Previous Article | Next Article ![]()
Molecular and Cellular Biology, November 2005, p. 9829-9844, Vol. 25, No. 22
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.22.9829-9844.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Unité de Recherche en Développement et Différenciation Cardiaques, Institut de Recherches Cliniques de Montréal, 110, Avenue des Pins Ouest, Montréal, QC H2W 1R7, Canada, and Département de Pharmacologie, Université de Montréal, Montréal, Quebec, Canada
Received 21 March 2005/ Returned for modification 19 April 2005/ Accepted 10 August 2005
|
|
|---|
|
|
|---|
G-protein-coupled receptors (GPCR) constitute the largest family of transmembrane receptors in mammals (77). The angiotensin II (AII) type 1 receptor (AT1R), which transduces the biologic effects of AII, is one of the most extensively studied GPCR (18), and drugs that target AT1R are widely used for the treatment of cardiovascular diseases, such as hypertension and cardiac hypertrophy (17). AT1Rs activate a plethora of signaling cascades, including those of mitogen-activated protein kinase (MAPK), phosphatidylinositol 3-kinase (PI3K), protein kinase C (PKC), Janus kinase (JAK)-STAT, and calcineurin, resulting in apoptosis, proliferation, hypertrophy, or differentiation depending on the cell type and developmental stage (35). At the level of the nucleus, AT1R activation has been shown to alter expression of some ubiquitous as well as tissue-specific transcription factors. They include the immediate-early genes c-fos, c-jun, and egr1 (reviewed in reference 8), and in smooth muscle and adrenal cells, tissue-restricted transcription factors like the homeobox factors MHOX and DAX-1 (27, 52) and the zinc finger proteins KLF5 and SF-1 (52, 65). AII also enhances nuclear accumulation of STAT family members (reviewed in reference 9), NF-
B (59), and nuclear factor of activated T cells 3 (72). However, the exact role of these factors in mediating AII actions remains largely controversial.
At the level of the heart, AT1R activation causes myocyte hypertrophy and apoptosis (55) and is associated with upregulation of c-jun, c-fos, and the cardiac-specific atrial natriuretic factor (ANF) gene, which is induced during hypertrophy (55, 74) AII also activates several STAT family members which have themselves been implicated in cardioprotection, apoptosis, and hypertrophy through mechanisms and effectors that remain to be elucidated (reviewed in reference 9). Similarly, the various signaling pathways activated by AII have all been implicated in cardiac hypertrophy, apoptosis, or both (1, 24, 46). Their importance in mediating specific AII effects as well as their involvement in AII regulation of cardiac genes has not been firmly elucidated.
STAT (signal transducers and activators of transcription) proteins are evolutionary conserved transcription factors that reside in the cytoplasm until they are activated by tyrosine phosphorylation, which leads to their dimerization and nuclear accumulations. Initially identified as the targets of interferon, the STAT family in mammals now comprises seven members that are activated by cytokine and growth factor signaling through receptor coupling to the JAK family of proteins (reviewed in reference 40). STATs can also be activated by receptor tyrosine kinases, like epidermal growth factor receptor, and by some members of the GPCR family, such as the AT1 receptor (9). STAT proteins play important roles in developmental decisions as well as in stress response and host defense (40). Although most STAT proteins are widely expressed, gene targeting in mice revealed nonredundant functions for the different family members. For example, lack of STAT1 or STAT2 leads to an impaired response to interferon and hypersensitivity to infections, while lack of STAT4 and STAT6 is associated with impaired T-cell differentiation. Interestingly, while loss of STAT3 causes early embryonic lethality, tissue-specific inactivation of the STAT3 gene revealed distinct and at times opposing effects in cell survival, proliferation, and acute-phase response, depending on the targeted tissue or organ. Similarly, inactivation of each of the two highly homologous STAT5 genes revealed hematopoietic defects, growth retardation (for STAT5a), and mammary gland development (in STAT5b null).
At the level of the heart, targeted overexpression of constitutively active STAT3 has been shown to enhance vascular endothelial growth factor (VEGF) expression and causes hypervascularization (53), which would enhance cardiac adaptation to stress. Others found that overexpression of STAT3 leads to cardiac hypertrophy but also protects against drug-induced cardiotoxicity (37). More recently, mice with cardiac-specific inactivation of STAT6 were generated and found to have an impaired response to pressure overload (29). In human, STAT3 is constitutively active in several tumors (10) and mutation of STAT1 lead to impaired bacterial immunity (20). The mechanisms by which STAT proteins can transduce such a wide spectrum of cellular responses and biologic effects remain to be determined.
The activities of STAT proteins can be modulated by protein-protein interaction, and a growing number of STAT-interacting proteins is being reported (66). In addition to STAT-interacting kinases and phosphatases, several transcription factors and coactivators/corepressors were shown to associate with and modulate STAT activity. They include CBP/p300 (31) and histone deacetylases (82), as well as inducible regulators such as c-Jun (85) and members of the nuclear receptor family (22, 67, 71). Finally, a role for tissue-specific transcription factors in STAT transcriptional regulation is emerging. In T cells, STAT proteins have been shown to physically and functionally interact with members of the Ets family of transcription factors over composite STAT-Ets DNA elements required for cytokine regulation of target genes (60, 76). In hepatocytes, STAT3 was shown to cooperate with HFN1 in mediating the transcriptional response to interleukin 6 during liver regeneration (38).
GATA proteins are tissue-specific transcription factors that play crucial roles in organogenesis. In mammals, the six members are divided into two subfamilies based on sequence homology and tissue distribution. GATA-1, -2, and -3 play essential roles in hematopoietic cell survival, proliferation, and differentiation, whereas GATA-4, -5, and -6 are key regulators of endodermal and cardiovascular development (56).
In the present study, we show that STAT and GATA proteins cooperatively mediate AII responsiveness of the ANF (NPPA) promoter through direct physical interaction. Moreover, we found that GATA-4 is essential for transcriptional activation by AII, which enhances GATA-4 binding to DNA through PKC-mediated phosphorylation. In turn, GATA-4 is able to recruit activated STAT to target promoters, suggesting that STAT proteins can act as inducible coactivators of the tissue-specific GATA transcription factors. This unravels a novel GATA-dependent mechanism for STAT action which could account for cell specificity of cytokine and growth factor action. Interaction with GATA-4 and activation of ANF may also explain some of the cardioprotective effects of STAT proteins.
|
|
|---|
Plasmids and adenovirus vectors.
The luciferase reporter constructs used and most GATA expression vectors were described previously (3, 49). The SV-sport1-HA-GATA-4 plasmids were prepared based on the original rat GATA-4 cDNA (25). Heterologous promoters were generated by multimerizing the relevant oligonucleotides flanked by BamHI and BglII sites upstream of the minimal (57 bp) ANF or BNP (B-type natriuretic peptide) luciferase reporter as described previously (48). Expression vectors for rat AT1aR and its mutants were gifts from Sadashiva S. Karnik (45). Erk1/2 expression vectors were described previously (43). The VEGF-luciferase reporter was a kind gift of Darren Richard. It contains the upstream sequence from the human VEGF gene (44). STAT cDNA vectors expressing wild-type proteins from Svsport1 were provided by Juergen A. Ripperger. HA-tagged wild-type and mutant STAT1
vectors were generated using PCR-mediated amplification and cloning in the cytomegalovirus-driven pCGN plasmid. All constructs were confirmed by sequencing. Ad-LacZ has been described previously (3), and the AII type 1a receptor adenovirus vector (Ad-AT1aR) was a gift of Walter G. Thomas (74). The virus was amplified and quantified as described previously (14).
Cell cultures, adenovirus infection, and transient transfections. Myoblast C2C12 cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 20% fetal bovine serum. Cotransfections were carried out using calcium phosphate 24 h after plating. At 16 h posttransfection, the medium was changed to serum free and supplemented with 0.1 µM AII for overnight stimulation. Cells were harvested, and luciferase activity assays were performed with a Berthold LB953 luminometer. The amount of reporter construct was kept at 1 µg per 20-mm dish and the total amount of DNA at 3 µg. One microgram of rat AT1aR expression vector was used unless otherwise stated. Primary cardiomyocyte cultures were prepared from 4-day-old Sprague-Dawley rats and cotransfected as described previously with minor modifications (14). In brief, cardiomyocytes were cotransfected and treated with 100 nM AII or left untreated in serum-free medium for 24 h. For adenovirus infections, cardiomyocytes were infected with 2 PFU of Ad-AT1aR or the control Ad-LacZ per cardiomyocyte as described previously (14) and treated with 100 nM AII or left untreated in serum-free medium for 20 min or 48 h. When required, pharmacologic inhibitors were added to the cells 30 min prior to AII stimulation. Unless otherwise indicated, the data shown for transfections are the means for at least three independent experiments carried out in duplicate and with different DNA preparations.
Chromatin immunoprecipitation assays and QPCR analysis. Chromatin immunoprecipitation (ChIP) assays were carried out using a modification of a previously described protocol (23). Essentially, 16 million cardiomyocytes per ChIP were plated at 25,500 cells/cm2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 10 µg/ml cytosine ß-D-arabino-furanoside hydrochloride (Sigma). On day 2, the medium was changed for a serum-free medium supplemented with 50 mM KCl. Cardiomyocytes were infected with 2 PFU of Ad-AT1aR per cardiomyocyte. The serum-free medium was changed on day 3, and the cells were treated with 100 nM AII for 2 days. Cardiomyocytes were washed with ice-cold phosphate-buffered saline (PBS) and cross-linked with 1% formaldehyde at 4°C for 15 min. Cross-linking was stopped by incubating the cells in a solution of 125 mM glycine for 5 min at 4°C. Cells were harvested in PBS, centrifuged, and then resuspended and lysed in a hypotonic buffer for 5 min in ice. The lysate was centrifuged, and the pellet containing the nuclei was resuspended in a buffer containing 300 mM NaCl and incubated for 30 min at 4°C to extract free nuclear proteins. The pellet containing the cross-linked chromatin was resuspended and sonicated to achieve fragments of about 600 bp. Fragmented chromatin was precleared with protein A/G PLUS-agarose (Santa Cruz Biotechnology) with a 1- to 2-h incubation with agitation at 4°C. A small aliquot was saved as the input, and the remaining was subdivided in equal fractions for ChIP. Immunoprecipitated chromatin was washed several times for 5 min at room temperature. DNA was purified with the QIAquick PCR purification kit (QIAGEN). Samples and input were analyzed by real-time quantitative PCR (QPCR). DNA template and 1 µM oligonucleotides were used at an annealing temperature of 58°C using the Quantitect SYBR green PCR kit (QIAGEN) in an MX4000 real-time PCR machine (Stratagene, La Jolla, CA). The primers used were 5'-AAAGCGGTTTCATCCTCCAGGC-3' and 5'-ACAGGCTCTAAAGAATTCAGCTACACG-3' for the distal ANF region and 5'-GCCTTTGTCCGTCACTGTCT-3' and 5'-GAGCGCCCAGGAAGATAACC-3' for the proximal ANF promoter. A comparative quantification was used, and the input was set as the calibrator. The results are expressed as the severalfold enrichment of GATA or STAT ChIP over the values obtained with the control immunoglobulin G.
Northern blot and QPCR. Total RNA was prepared using TRIZOL reagent (Invitrogen Canada, Inc., Burlington, ON, Canada). Northern blots were performed as previously described (55). QPCR was performed on cDNAs obtained by reverse transcription of 2 µg of total RNA using Omniscript reverse transcriptase (QIAGEN, Inc., Mississauga, Canada). Two nanograms of cDNA template and 1 µM oligonucleotides were used. The oligonucleotides for mouse ANF are TGCCGGTAGAAGATGAGGTC (forward) and AGCAGCTGGATCTTCGTAGG (reverse). The oligonucleotides for mouse ribosomal protein S16 are ATCTCAAAGGCCCTGGTAGC (forward) and ACAAAGGTAAACCCCGATCC (reverse).
Electrophoretic mobility shift assays. Preparation of nuclear extracts from cell culture was as described previously (13, 49). Nuclear proteins were extracted from hearts of human AII type I receptor transgenic and nontransgenic mice essentially as described previously (19). Briefly, the hearts were excised from mice, washed with PBS to remove blood, and then broken into pieces in liquid nitrogen. Afterwards, the heart pieces were homogenized in solution A (0.6% NP-40, 150 mM NaCl, 10 mM HEPES [pH 7.9], 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride) at 4°C, followed by centrifugation for 30 s at 2,000 rpm. The supernatant was then saved and centrifuged for 5 min at 5,000 rpm. The pellets obtained were suspended in solution B (25% glycerol, 20 mM HEPES [pH 7.9], 420 mM NaCl, 1.2 mM MgCl2, 0.2 mM EDTA, 05 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, 5 µg/ml aprotinin) at 4°C for 20 min and centrifuged for 15 s at full speed in a microcentrifuge. Extracts were then divided into aliquots and stored at 80°C for future use. Protein concentrations were determined using Bio-Rad assays. Binding assays were performed at room temperature for 30 min in the presence of 500 ng of poly(dI-dC) in 120 mM KCl, 25 mM MgCl2, 20 mM Tris-Cl [pH 7.9], 2 mM DTT, 2 mM EDTA, 8% Ficoll (for GATA-4 and serum response factor (SRF) binding assays), or 5 mM HEPES (pH 7.9), 100 mM NaCl, 0.25 mM EDTA, 0.5 mM DTT, and 5% glycerol (for STAT binding assay).
Western blots and coimmunoprecipitations. Western blots were performed using whole-cell or nuclear extracts according to standard protocols. Polyclonal antibodies were used at a 1:1,000 dilution and incubated with the membrane for 1 h at room temperature and then with peroxidase-conjugated antibody for another hour at room temperature. The bands were revealed using the ECL Plus standard protocol (Amersham Pharmacia Biotechnology). Coimmunoprecipitation of STAT1 and HA-GATA-4 or Flag-GATA-4 and HA-STAT1 was carried out using nuclear extracts of 293T cells overexpressing the relevant proteins, as described previously (49).
Kinase assays.
The recombinant proteins glutathione S-transferase (GST)-GATA-4 1-207, GST-GATA-4 329-440, and GST-GATA-4 329-440 with a 419-420, SS
AA mutation were produced as described previously (15). Five micrograms of bacterially expressed protein was incubated with 20 ng of the purified catalytic subunit of protein kinase C (Calbiochem) in the reaction buffer (20 mM Tris [pH 7.5], 12.5 mM MgCl2, 0.5 mM EGTA, 50 µM ATP) at 30°C for 1 h. Thereafter, the proteins were resolved on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and exposed to X-ray films.
|
|
|---|
![]() View larger version (22K): [in a new window] |
FIG. 1. ANF is induced by AII in cardiomyocytes. (A) ANF transcript levels were quantified in the ventricles of AT1R transgenic mice (TG) and nontransgenic (Wt) littermates by QPCR. The results shown represent the means ± standard errors of the means for 17 Wt and 8 TG mouse ventricles. (B and C) AII increases the activity of the ANF promoter in cardiomyocytes and in C2C12 cells in an AT1R-dependent fashion. (B) The 695ANF promoter-driven luciferase reporter construct was transfected into cardiomyocytes (left) that were treated for 12 h with 100 nM AII in presence or absence of 100 nM Losartan (Los), an AII antagonist. The right panel is a Northern blot showing changes in endogenous ANF mRNA levels in ventricular cardiomyocyte cultures in response to 24 h of treatment with 100 nM AII. (C) The 695ANF promoter luciferase construct was cotransfected with rat AT1aR, a dominant-negative AT1a mutant (N74D), or an AII type 2 receptor (AT2) expression vector in C2C12 cells. The cells were treated or not with 100 nM AII with or without 100 nM Los for 12 h. The results shown in B and C are the means ± standard errors of at least six independent determinations and represent the ratio of promoter activity plus AII over promoter activity plus vehicle.
|
![]() View larger version (23K): [in a new window] |
FIG. 2. Mapping AII response elements on the ANF promoter. (A and B) C2C12 cells were cotransfected with various ANF promoter constructs and the AT1aR expression vector and then treated with or without 100 nM AII for 12 h. In panel A, reporter constructs were driven by the wild-type 695 or 135 ANF promoter and deletion or point mutants thereof. In panel B, C2C12 cells were cotransfected with reporter constructs driven by the minimal 57 or 135ANF promoters plus or minus the distal STAT element and point mutants thereof. Note how the distal STAT-containing domain cooperates with the proximal GATA/SRE. The data shown represent the means ± standard errors of the means of at least six independent determinations. (C) ANF promoter elements required for AII response in cardiomyocytes. Cells were treated with 100 nM AII for 24 h. Wt, 695ANF-luc; GATA mut, 695ANF-luc with mutated GATA sites; STAT del, 640ANF-luc. The data are from one representative experiment carried out in duplicate (out of three).
|
(Fig. 3B, left panel), as well as endogenous STAT proteins present in nuclear extracts from mouse hearts (Fig. 3B, middle panel); binding over the ANF probe was efficiently displaced by several well-characterized STAT elements (Fig. 3B, middle panel). Interestingly, STAT binding was increased in TG mouse extracts, suggesting that activation of STAT proteins may be an early event in AT1R action in the heart (Fig. 3B, right panel). This was directly confirmed using Western blot analysis, which revealed increased nuclear accumulation of STAT1 and -3 but no detectable change in the level of GATA-4 (Fig. 3C).
![]() View larger version (60K): [in a new window] |
FIG. 3. A) The distal ANF promoter harbors a low-affinity STAT binding site. Electrophoretic mobility shift assays were performed using nuclear extracts of C2C12 cells cotransfected with STAT1 and AT1aR expression vectors and treated with AII. Binding to the 32P-labeled Ly-6E STAT element was competed with 25x cold probe (Self) or with 25x or 50x unlabeled ANF oligonucleotide containing the putative STAT site (ANF). (B) Electrophoretic mobility shift assays were performed using the STAT-containing ANF probe (ANF STAT) and nuclear extracts prepared from STAT1-expressing C2C12 cells (left panel) or from pooled hearts of wild-type (Wt) or AT1R transgenic (TG) mice (middle and right panels). Specific binding was blocked by an anti-STAT1 antibody (left panel). Binding on the ANF STAT probe was competed with a 25x excess of cold probe (Self) or with 25x or 50x labeled probes containing STAT binding sites from the indicated promoters (middle panel). The right panel shows increased STAT binding in AT1R transgenic hearts (TG) compared to wild-type littermates (Wt). Note unchanged OCT-1 binding in the same extracts. (C) Western blots were carried out on whole-cell extracts prepared from the hearts of wild-type (Wt) and AT1R transgenic mice (TG) using the indicated antibodies. In each case, the first lane is a positive control containing extracts from cells overexpressing the relevant transcription factor. (D) Sequences of the various STAT elements used. The core sequences are indicated in bold.
|
![]() View larger version (34K): [in a new window] |
FIG. 4. Involvement of JAK, PKC, and phospholipase C but not PI3K or MAPK in AT1aR-dependent ANF transcriptional activation. (A) C2C12 cells were cotransfected with the 695ANF-luc construct and the AT1aR expression vector and treated or not with AII in the presence of inhibitors for various pathways: p38 MAPK (SB 203580; 10 µM [SB]), ERK (PD 98059; 50 µM [PD]), PI3K (LY 294002; 50 µM [LY]), phospholipase C (U-73122; 5 µM [U]), PKC (GF 109203X; 5 µM [GF]), and JAK2 tyrosine kinase (AG490; 25 µM [AG]). Inhibitors were applied 30 min before the AII treatment. (B) Maximal AII-induced ANF transactivation requires JAK binding to AT1aR. C2C12 cells were cotransfected with wild-type AT1aR (Wt) or YIPP motif mutant (IIGG) and 695ANF-luc constructs containing the wild type (Wt) or a STAT mutant (STAT mut). The inset shows total and phospho-STAT1 (pSTAT1) levels in AII-treated C2C12 cells transiently transfected with intact AT1aR or the IIGG mutant. The first lane is a positive control from AII-treated C2C12 cells overexpressing STAT1 . Note decreased pSTAT1 levels in IIGG-expressing cells relative to those in cells expressing wild-type receptor. (C) PKCß enhances AII-induced ANF transactivation. C2C12 cells were cotransfected with the 695ANF-luc construct and the AT1aR expression vector plus or minus the PKC (the catalytic subunit), ERK1, or ERK2 expression vector. The expression vectors are described in Material and Methods. (D) AII-induced PKC targets GATA elements. C2C12 cells were cotransfected with AT1aR and the indicated ANF-luc constructs and stimulated with AII in presence or absence of the PKC inhibitor (GF). In all cases, AII treatment was for 12 h. Data shown are means ± standard errors of the means of six independent determinations.
|
We further examined the effect of PKC on GATA-4. Bioinformatics-assisted analysis of the GATA-4 protein revealed a putative PKC phosphorylation site within its C-terminal activation domain (aa 417 to 423); this motif is conserved across all species (Fig. 5A). To test whether this or other domains of GATA-4 are phosphorylatable by PKC, we performed in vitro phosphorylation analysis on bacterially expressed GST fusion proteins containing either the N- or C-terminal transactivation domain of GATA-4. As shown in Fig. 5B, the recombinant protein containing the C-terminal region of GATA-4 (aa 329 to 443) was efficiently phosphorylated by the purified catalytic subunit of PKC. Mutation of the serine residues within the PKC recognition motif (S419A S420A) dramatically decreased PKC phosphorylation, suggesting that this site is the major PKC phosphorylation target on GATA-4. Next, the functional consequences of PKC phosphorylation on GATA-4 were assessed. Pharmacologic inhibition of PKC significantly decreased GATA-4 activation of the ANF promoter (Fig. 5C, right panel), and S419A S420A mutation in GATA-4 reduced its transcriptional activity by more than 50% (Fig. 5C, left panel). To elucidate the mechanisms by which PKC activates GATA-4, we analyzed the effect of the S419A S420A mutation on nuclear protein accumulation and DNA binding properties. As shown in Fig. 5D, although the S419A S420A mutation was consistently expressed at a slightly higher level (top panel), the ability of this mutant to interact with the ANF GATA binding site (bottom panel) was markedly decreased (2.5- to 3-fold, without correcting for protein expression). This result suggested that AII stimulation enhances GATA-4 activity, in part by increasing its DNA-binding capacity. This hypothesis was directly tested by analyzing the level and DNA-binding activity of endogenous GATA-4 in AII-stimulated cardiomyocytes. Treatment of neonate cardiomyocyte cultures with AII did not affect the level of nuclear GATA-4 protein (Fig. 5E, lower panel), a finding consistent with that obtained in extracts from the hearts of AT1R transgenics (Fig. 3C). Nevertheless, gel shift analysis revealed a 2.7-fold increase in GATA binding activity that was confirmed to correspond to GATA-4 with antibody supershift assay (Fig. 5E). That nuclear signaling by AII involved GATA-4 was also confirmed by the ability of two dominant-negative GATA-4 proteins to block the AII response in cardiomyocytes, while addition of the intact GATA-4 protein could substitute for AII stimulation (Fig. 5F). Together, the above results reveal that GATA-4 is an essential mediator of nuclear AII action and that AII activates GATA-4, in part, through PKC-mediated phosphorylation and enhancement of its DNA binding activity.
![]() View larger version (50K): [in a new window] |
FIG. 5. (A) GATA-4 contains a conserved PKC phosphorylation site within the C-terminal activation domain. The putative PKC phosphorylation site is shown in bold. (B) In vitro PKC phosphorylation of GST-GATA-4 fusion proteins containing either the N-(1-207) or C-terminal (329-443) transactivation domain. Ponceau staining was used to show protein loading. The right panel shows the effect of serine-to-alanine mutation within the conserved PKC motif (S419A S420A) on PKC phosphorylation. (C) Effect of mutating the PKC phosphorylation residues on GATA-4 transcriptional activity. In the left panel, C2C12 cells were cotransfected with a 3x GATA-luc reporter and increasing concentrations of wild-type (Wt) HA-GATA-4 (1-425) or mutated (Mut) HA-GATA-4 (S419A S420A). The right panel shows the effect of PKC inhibition with 5 µM GF 109203X on the 135ANF promoter activation with GATA-4. The data shown represent the means ± standard errors of the means of at least four independent determinations. (D) Effect of the same mutation on GATA-4 nuclear levels (top panel) and DNA binding activity (lower panel). Nuclear extracts were prepared from C2C12 cells transfected with wild-type (Wt) or mutant (PKC mut) GATA-4 (described above). The amount of GATA-4 was determined by Western blotting using anti-HA antibody (upper panel). The binding activity was determined by electrophoretic mobility shift assay using increasing concentrations of nuclear extracts and the 120ANF GATA site as a probe. (E) Effect of AII on endogenous GATA-4 levels and DNA-binding activity. Nuclear extracts (NE) were prepared from cardiomyocytes infected with Ad-AT1aR and treated or not with 100 nM AII for 20 min. DNA binding (upper panel) was performed as described above. The specificity of GATA-4 binding was determined by supershift assay with the anti-GATA-4 ( G4) antibody or by competition with the cold ANF GATA oligonucleotide (self). GATA binding is indicated by the arrowhead and the supershift by the asterisk. The amount of GATA-4 in the nuclear extracts was determined by Western blotting using anti-GATA-4 antibody. (F) The AII-GATA-4 pathway in cardiomyocytes. Cardiomyocytes were cotransfected with the 695ANF-luc construct and wild-type (Wt) or two dominant-negative forms of GATA-4, one with the ability to bind DNA but lacking transcriptional activation domains (DBD) and one lacking DNA binding activity but retaining the ability to interact with cofactors (ZN mut). The data are the means ± standard errors of the means of one representative experiment out of four that were qualitatively identical.
|
but not STAT3 or STAT5b consistently activated the ANF promoter in cardiac and noncardiac cells, and this effect was further potentiated in the presence of AII (Fig. 6A). Next, we tested whether STAT1
and GATA-4 cooperate in transcriptional activation. As shown in Fig. 6B, STAT1
and GATA-4 synergistically activated the ANF promoter. Addition of STAT1
consistently enhanced GATA-4 transcriptional activation of this promoter by five- to sixfold (n > 20). In contrast, STAT3, in various amounts, had no effect on GATA-4 activity. Interestingly, although STAT5b by itself did not activate the ANF promoter, it was able to cooperate with GATA-4 in transcriptional activation, though to a lesser extent than STAT1
(Fig. 6B).
![]() View larger version (25K): [in a new window] |
FIG. 6. (A) AII potentiates STAT1 -induced transactivation of ANF. NIH 3T3 cells were cotransfected with the 695ANF-luc construct and the STAT1 expression vector and treated with 100 nM AII (AII) or vehicle (Ctl) for 12 h. (B) Synergistic activation of ANF transcription by GATA-4 and STAT1 . Cells were cotransfected with the 695ANF-luc and GATA-4 vectors in the presence or absence of various STAT expression vectors. The results shown are from C2C12 cells, but similar results were also obtained in NIH 3T3 cells. (C and D) Structure-function analysis of GATA-4 and STAT1 using the 695ANF-luc reporter. The various GATA-4 or STAT1 expression vectors are shown schematically. (E) Effect of the CBP coactivator on GATA-4/STAT1 synergy. The experiments were done as described in panels C and D above. The data shown represent the means ± standard errors of the means of several experiments (n = 6 for panels A and B; n = 4 for panels C, D, and E).
|
. The GATA-4 protein contains two transcriptional activation domains flanking its two-zinc-finger DNA-binding domain. As shown in Fig. 6C, removal of the first 129 aa, which decreased GATA-4 transcriptional activity, reduced but did not abrogate synergy; deletion of the C-terminal activation domain significantly reduced synergy, indicating that intact GATA-4 transcriptional activity is required for functional interaction with STAT1. Consistent with this, the DNA binding domain (aa 200 to 332) was unable to support synergy. Mutations in the second zinc finger, which abolish DNA binding, also interfered with STAT1 synergy (Fig. 6C), suggesting that GATA-4 binding to its site is necessary for functional interaction with STAT over the ANF promoter. Next, we tested whether the transactivation domains of STAT1 were required for synergy with GATA-4. Various STAT1 functional domains have been identified (12) and are schematically depicted in Fig. 6D. Removal of the entire C-terminal transactivation domain significantly reduced but did not abolish synergy; however, removal of the N-terminal region, which harbors a domain required for STAT dimer-dimer formation as well as a coiled-coiled domain involved in CBP/p300 interaction, abrogated synergy (Fig. 6D). From this analysis, we conclude that the C-terminal activation domain of STAT1 is required for maximal synergy but that the N-terminal region is essential for functional interaction with GATA-4. The finding that the activation domains of both GATA-4 and STAT1 are needed for maximal synergy, given that both proteins interact with the CBP/p300 coactivators (6, 31), led us to investigate whether GATA-4/STAT1 cooperativity involves corecruitment of CBP. As shown in Fig. 6E, addition of increasing amounts of CBP greatly potentiated the synergistic action of GATA-4 and STAT1 on the ANF promoter. Next, we determined which promoter elements were required for GATA-4 and STAT1 cooperativity. As shown in Fig. 7A, deletion of sequences between bp 695 and 135 decreased maximal activation levels but did not impair GATA-4/STAT1 synergy, suggesting that binding of STAT1 to DNA was dispensable. Consistent with this, mutation of the STAT element in the context of the full-length promoter reduced but did not abolish synergy. In contrast, mutation of the GATA sites abrogated both GATA responsiveness and GATA/STAT synergy. A minimal promoter driven by multimerized GATA binding sites was cooperatively activated by GATA-4 and STAT1. Together, these results indicate that GATA elements are necessary and sufficient for GATA/STAT synergy and suggest that GATA factors may be able to recruit STAT proteins to target promoters. To test this, we performed coimmunoprecipitation assays which revealed that GATA-4 was indeed able to physically interact with STAT1 in vivo (Fig. 7B). Interestingly, removal of the N-terminal but not the C-terminal domain of STAT1 abolished physical association with GATA-4 (Fig. 7C), a finding that would explain the inability of N-terminally deleted STAT1 (330 to 713) to synergize with GATA-4 (Fig. 6D). Finally, to confirm the relevance of a GATA-dependent pathway for STAT1 action, ANF-luc constructs containing the 695 wild-type or GATA element-mutated ANF promoter were tested for their ability to respond to STAT1 in cardiomyocytes. As shown in Fig. 7A, whereas the wild-type promoter was dose-dependently activated by cotransfected STAT1, mutation of the GATA sites abrogated STAT1 activation. These resultswhich are consistent with those of Fig. 2Cindicate that in vivo, interaction with GATA factors bound to the promoter is required for STAT1 activation of the ANF promoter.
![]() View larger version (42K): [in a new window] |
FIG. 7. (A) Mapping of the DNA elements required for GATA-4/STAT1 synergy. NIH 3T3 cells were cotransfected with the indicated ANF-luc constructs or a minimal BNP promoter driven by multimerized GATA binding sites (3xGATA) and with GATA-4, STAT1 , or both expression vectors. The data shown represent the means ± standard errors of the means of at least six independent determinations. (B and C) GATA-4 interacts physically with STAT1 in vivo. In panel B, nuclear extracts from 293T cells transfected with STAT1 and/or HA-GATA-4 were immunoprecipitated using an anti-HA antibody, separated on 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes, and subjected to immunoblotting using either anti-STAT1 or anti-HA antibodies (lower two panels). The top panels are Western blots carried out on the nuclear extracts used for the immunoprecipitation. In panel C, similar experiments were done using Flag-GATA-4 and HA-tagged full-length or N- or C-terminally deleted STAT1 . Immunoprecipitation was carried out with the anti-Flag antibody. The positions of the different STAT1 proteins as revealed with the anti-HA antibody are indicated by asterisks. (D) GATA elements are essential for ANF transactivation by STAT1 in cardiomyocytes. Increasing amounts of the STAT1 expression vector were cotransfected in cardiomyocytes with the 695ANF-luc construct (Wt) or a similar construct containing point mutations in the two high-affinity GATA sites (GATA mut). The data shown represent the means ± standard errors of the means of four independent determinations.
|
![]() View larger version (9K): [in a new window] |
FIG. 8. In vivo association of the GATA-4 and STAT proteins with the ANF promoter. (A) Schematic representation of the various STAT and GATA elements on the ANF promoter. Putative elements correspond to in silico-identified consensus sequences. The location of the sets of primers used in the QPCR is depicted below. (B) Enrichment of GATA-4 and STAT1 and -3 proteins on the endogenous ANF promoter as revealed from ChIP experiments. The results shown are from one representative experiment out of two carried out in duplicate on primary cardiomyocytes stimulated for 48 h with 100 nM AII. The data are expressed as the ratio of ChIP with the respective antibodies over that obtained with immunoglobulin G. For details, see Materials and Methods.
|
![]() View larger version (21K): [in a new window] |
FIG. 9. (A) Functional cooperation between GATA-4 and STAT1 is not restricted to the ANF promoter. NIH 3T3 cells were cotransfected with the 1176 VEGF, 360 c-fos, or 757 Bcl-x promoter-driven luciferase reporters and GATA-4, STAT1 , or both expression vectors. (B and C) Functional cooperation between STAT1 , GATA-4, and SRF. Cells were cotransfected with 137ANF (B) or 360 c-fos (C) promoter-driven luciferase reporter constructs with various combinations of SRF, GATA-4, and STAT1 . The data shown represent the means ± standard errors of the means for four to six experiments with C2C12 cells.
|
|
|
|---|
AII regulation of ANF transcription. AII is a major cardioregulatory hormone, and drugs that inhibit its biosynthesis or its receptor are widely used for the treatment of human cardiovascular conditions. Surprisingly, the mechanisms by which AII regulates transcription in the heart remain undefined. Within the heart, AII targets both myocytes and nonmyocytes (64, 74). Except for the c-fos gene (61), few direct transcription targets of AII in cardiomyocytes have been identified. The data presented show that ANF is a direct transcription target of AII and that upregulation of ANF does not require AII-induced hypertrophy. Thus, studies of AII regulation of the ANF promoter offered the opportunity to identify AII-mediated transcriptional mechanisms without the confounding input of hypertrophy-induced pathways. The results show that AII, via its type 1 receptor (AT1R), activates the ANF promoter through two major signaling cascades, JAK-STAT and PKC-GATA-4. Interestingly, MAPK signaling did not appear to play a role in relaying AII signaling at the level of the ANF promoter. This may reflect a more specific role for the MAPK pathway in the growth (hypertrophic) effects of AII that are dependent on the EGF receptor (74). In contrast, ANF is a cardioprotective hormone that antagonizes cardiac hypertrophy (30). ANF is also a well-known antagonist of AII (39). Thus, ANF activation by AII may be part of a negative feedback loop that serves to attenuate AII action. In this case, the signaling pathways linking AT1R to ANF transcription, i.e., PKC and JAK-STAT, would be predicted to be cardioprotective. Several studies support this conclusion. First, STAT proteins have been reported to transduce cardioprotective signals (29, 37, 83). Although the mediators of this beneficial effect are not defined, interaction of STAT with GATA-4, a cardioprotective transcription factor (3), and activation of ANF and/or VEGF may explain at least part of STAT cardioprotective effects. Second, although numerous hypertrophic signals were shown to activate different PKC isoforms, the bulk of the evidence argues against an involvement of PKC in initiating and/or maintaining hypertrophy (11, 28). In fact, upregulation of PKCß in the adult heart has been shown to have beneficial effects (75). Importantly, pharmacologic inhibition of PKC did not block AII-induced hypertrophy (74) but did abrogate AII activation of c-fos transcription (62) and ANF biosynthesis (34). In the future, it will be interesting to map the specific domains of the AT1R that are required for ANF transcription and determine whether they can be dissociated from those involved in mediating the AII hypertrophic response. Such studies could ultimately lead to the development of novel therapeutic drugs that selectively target specific AII-activated signaling pathways.
GATA-4, an integrator of cell signaling in the heart. Cooperative interactions between cell-specific transcription factors and signal-activated regulators represent one of the most effective means to achieve cell and target gene specificity by signaling pathways. The experiments presented in this paper reveal that GATA-4 plays an essential role for ANF promoter activation in response to AII. In this context, GATA-4 acts as an integrator of two signaling pathways: PKC, which targets its C-terminal domain, resulting in enhanced DNA binding activity, and the JAK-STAT pathway, which potentiates its activity through protein-protein interaction with STATs. GATA-4, a member of the GATA family of tissue-specific zinc finger proteins, is a critical regulator of cardiogenesis (26, 58). In postnatal cardiomyocytes, GATA-4 is essential for maintaining the cardiac genetic program (14) and for the adaptive response of the heart to numerous stimuli, including hormones and work overload (15, 42, 57). GATA-4 actions involve combinatorial interactions with other cell-restricted or inducible transcription factors, including Nkx2.5, Mef2, SRF, nuclear factor of activated T cells, SMAD, and c-fos (reviewed in reference 73). GATA-4 activity is also directly modulated by signaling cascades; ERK and p38 MAPK phosphorylate and enhance GATA-4 transcriptional activation domains (15, 41), while glycogen synthase kinase (GSK3ß) phosphorylates the GATA-4 DNA binding domain and inhibits nuclear GATA-4 accumulation (50). Through its cooperative interaction with other transcriptional regulators, GATA-4 serves as a nuclear integrator of several signaling pathways, most notably calcineurin, MAPK, PI3 kinase, and receptor serine-threonine kinases. Our findings that PKC and JAK-STAT also converge on GATA-4 expand the role of GATA-4 as a transcriptional mediator of epigenetic signals and will be important in understanding the mechanisms of action of numerous other cardioregulators. For example, opioid receptor agonists were found to enhance embryonic stem cell differentiation into cardiomyocytes via PKC-dependent activation of GATA-4 (78). On the other hand, some cytokines acting through a gp130-coupled receptor have been shown to require GATA elements for transcriptional regulation of target promoters (47).
Our findings that GATA binding sites were sufficient to support GATA/STAT synergy and that GATA-4 was able to physically associate with STAT1 in living cells are especially noteworthy, since they raise the possibility that STAT proteins can activate target promoters via GATA binding sites. Synergistic action of the GATA/STAT complex does not appear to be due to an effect of STAT on GATA-4 binding to its site (data not shown). The structure-function analysis indicates that at least one of the transcriptional activation domains of GATA-4 is required; in the case of STAT1, the presence of the N-terminal domain appears to contact GATA-4, and the C-terminal activation domain, which is known to interact with CBP/p300 (31), is required for maximal synergy (Fig. 6). GATA-4 and several other GATA factors also associate with CBP/p300 through the DNA binding domain, leading to enhanced transcriptional activity (6, 7, 33). Together with ability of CBP to further enhance synergy, these data suggest that the GATA/STAT functional synergy likely involves corecruitment of CBP/p300.
GATA/STAT interaction and cell specificity of cytokine action. The involvement of the GATA and STAT proteins in cytokine signaling is well documented in the hematopoietic system. For example, both STAT5 and GATA-1 are essential for the survival effects of erythropoietin on erythroid progenitors (68, 81), and dominant-negative GATA proteins block interleukin 13 action; these proteins also mediate the effects of thrombopoietic cytokines in erythroid and megakaryotic differentiation (32, 36). Similarly, in the lymphoid system, both GATA-3 and STAT5 and -6 mediate cytokine-induced development of CD4+ cells and the differentiation of T-helper type 2 (cells (54). Interestingly, cooperation between GATA and STAT has been suggested by the finding that the T-helper type 2 locus control region requires both GATA-3 and STAT6 for generating/maintaining an open chromatin configuration (70). More recently, GATA-1 was found to mediate interferon 8 induction of the human major histocompatibility complex class 1b gene; in this case, GATA-1 binds to a weak site adjacent to the interferon response element, and the presence of both sites results in superactivation (5). Thus, the GATA/STAT synergy described in this work is likely to represent a general mechanism that could account for cell-specific effects of cytokine/growth factors acting through tyrosine kinase-coupled receptors. This may be particularly relevant to understanding cytokine action in hematopoietic cells. In this respect, we demonstrated that at least two targets of GATA and STAT action in hematopoietic cells, namely the Bcl-x and c-fos promoters, are synergistically activated by GATA and STAT proteins (Fig. 9). Whether this paradigm extends to other target genes in hematopoietic and other cell types deserves to be tested.
We thank S. Karnik, D. Richard, and T. Hoang for sharing various DNA vectors, Walter G. Thomas for generously providing the adenovirus AT1aR vector, Lise Laroche for secretarial assistance, and the Nemer Lab for helpful discussions.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»