± 1.66; 53BP1+/ versus 53BP1/ cells, P < 0.001) (Fig. 5C). Moreover, irradiated 53BP1+/ splenocytes showed a high degree of aneuploidy (43%) that was more similar to that of irradiated 53BP1/ cells (49%) than of 53BP1+/+ cells (19%) (Fig. 5D). A slight increase in aneuploidy was also found in nonirradiated 53BP1+/ splenocytes, with 14.3% of the cells showing losses or gains of chromosomes compared to 10.3% in 53BP1+/+ cells and 34.5% in 53BP1/ cells (Fig. 5D). Together these findings demonstrate that a reduction in 53BP1 protein levels is sufficient to compromise the maintenance of chromosomal structure and number. |
|
|---|
We have shown that 53BP1 is not essential for p53 stabilization and the induction of mdm2 and p21 expression in irradiated mouse cells. In fact, the absence of 53BP1 rather resulted in an increase in the p53 transactivation activity, suggesting that 53BP1 may negatively modify p53 function. Such a model is contrary to initial studies, which implied that 53BP1 may stimulate p53-mediated transcriptional activation, based on the ability of overexpressed 53BP1 to increase the expression of a p53-dependent chloramphenicol acetyltransferase reporter gene and of endogenous p21 (16). However, later structural analyses suggest that p53 may not be able to bind simultaneously to 53BP1 and p53 DNA binding sites (10, 17). Thus, it appears unlikely that 53BP1 could directly facilitate p53-mediated transcription. The increase in gene expression observed in the early study might be a consequence of artificial 53BP1 overexpression.
An involvement of 53BP1 in DNA DSB repair has been proposed previously based on the increased radiation sensitivity and impaired CSR observed in 53BP1-deficient mice (24, 33, 34). Moreover, an approximately 50% decrease in the production of mature T cells in the absence of 53BP1 suggested a defect in the rearrangements of the TCR locus required for normal T-cell development (33). Normally, cells which fail to successfully rejoin the rearranged gene segments undergo cell cycle arrest or apoptosis. However, in some cells, misrepair of DNA DSBs can lead to oncogenic translocations and subsequent tumor formation (11, 37). The low but significant lymphoma incidence in 53BP1-deficient mice together with the dramatic acceleration of lymphomagenesis observed in 53BP1/ p53/ mice suggests a role of 53BP1 in suppressing oncogenic translocations. Indeed, the one 53BP1/ p53/ B-lineage lymphoma analyzed contained a clonal T(12;15) translocation, which juxtaposed the c-myc oncogene to the IgH antigen receptor locus and may have evolved by aberrant RAG-induced V(D)J recombination. Moreover, two out of five 53BP1/ p53/ thymic lymphomas harbored clonal translocations, one of which involved the TCR locus, suggesting that faulty TCR
/
V(D)J recombination initiated the oncogenic transformation. Interestingly, thymomas that developed in ATM-deficient mice also harbor translocations in the TCR locus (20), supporting our previous conclusion that 53BP1 and ATM may be components of the same tumor suppression pathway (33).
Some of the 53BP1/ p53/ lymphomas as well as the 53BP1/ p53+/+ thymoma analyzed showed neither translocations nor deletions but exhibited abnormal numbers of chromosomes. Aneuploidy is a well-known hallmark or causal factor of cancers and may arise from centrosome malfunction or defects in mitotic segregation (6, 30). Unlike p53-deficient tumor cells, aneuploid 53BP1-deficient tumor cells showed only a moderate amount of centrosome hyperamplification, suggesting a difference in the mechanisms by which p53 and 53BP1 suppress aneuploidy. There are several possibilities regarding how the loss of 53BP1 may lead to numerical chromosomal alterations. For instance, 53BP1 has been shown to localize to the kinetochore in mitotic cells and 53BP1 accumulation appears to be the highest at the kinetochore of unaligned chromosomes (18), suggesting that 53BP1 may participate directly in sensing chromosome alignment during mitosis. Moreover, 53BP1 interacts with SNM1, a protein that is involved in an early mitotic checkpoint induced by spindle stress (1). However, we did not observe a defect in the ability of 53BP1-deficient MEFs to transiently arrest in mitosis in the presence of nocodazole, a microtubule-disrupting agent (data not shown). This suggests that mitotic spindle checkpoints are grossly intact in 53BP1-deficient cells, although we cannot rule out subtle defects. Another explanation for chromosome missegregation in 53BP1-deficient tumors could be reduced cohesion fidelity in the absence of 53BP1. 53BP1 is involved in the S-phase checkpoint. Recent data from Saccharomyces cerevisiae suggest that S-phase checkpoint proteins contribute to the establishment of chromatin configurations permissive for sister chromatid cohesion (35).
Interestingly, the loss of one allele of 53BP1 also significantly accelerated tumorigenesis in a p53-deficient background. The tumors appeared later than in 53BP1/ mice and exhibited a broader spectrum, including lymphoma, sarcoma, and carcinoma. Moreover, 53BP1+/ p53+/+ mice also had a higher cancer predisposition than wild-type animals, further indicating that 53BP1 haploinsufficiency compromises genomic stability. The high percentage of solid tumors in these animals points to aneuploidy as a causal factor, while the observed hematological malignancies likely evolved from the misrepaired juxtaposition of genes at the sites of translocations. In support of this hypothesis, we observed a decreased ability to repair IR-induced DNA DSBs in 53BP1+/ cells as well as a marked increase in aneuploidy in 53BP1+/ splenocytes upon irradiation.
The high rate of chromosomal missegregation in some of the 53BP1/ p53/ and 53BP1/ p53+/+ tumors distinguishes the tumor suppressor function of 53BP1 from that observed for H2AX. H2AX is a histone variant that becomes phosphorylated at megabase regions surrounding the sites of DNA strand breaks (27). 53BP1 interacts with phosphorylated H2AX in response to DNA damage, and H2AX is required for 53BP1 accumulation at the damage sites (8, 32). The loss of both alleles or only one H2AX allele has been shown to enhance tumor susceptibility in a dosage-dependent manner by promoting structural chromosomal anomalies, including translocations, deletions, and duplications (4, 7). Thus, while 53BP1 and H2AX act together in facilitating the repair of DNA DSBs, 53BP1 appears to have an additional role in suppressing numerical chromosomal aberrations. The fact that 53BP1/ or 53BP1+/ mice show a higher tumor risk than H2AX/ or H2AX+/ mice further supports the hypothesis of a dual role of 53BP1 in tumor suppression.
Given the impact of 53BP1 on tumorigenesis in our mouse model, it is not surprising that a 53BP1 or 53BP1-associated DNA damage response has also been implicated in human disease. Two recent studies describe the activation of the DNA damage response network in human precancerous lesions as an important barrier to tumorigenesis (3, 14). More directly, in a small number of lung tumors and melanomas tested, the progression to carcinoma or malignant melanoma was associated with a reduction in 53BP1 level (14). Thus, 53BP1 deficiency or haploinsufficiency may play a causal role in human cancer development.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»