This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sarruf, D. A.
Right arrow Articles by Fajas, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sarruf, D. A.
Right arrow Articles by Fajas, L.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, November 2005, p. 9985-9995, Vol. 25, No. 22
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.22.9985-9995.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Cyclin D3 Promotes Adipogenesis through Activation of Peroxisome Proliferator-Activated Receptor {gamma}

David A. Sarruf,1 Irena Iankova,1,{dagger} Anna Abella,1,{dagger} Said Assou,1 Stéphanie Miard,1 and Lluis Fajas1,2*

INSERM, Equipe Avenir, U540, F34090 Montpellier, France,1 Centre Hostpitalier Universitaire Montpellier, F34295 Montpellier, France2

Received 15 February 2005/ Returned for modification 8 April 2005/ Accepted 7 August 2005


arrow
ABSTRACT
 
In addition to their role in cell cycle progression, new data reveal an emerging role of D-type cyclins in transcriptional regulation and cellular differentiation processes. Using 3T3-L1 cell lines to study adipogenesis, we observed an up-regulation of cyclin D3 expression throughout the differentiation process. Surprisingly, cyclin D3 was only minimally expressed during the initial stages of adipogenesis, when mitotic division is prevalent. This seemingly paradoxical expression led us to investigate a potential cell cycle-independent role for cyclin D3 during adipogenesis. We show here a direct interaction between cyclin D3 and the nuclear receptor peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). Our experiments reveal cyclin D3 acts as a ligand-dependent PPAR{gamma} coactivator, which, together with its cyclin-dependent kinase partner, phosphorylates the A-B domain of the nuclear receptor. Overexpression and knockdown studies with cyclin D3 had marked effects on PPAR{gamma} activity and subsequently on adipogenesis. Chromatin immunoprecipitation assays confirm the participation of cyclin D3 in the regulation of PPAR{gamma} target genes. We show that cyclin D3 mutant mice are protected from diet-induced obesity, display smaller adipocytes, have reduced adipogenic gene expression, and are insulin sensitive. Our results indicate that cyclin D3 is an important factor governing adipogenesis and obesity.


arrow
INTRODUCTION
 
Our understanding of the molecular mechanisms that orchestrate adipocyte differentiation have been greatly advanced by the use of preadipocyte cell lines, such as 3T3-L1 cells capable of undergoing adipogenesis (14). Upon reaching confluence, proliferating preadipocytes become growth arrested by contact inhibition. These growth-arrested preadipocytes reenter the cell cycle after hormonal induction, arrest proliferation again, and finally undergo terminal adipocyte differentiation. Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), a ligand-inducible transcription factor, has been identified as a major regulator of terminal adipocyte differentiation (10, 37). PPAR{gamma}, upon activation by either fatty acid derivatives or antidiabetic thiazolidinediones, drives the expression of several adipocyte-specific genes, such as the fatty acid binding protein aP2, transforming the cell into the characteristic lipid-rich adipocyte (42). Subsequent studies have demonstrated that ectopic expression of PPAR{gamma} further induces adipocyte differentiation (43). This pivotal role of PPAR{gamma} in adipocyte differentiation is also highlighted by the phenotype observed in humans with mutations in the PPAR{gamma} gene and by PPAR{gamma}-deficient mice, which are essentially void of white adipose tissue (8).

D-type cyclins were first characterized for their ability to coordinate cell cycle progression through the G1 phase. Three D cyclins (cyclins D1, D2, and D3) bind and activate cyclin-dependent kinases 4 and 6 (CDKs 4 and 6), directing the phosphorylation of retinoblastoma protein, as well as retinoblastoma protein-related proteins p107 and p130 (4, 18, 28). This phosphorylation event disrupts the retinoblastoma protein repressor complexes, leading to derepression of E2F transcription factors and induction of E2F target genes, which are required for S-phase entry (6).

In addition to their defined role as part of the core cell cycle machinery, a new potential for D cyclins has emerged in other cellular processes, including transcriptional control and differentiation. Cyclin D1 can bind and repress the activity of several transcription factors, including b-Myb (15), MyoD (34, 40), and DMP1 (17). Although less well explored, a CDK-independent role for cyclin D3 has also been reported, including inhibition of granulocyte differentiation (19). More recent studies have attributed cyclin D3 with the ability to bind and activate certain transcription factors, such as human activating transcription factor 5 (25). In the case of cyclin D3 mutant mice it has been found that they fail to undergo development of immature T lymphocytes (39).

Recently, our laboratory explored a link between the molecular processes governing adipocyte differentiation and the molecular machinery involved in cell cycle progression. These studies have established key cell cycle regulators including the retinoblastoma protein and the E2F transcription factor family as fundamental regulators of adipogenesis through their modulation of PPAR{gamma} expression and activity (9, 11). Other recent studies have linked loss of cyclin-dependent kinase inhibitors with obesity in mice (30).

The notion that adipogenesis is regulated by proteins of the cell cycle is not unexpected since early stages of 3T3-L1 adipogenesis (days 1 to 2) are marked by active rounds of mitotic clonal expansion. An active cell cycle during the initial stages of adipogenesis is considered a prerequisite for terminal adipocyte differentiation (days 3 to 6) since CDK and MEK-1 (mitogen-activated protein kinase 1) inhibitors, which prevent mitotic clonal expansion, also block the differentiation process (41). Following a few rounds of mitotic division, CDK inhibitors mediate cell cycle exit, which sets the stage for PPAR{gamma}-driven terminal adipocyte differentiation (29).

Because D-type cyclins represent a link between cell cycle progression, cell differentiation, and transcriptional regulation, we wanted to explore their potential role during adipogenesis. We show here that cyclin D3 expression is up-regulated during terminal stages of adipogenesis and functions as a ligand-dependent coactivator of PPAR{gamma} capable of phosphorylating the A-B domain of the nuclear receptor. Knockdown of cyclin D3 diminished PPAR{gamma} activity and adipogenesis, whereas cyclin D3 overexpression had the opposite effect. Consistent with these findings, we show that cyclin D3 null mice are protected from diet-induced obesity, have reduced adipocyte size, and show increased sensitivity to insulin.


arrow
MATERIALS AND METHODS
 
Chemical reagents and antibodies. Pioglitazone was provided by Takeda Pharmaceutical Company (Osaka, Japan) and rosiglitazone was purchased from Interchim (Montlucon, France). All chemicals were purchased from Sigma (St. Louis, MO). Cyclin D3 (sc-6283), PPAR{gamma} (sc-7273), PPAR{gamma} (sc-7196), and actin (sc-1615) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-bromodeoxyuridine antibody was bought from Dako A/S (Glostrup, Denmark).

Cell culture, transfections, and protein extracts. Cos and 3T3-L1 cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. In differentiation studies, 0.5 mM 3 isobutyl-1-methylxanthine, 10 µg/ml insulin, and 1 µM dexamethasone were added for 2 days. From day 3 on, 10 µg/ml insulin and in certain cases 10–6 M pioglitazone were added. Nuclear extracts and Oil Red O staining were prepared as described (35) with the exception that cells were incubated with Oil-Red-O solution for only 90 seconds. For reporter assays, cells were transfected with 10 ng of PPAR{gamma} and 300 ng of cyclin D3 expression vectors using Lipofectamine (Life Technologies, Rockville, MD). Luciferase and ß-galactosidase activity was measured as described (35). Stable 3T3-L1 cell lines were carried out by transfection of the pcDNA3-cycD3 vector and the control empty vector followed by selection with neomycin (500 µg/ml) for 15 days.

Pull-down, coimmunoprecipitation, and chromatin immunoprecipitation. In vitro translation of pSG5-PPAR{gamma} and pcDNA3-cycD3 was done using [35S]methionine (Amersham, Orsay, France) in a TNT coupled reticulocyte lysate (Promega, Madison, WI). Pull-down immunoprecipitation assays were performed as described (9). Chromatin immunoprecipitation assays were performed using three 10 cm plates per point according to the Upstate chromatin immunoprecipitation assay kit (Lake Placid, NY). Oligonucleotides used to amplify the mouse aP2 PPRE were 5'-CCCAGCAGGAATCAGGTAGC-3' and 5'-AGAGGGCGGAGCAGTTCATC.

RNA isolation, quantitative real-time PCR, and Northern blot. RNA isolation was carried out using the Rneasy minikit (QIAGEN Sciences, Maryland) according to the manufacturer's instructions. Reverse transcription of total RNA was performed at 42°C using Moloney murine leukemia virus reverse transcriptase enzyme and random hexanucleotide primers (Invitrogen, Carlsbad, CA), followed by 15 min inactivation at 70°C. Quantitative PCR was carried out by real-time PCR using a LightCycler and the DNA double-strand-specific SYBR green I dye for detection (Roche, Basel, Switzerland). Results were normalized to glyceraldehyde-3-phosphate dehydrogenase levels. Oligonucleotide sequences used for quantitative real-time PCR are available upon request. A melting temperature of 60°C was used for all of the primers used above. Northern blot analysis was performed as described previously (23).

SiRNA against cyclin D3. To target cyclin D3 expression, short interfering RNA (siRNA) sequences were designed against the 5'-CAGCGGGAGATCAAGCCGCACAT-3' sequence of the mouse cyclin D3 transcript. Oligonucleotides coding for a hairpin siRNA were cloned into pRNAT-U6.1/Neo vector (GenScript, Piscataway, NJ) as described by the manufacturer. Stable 3T3-L1cell lines expressing the pRNAT-U6.1/Neo {alpha}D3 and the pRNAT-U6.1/Neo-control vector were created by Lipofectamine transfection of the vectors followed by selection with neomycin (500 µg/ml) for 14 days.

Western blot analysis and immunofluorescence. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and electrotransfer were performed as described (38). The membranes were blocked at room temperature for 45 min in phosphate-buffered saline, 0.5% Tween 20, 5% milk and incubated overnight at 4°C with the indicated antibodies followed by 1 h with a peroxidase-conjugated secondary antibody at room temperature. The complex was visualized with a 4-chloro-1-naphthol reagent. For all immunofluorescence experiments, cells were grown on coverslips and fixed with methanol at 4°C for 10 min. For bromodeoxyuridine incorporation, cells were additionally treated with 1.5 N HCl for 10 min at RT. After incubation with the indicated antibodies, cells were incubated with a combination of Texas red-conjugated anti-mouse immunoglobulin G and fluorescein isothiocyanate-conjugated anti-rabbit immunoglobulin G.

Plasmids and mutant constructs. The pcDNA3 vector was purchased from Stratagene (La Jolla, CA). The pcDNA3-cycD3 expression vector was created by excising the cyclin D3 insert from the pBABE-cycD3 vector (gift from B. Amati) at BamHI and EcoRI restriction sites followed by ligation into the pcDNA3 vector. The thymidine kinase-luciferase (TK-Luc), PPAR{gamma} response element (PPRE)-TK-Luc, upstream activation sequence (UAS)-TK-Luc, glutathione S-transferase (GST)-PPAR{gamma} DE, GST-PPAR{gamma}b-AB, GST-PPAR{gamma}-AB, Gal4-PPAR{gamma}, and PPAR{gamma}2 expression vectors have been previously described (13, 35).

The cyclin D3 LXXLL point mutations were performed by PCR of pcDNA3-cycD3 with primers GATCCCTGCCAGGAATTCTGTGAGCTCATC (for the Ct mutant), and GATGAGCTCACAGAATTCCTGGCAAGGGATC (for the Nt mutant). The {Delta}1-129 deletion mutant was created by PCR amplification of pcDNA3-cycD3 with the following primers: forward, CGGGATCCCGCAAGTGGGACCTGGCTGCTGTGAT, and reverse, CGGAATTCCGGCGGCCCCTCCTCTGCTTAGTGG, containing BamHI and EcoRI restriction sites, respectively. Wild-type cyclin D3, LXXLL point mutants, and {Delta}1-129 deletion mutants were cloned into the pGex4T1 vector at BamHI and EcoRI restriction sites. The {Delta}148-293 deletion mutant was created by digesting WTcycD3-pGex4T1 with PpuMI followed by ligation.

Kinase assays. Kinase assays were performed using 100 ng of an active cyclin D3/CDK6 kinase (Upstate, Charlottesville, Virginia) and 250 ng of recombinant PPAR{gamma} protein as the substrate (Active Motif, Carlsbad, CA). Reactions were performed in kinase buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol) in the presence of 40 mM ATP and 8 mCi [{gamma}-33P]ATP for 30 min at 37°C. The reaction was stopped by boiling the samples for 5 min in the presence of denaturing sample buffer. Samples were then subjected to SDS-PAGE, and the gels were then dried in a gel dryer for 1 h at 80°C and exposed to an X-ray film overnight.

Animal experiments. The cyclin D3 knockout mice were a generous gift from P. Sicinski, by whom their generation has been previously described (39). Animals were maintained according to European Union guidelines for use of laboratory animals. Sections from white adipose tissue were fixed in 4% formaldehyde and stained with hematoxylin and eosin. The intraperitoneal glucose tolerance test and insulin sensitivity tests were performed as described (33). Cyclin D3 mutant and age-matched wild-type mice were fed a lipid-rich diet (58% fat, 25% carbohydrates, and 16% protein) for 8 weeks. All experiments were performed with six age- and gender-matched mice for each group.


arrow
RESULTS
 
Cyclin D3 expression is up-regulated during adipogenesis. When hormonally stimulated, confluent 3T3-L1 preadipocytes reenter the cell cycle before they undergo differentiation (14). We correlated the expression of cyclin E, cyclin D3, and PPAR{gamma} during differentiation of 3T3-L1 cells. Protein levels of cyclin E were observed to increase after 1 day of differentiation coincident with cell cycle entry (Fig. 1A). After 2 days of differentiation cyclin E expression drops as differentiating cells exit the cell cycle and the expression of adipogenic markers such as PPAR{gamma} is switched on (Fig. 1A). Surprisingly, cyclin D3 protein levels were undetectable during the early stages of differentiation and were strongly induced during later stages after the cells had already exited from the cell cycle and began to express PPAR{gamma}. A similar expression pattern was observed by immunofluorescence microscopy (Fig. 1B). Interestingly, we observed that cyclin D3 and PPAR{gamma} coexpressed in the same cells.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 1. Expression pattern of cyclin D3 during adipogenesis. (A) Western blot analysis of whole-cell extracts prepared at the indicated days of 3T3-L1 adipocyte differentiation. The proteins detected by cyclin E, cyclin D3, and PPAR{gamma} antibodies are indicated. (B) Analysis of cyclin D3 and PPAR{gamma} protein expression by immunofluorescence during the first 4 days of 3T3-L1 differentiation. Cells expressing PPAR{gamma} are labeled in red (Texas red), whereas cells expressing cyclin D3 are labeled in green (fluorescein isothiocyanate). Nuclei were stained with the Hoechst reagent (blue staining). (C) Northern blot analysis of cyclin D3 mRNA expression during adipocyte differentiation, 28s is used as a loading control. (D) Relative cyclin E, cyclin D3, and PPAR{gamma} gene expression measured by quantitative real-time PCR during 3T3-L1 differentiation. (E) Relative expression of cyclin D3 mRNA as measured by quantitative real-time PCR in different mouse tissues (WAT, white adipose tissue; BAT, brown adipose tissue; MUS, muscle; LIV, liver). Results were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase. (F) Analysis of cyclin D3 protein expression and bromodeoxyuridine by immunofluorescence at day 5 of differentiation. After a 24-h incubation with bromodeoxyuridine, cells, which have incorporated bromodeoxyuridine are labeled in red, while cells expressing cyclin D3 are labeled green, and nuclei are visualized with Hoechst staining.

To obtain further evidence of the expression pattern of cyclin D3 during adipogenesis, we performed Northern blot analysis on differentiating 3T3-L1 cells. Such analysis revealed a potent increase in cyclin D3 mRNA throughout adipogenesis (Fig. 1C). This result was confirmed by quantitative real-time PCR analysis, which revealed a threefold increase in cyclin D3 mRNA throughout adipogenesis (Fig. 1D). Consistent with protein expression (Fig. 1A), mRNA levels for cyclin E increased during days 1 to 2 and decreased thereafter, whereas expression of PPAR{gamma} increased strongly from day 1 through the end of differentiation.

To determine the relative expression of cyclin D3 mRNA in vivo, we performed quantitative real-time PCR, comparing cyclin D3 mRNA expression in mouse white adipose tissue, brown adipose tissue, muscle, and liver. Interestingly, we observed strongly elevated cyclin D3 expression in white adipose tissue compared to other tissues (Fig. 1E), suggesting a possible role of this protein in adipose tissue biology. To determine whether cyclin D3 expression during adipogenesis was associated with an active cell cycle, we incubated differentiating 3T3-L1 cells with bromodeoxyuridine to mark proliferating cells. After a 24-hour incubation at day 5 of differentiation, cells were colabeled with bromodeoxyuridine and cyclin D3 antibodies and visualized by fluorescence microscopy. We observed that only a limited percentage of cyclin D3-positive cells had incorporated bromodeoxyuridine (less than 12%) (Fig. 1F). These results suggest a cell cycle-independent role for cyclin D3 during adipogenesis.

Cyclin D3 inhibition impairs adipogenesis. To elucidate the role of cyclin D3 during adipogenesis, we silenced cyclin D3 expression using siRNA techniques. 3T3-L1 cell lines stably expressing a vector coding for a hairpin siRNA sequence against the mouse cyclin D3 transcript or an irrelevant siRNA were compared for their ability to differentiate into adipocytes. After 6 days in differentiation medium, normal lipid accumulation was observed in control cells, whereas a dramatic decrease in lipid accumulation was observed in cyclin D3 knockdown cells as assessed by Oil Red O staining (Fig. 2A and B). Differentiated cyclin D3 knockdown cells expressed significantly reduced levels of cyclin D3 and slightly reduced PPAR{gamma} protein compared to control cells (Fig. 2B). Quantitative real-time PCR performed on differentiated 3T3-L1 cells revealed a dramatic reduction of adipogenic gene markers, including adiponectin, aP2, and lipoprotein lipase, and a modest reduction of PPAR{gamma} expression when cyclin D3 was knocked down (Fig. 2C), further demonstrating the importance of cyclin D3 in adipogenesis.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. Cyclin D3 knockdown inhibits 3T3-L1 adipogenesis. (A) Micrographs of Oil Red O staining of cyclin D3-silenced 3T3-L1 cells (siRNA-cycD3) and control (siRNA-mock) after 6 days of differentiation (top panel). The middle panel confirms knockdown of cyclin D3 by immunofluorescence assay. Nuclei are stained in blue (Hoechst). (B) Western blot showing knockdown of cyclin D3 expression in 3T3-L1 cells expressing a stable vector coding for a siRNA sequence directed against mouse cyclin D3 and corresponding PPAR{gamma} protein expression. (C) Quantitative real-time PCR showing gene expression of the adipogenic markers adiponectin, aP2, LPL, and PPAR{gamma} in knockdown versus control differentiation experiments. Results are expressed as fold repression compared to the control.

Cyclin D3 overexpression stimulates adipogenesis. Since knockdown of cyclin D3 was inhibiting adipogenesis, we next tested whether overexpressing cyclin D3 could accelerate adipocyte differentiation. For this we created stable cell lines expressing the pcDNA3-cyclin D3 or control vector. After just 4 days in differentiation medium, we observed increased lipid accumulation, increased PPAR{gamma} protein expression, and up-regulation of adipogenic mRNA markers as assessed by quantitative real-time PCR in cells overexpressing cyclin D3 compared to the control (Fig. 3A to 3C). Immunofluorescence performed on differentiated 3T3-L1 cells (day 5) overexpressing cyclin D3 revealed a positive correlation between the level of cyclin D3 expression and that of PPAR{gamma} in individual cells (Fig. 3D), further suggesting that cyclin D3 is an adipogenic factor.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 3. Cyclin D3 overexpression stimulates 3T3-L1 adipogenesis. (A) Western blot showing cyclin D3 and PPAR{gamma} expression in 3T3-L1 cells overexpressing cyclin D3 and control cells. (B) Oil Red O micrographs taken from stable 3T3-L1 cells overexpressing cyclin D3 (pcDNA3-cycD3) and control (pcDNA3-) after 4 days of differentiation. (C) Gene induction change of adipogenic markers as measured by quantitative real-time PCR resulting from cyclin D3 overexpression after 4 days of differentiation. (D) Immunofluorescence showing correlation between PPAR{gamma} expression intensity and cyclin D3 in differentiated (day 5) 3T3-L1 cells overexpressing cyclin D3.

Cyclin D3 stimulates PPAR{gamma} transcriptional activity. In light of our above observation showing coexpression of cyclin D3 and PPAR{gamma} in the same cells (Fig. 3D), we decided to explore a potential functional relationship between the two proteins. To test whether cyclin D3's stimulatory role during adipogenesis may be mediated though activation of PPAR{gamma}, we performed cotransfection experiments using a PPAR{gamma}-responsive, luciferase-based reporter construct (PPRE-TK-Luc) and expression vectors for PPAR{gamma}2 and cyclin D3.

A 3.5-fold induction of luciferase activity was observed upon transfection of PPAR{gamma}2 in the presence of the PPAR{gamma} agonist pioglitazone (Fig. 4A). This induction was further enhanced up to 5.5-fold by cotransfection of cyclin D3. Transfection of cyclin D3 alone stimulated the PPAR{gamma} response element over twofold. No effects of either PPAR{gamma} or cyclin D3 were observed on the parental reporter vector TK-Luc. which does not contain a PPRE (Fig. 1A, right panel). No induction of PPRE-TK-Luc was observed after transfecting expression vectors coding for cyclin D1 and D2 (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. Cyclin D3 stimulates PPAR{gamma} transcriptional activity. (A) Activity of the PPRE-TK-Luc reporter carrying the PPAR{gamma} specific response elements measured in Cos cells upon transfecting expression vectors for cyclin D3, PPAR{gamma} or both plasmids together. The experiments were performed in triplicate in the presence or absence of the PPAR{gamma} agonist pioglitazone (10–6M) and were normalized for ß-galactosidase activity. The same transfections were performed using a TK-luc vector which does not contain the PPRE. (B) Knockdown of cyclin D3 by transfection of expression vectors coding for siRNA against cyclin D3 abrogates PPAR{gamma} transcriptional activity.

We next tested whether the cotransfection of expression vectors coding for siRNA against cyclin D3 could attenuate the PPAR{gamma}-mediated luciferase response. Cotransfection of siRNA vector against cyclin D3 reduced PPAR{gamma}-mediated luciferase activation by approximately twofold (Fig. 4B). Together, these results suggest that cyclin D3's stimulatory role during adipogenesis is likely the result of its ability to modulate PPAR{gamma} activity.

Cyclin D3 physically interacts with PPAR{gamma}. To test whether the induction of PPAR{gamma} activity in the presence of cyclin D3 is the consequence of an interaction between PPAR{gamma} and cyclin D3, nuclear extracts from Cos cells transfected with cyclin D3 and PPAR{gamma} expression vectors were immunoprecipitated with an anti-PPAR{gamma} antibody. A 33-kDa protein was recognized by a cyclin D3 antibody, indicating that cyclin D3 is associated with PPAR{gamma} (Fig. 5A, top panel). We performed the same immunoprecipitation on endogenous PPAR{gamma} from differentiated 3T3 L1 cells (day 5) and also revealed an association between the two proteins (Fig. 5A, bottom panel).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 5. Cyclin D3 interacts with PPAR{gamma}. (A) Coimmunoprecipitation of PPAR{gamma} and cyclin D3 from Cos cells transfected with the expression vectors for both proteins (top panel) and in 5-day differentiated 3T3-L1 cells (bottom panel). Whole-cell extracts were immunoprecipitated with either PPAR{gamma} or mock immunoprecipitated (no antibody) and blots were revealed by an anti-cyclin D3 antibody. (B) GST pull-down assay showing details of the PPAR{gamma}-cyclin D3 interaction. In vitro-translated 35S-radiolabeled cyclin D3 protein was incubated with GST-PPAR{gamma} AB (residues 1 to 146), b-AB (contains an additional 30 amino acids specific for the PPAR{gamma} 2 transcript), GST-PPAR{gamma} DEF (residues 203 to 477), and GST alone. (C) The same experiment was performed using the DEF domain in the presence and absence of rosiglitazone, 10–6 M. (D) GST pull-down between GST-cyclin D3 and full-length, in vitro-translated 35S-radiolabeled PPAR{gamma} protein in the presence and absence of rosiglitazone 10–6M. (E) GST-wild-type cyclin D3 (WTD3), deletion, and point mutants were constructed and tested for their ability to bind full-length recombinant PPAR{gamma}. After washing the beads, PPAR{gamma} was revealed by Western blot. (F) Chromatin immunoprecipitation assays demonstrating binding of cyclin D3 to the region of the aP2 promoter carrying the PPAR{gamma}-responsive element. Cross-linked chromatin from either confluent (top panel) or 5-day-differentiated 3T3-L1 cells (middle panel) was incubated with antibodies against PPAR{gamma}, cyclin D3, or nonspecific antibody (mock). Immunoprecipitates were analyzed by PCR using primers specific for the mouse aP2 promoter containing the PPRE and by primers amplifying a region outside the PPRE (negative control). A sample representing 0.1% of total chromatin was included in the PCR (Input). (G) The same experiment was performed on NIH 3T3 cells transfected or not with PPAR{gamma}.

To identify the PPAR{gamma} domain responsible for the interaction with cyclin D3, GST-PPAR{gamma} DEF, AB, and b-AB (where "b" contains an additional 30-amino-acid subunit specific to the PPAR{gamma}2 transcript) fusion proteins were incubated with in vitro-translated 35S-radiolabeled cyclin D3. We found that cyclin D3 binds to all three constructs of PPAR{gamma} (Fig. 5B).

Next, to see if the association between cyclin D3 and the DEF construct of PPAR{gamma}, which contains the ligand binding region of the receptor could depend on ligand, we performed the same pull-down assay in the presence and absence of the PPAR{gamma} ligand rosiglitazone. Interestingly, we observed a strong enhancement of the interaction between cyclin D3 and the DEF-PPAR{gamma} construct in the presence of rosiglitazone (Fig. 5C). To see if the ligand-dependent interaction between cyclin D3 and PPAR{gamma} DEF could also be observed using full-length PPAR{gamma}, we incubated GST-cyclin D3 with full-length in vitro-translated 35S radiolabeled PPAR{gamma}. We observed no interaction enhancement between cyclin D3 and PPAR{gamma} in the presence of ligand, (Fig. 5D), possibly due to the masking of the ligand-dependent effect by the additional contribution of the AB domain.

We next set out to identify the region of cyclin D3 responsible for the interaction with PPAR{gamma}. Upon amino acid sequence screening of cyclin D3, we identified two LXXLL nuclear receptor interaction motifs located at the N- and C-terminal regions of the transcript (Fig. 5E). To test the contribution of these LXXLL motifs on the interaction with PPAR{gamma}, we performed site-specific mutagenesis, converting the second L to I, and performed GST pull-down with purified full-length PPAR{gamma}. Despite mutations of both LXXLL sites, the interaction with PPAR{gamma} was not disrupted, indicating that these sites do not contribute to the interaction with PPAR{gamma} (Fig. 5E, lane 4). Next, we created two deletion mutants of cyclin D3, {Delta}1-149, which lacks the cyclin box (CDK binding unit), and deletion mutant {Delta}148-293. GST pull-down assays reveal that amino acids 1 to 149 of cyclin D3 are required for the interaction with PPAR{gamma} (Fig. 5E).

To demonstrate that cyclin D3 could regulate the expression of PPAR{gamma} target genes in vivo, we performed chromatin immunoprecipitation experiments on differentiating 3T3-L1 cells. As expected, when chromatin of cells after 5 days of differentiation was immunoprecipitated with an anti-PPAR{gamma} antibody, we observed amplification of the region of the aP2 promoter containing the PPAR{gamma} response element (PPRE). Immunoprecipitation of cyclin D3 in the same conditions also resulted in amplification of the aP2 promoter (Fig. 5F, center panel). No amplification of the aP2 promoter was observed when either PPAR{gamma} or cyclin D3 was immunoprecipitated from confluent, undifferentiated 3T3-Ll cells, which do not express PPAR{gamma} or cyclin D3 (Fig. 5F, top panel). Binding of cyclin D3 and PPAR{gamma} was specific to the PPAR{gamma} binding site of the aP2 enhancer, since no amplification of a promoter region located outside the PPRE was observed (Fig. 5F, bottom panel).

To determine if the recruitment of cyclin D3 to PPAR{gamma} target genes is dependent on the presence of PPAR{gamma}, we performed additional chromatin immunoprecipitation experiments on NIH 3T3 cells, which do not express PPAR{gamma}, transfected or not with PPAR{gamma}2. We show that cyclin D3 is targeted to the PPRE of the aP2 promoter only when PPAR{gamma} is introduced into the cells by transfection (Fig. 5G). The recruitment of cyclin D3 to the aP2 promoter was, however, not found to depend on ligand (data not shown). The results of these chromatin immunoprecipitation assays demonstrate that cyclin D3 is recruited to the promoter of PPAR{gamma} target genes during adipogenesis and that this recruitment is dependent on the presence of PPAR{gamma}.

Cyclin D3/CDK6 complex phosphorylates PPAR{gamma}. Because cyclin D3, together with its cyclin-dependent kinase partners CDK 4 and 6, constitutes an active kinase that phosphorylates retinoblastoma protein during the cell cycle, we wanted to investigate whether cyclin D3 could also participate in PPAR{gamma} phosphorylation. To test this hypothesis, we performed in vitro kinase assays using an active cyclin D3/CDK6 kinase complex and purified PPAR{gamma} protein as the substrate. Kinase assays resulted in the appearance of a 60-kDa band corresponding to the size of recombinant PPAR{gamma}t (Fig. 6A, lane 3). As a control, the kinase assay was performed in the absence of active kinase and in the absence of PPAR{gamma} (Fig. 6A, lanes 1 and 2, respectively).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6. Cyclin D3/CDK6 phosphorylates PPAR{gamma}. (A) In vitro kinase assay showing phosphorylation of purified full-length PPAR{gamma} by cyclin D3/CDK6 complex (lane 3). As a control, assays were performed in the absence of PPAR{gamma} (lane 1) or cyclin D3/CDK6 (lane 2). (B) The same kinase assay was performed using PPAR{gamma}-AB and DEF domain fusion proteins. (C) Activity of the UAS-TK-Luc reporter carrying the Gal4-specific response element measured in Cos cells upon transfecting expression vectors for cyclin D3, and chimeric Gal4-PPAR{gamma} containing a Gal4 DNA-binding domain and lacking the AB domain. The experiments were performed in triplicate in the presence or absence of the PPAR{gamma} agonist pioglitazone and were normalized for ß-galactosidase activity. (D) Chromatin immunoprecipitation assays showing association of CDK6 with the PPRE of the aP2 promoter in differentiated 3T3-L1 cells (day 5). Cross-linked chromatin was incubated with antibodies against PPAR{gamma}, cyclin D3, CDK6, or nonspecific antibody (mock). Immunoprecipitates were analyzed by PCR using primers specific for the mouse aP2 promoter containing the PPRE and by primers amplifying a region outside the PPRE (negative control). A sample representing 0.1% of total chromatin was included in the PCR (Input).

Next, to investigate which domain of PPAR{gamma} is phosphorylated by cyclin D3/CDK6, we performed the same kinase assays on GST-PPAR{gamma} DEF and AB domains. The AB domain but not the DEF domain was found to be phosphorylated by cyclin D3/CDK6 (Fig. 6B). To further investigate the functional significance of the PPAR{gamma}-AB domain in the activation by cyclin D3, we performed cotransfection experiments using a chimeric Gal4-PPAR{gamma} lacking the AB domain whose activity is measured via the UAS-TK-Luc reporter construct. As expected, when chimeric Gal4-PPAR{gamma} was introduced into the system in the presence of ligand, a strong induction of luciferase activity was observed. However, unlike experiments performed with full-length PPAR{gamma}, cotransfection of cyclin D3 with PPAR{gamma} failed to increase the luciferase response (Fig. 6C). These results suggest that the AB domain of PPAR{gamma} is important for its activation by cyclin D3, possibly due the presence of important phosphorylation sites.

Next, to see if CDK6 could associate on the PPRE of the aP2 promoter and, thereby, contribute to the adipogenic process, we performed chromatin immunoprecipitation assays of CDK6 on differentiated 3T3-L1 cells. PCR analysis of CDK6 immunoprecipitations confirmed its presence on the PPRE of the aP2 promoter (Fig. 6D), further suggesting a role for CDK6 during adipogenesis.

Cyclin D3 null mice display a compromised adipose tissue phenotype. We have shown that cyclin D3 and PPAR{gamma} are expressed during the same time in the differentiation process and that cyclin D3 binds PPAR{gamma} and activates its transcriptional potential. To determine whether the activating effect of cyclin D3 could apply to in vivo models, we analyzed the adipose tissue phenotype of cyclin D3 mutant mice. Cyclin D3 mutant mice showed normal weight gain and initial examination of fat tissue mass revealed no significant differences in weight between cyclin D3 mutant and wild-type mice (data not shown and Fig. 7A).



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 7. Analysis of adipose tissue phenotype in cyclin D3-deficient mice. (A) Epididymal fat pad weight relative to total body weight for cyclin D3 mutant and wild-type mice. (B and C) Histological analysis of epididymal white adipose tissue (WAT) from cyclin D3 mutant and wild-type mice and corresponding histograms of adipocyte cell size. (D) Gene expression profiles of pertinent adipogenic genes from white adipose tissue measured by quantitative real-time PCR. (E) Weight gain curves for cyclin D3 mutant and wild-type mice fed a lipid-rich diet for 8 weeks. Each group was composed of six animals weighed on a weekly basis. Weight gain is adjusted to total initial body weight. (F) Fasting plasma glucose levels in cyclin D3 mutant and wild-type mice. (G) The intraperitoneal glucose tolerance test (IPGTT) measuring glucose levels at different times after intraperitoneal injection of glucose in cyclin D3 mutant and wild-type mice. (H) Glucose clearance after intraperitoneal injection of insulin (0.75 IU/kg) as a measure of insulin sensitivity in cyclin D3 mutant and wild-type mice.

Histological analysis of epididymal fat pads showed that adipocytes from cyclin D3 mutant mice were significantly smaller than wild-type mice (Fig. 7B and 7C), suggesting that cyclin D3 is important for normal adipocyte differentiation. Interestingly, this difference was observed in mice at 5 months of age but was absent in 3-month-old mice whose adipocytes were still of premature size in both the cyclin D3 mutant and wild-type groups (data not shown). Gene expression analysis of white adipose tissue taken from 5-month-old mice demonstrated a marked decrease in adipogenic markers aP2, LPL, and PPAR{gamma} (Fig. 7D).

We next analyzed the effect of challenging cyclin D3mutant mice with a high-fat diet. After feeding the mice a lipid-rich diet for 8 weeks, we observed a 30% decrease in weight gain in cyclin D3 mutant mice compared to their wild-type littermates (Fig. 7E). Because adipocyte size is also known to affect glucose homeostasis, we measured both glucose tolerance and insulin sensitivity in cyclin D3 mutant mice. Initial glucose measurements indicated that cyclin D3 mutant mice have a 30% decrease in fasting glucose levels (Fig. 7F). The intraperitoneal glucose tolerance test revealed that cyclin D3 mutants cleared glucose more efficiently than wild-type mice (Fig. 7G). Consistent with this observation, glucose decreased over two times more efficiently in cyclin D3 mutant compared to wild-type mice after insulin injection, indicating that the absence of cyclin D3 improves insulin sensitivity (Fig. 7H). Taken together, these in vivo studies confirm our in vitro data and suggest a crucial role for cyclin D3 in adipose tissue development.


arrow
DISCUSSION
 
The results presented in this study establish a new role for cyclin D3 as a PPAR{gamma} cofactor. We show that cyclin D3 is preferentially expressed in adipose tissue and that its expression is strongly induced during terminal stages of 3T3-L1 adipogenesis. We have identified cyclin D3 as a PPAR{gamma} coactivator capable of phosphorylating its AB domain. The essential role that cyclin D3 plays during adipogenesis was highlighted by the observation that silencing its expression strongly inhibited adipogenesis, whereas its overexpression promoted adipogenesis. Finally, we show that cyclin D3 mutant mice have a compromised adipose tissue phenotype. Our finding that cyclin D3 mutant mice display reduced adipocyte size, stunted adipogenic gene expression, resistance to high-fat weight gain, and insulin sensitivity is reminiscent of the phenotype observed in PPAR{gamma}+/– mice (21). This observation is consistent with the hypothesis that the phenotype observed in cyclin D3 mutant mice is due to reduced PPAR{gamma} activity.

Over 20 years ago, it was discovered how the ability of cyclins to bind and induce their CDK partners was dependent on their fluctuating expression pattern during the cell cycle (7). Here we show that the ability of cyclin D3 to bind PPAR{gamma} and help drive adipogenesis is also dependent on its differential expression pattern during adipogenesis. Strikingly, the stimulatory function of cyclin D3 during adipogenesis seems to fall deliberately outside its cell cycle role, as evidenced by its protein expression pattern; cyclin D3 is almost undetectable during the mitotic clonal expansion phase of adipogenesis, and then its expression is strongly induced during the noncycling terminal differentiation stage. Interestingly, an up-regulation of cyclin D3 expression has also been documented in other differentiation processes, including hematopoiesis (12, 26) and colon development (3); incidentally, PPAR{gamma} is also strongly induced during the latter (23). In the present study, we not only demonstrate an up-regulation of cyclin D3 during adipocyte differentiation but also identify PPAR{gamma} as a functional partner through which cyclin D3 mediates its proadipogenic effects.

The stimulatory effects of cyclin D3 on PPAR{gamma} could be the direct result of phosphorylation of PPAR{gamma} (Fig. 4C). Regulation of PPAR{gamma} activity by phosphorylation has already been documented. While some studies have linked PPAR{gamma} phosphorylation with its activation (2), others have shown PPAR{gamma} phosphorylation inhibits its activity, as is the case with mitogen-activated protein kinase-mediated phosphorylation (16). Other cyclin/CDK complexes are able to phosphorylate nuclear receptors. This includes cyclin A/CDK2-driven phosphorylation and activation of the estrogen receptor alpha (36), the progesterone receptor (46), and the glucocorticoid receptor (20).

The notion that cyclin D3 functions as a PPAR{gamma} coactivator during adipogenesis is not completely unexpected. Several studies have emerged showing regulation of nuclear receptor biology by D-type cyclins. Cyclin D1 can activate estrogen receptor alpha transcription through a direct interaction with the ligand binding domain of the receptor (47). On the other hand, cyclin D1 was shown to repress transcriptional activity of the thyroid hormone receptor (24) and the androgen receptor (31). Moreover, cyclin D1 can interact with several cofactors, including SRC1 (47), P/CAF (27), histone deacetylase 3 (24, 31), and TAF250 (1). While less well explored, cyclin D3 has also been implicated in the regulation of nuclear receptors including activation of the retinoic acid receptor (5). In addition, cyclin D3 can bind the SRC family coactivator GRIP-1, thereby disrupting its association with transcriptional regulators (22).

Recently, Pestell and colleagues reported that cyclin D1 represses PPAR{gamma} expression (45). In addition to inhibiting PPAR{gamma} promoter activity, they show that cyclin D1 retards adipogenesis and correlate this block with reduced PPAR{gamma} expression and activity. Remarkably they show that mouse embryo fibroblasts from cyclin D1 mutant mice have elevated levels of PPAR{gamma} even prior to inducing differentiation. Our laboratory and others have observed cyclin D1 expression to rapidly decrease after the mitotic clonal expansion phase of 3T3-L1 differentiation (32) (data not shown), consistent with the finding that PPAR{gamma} inhibits cyclin D1 expression (44).

Together, this information has allowed us to develop a model for how D-type cyclins orchestrate the molecular events taking place during adipocyte differentiation. Before adipogenesis is induced and immediately after its induction, elevated levels of cyclin D1 block immature expression of PPAR{gamma}. After a couple of rounds of mitotic clonal expansion, cyclin D1 levels rapidly shoot down, releasing its inhibitory effect on PPAR{gamma} expression and poising the cell for terminal differentiation. Once PPAR{gamma} protein is induced, cyclin D3 expression is increased, allowing it to bind and activate PPAR{gamma}. Such a model is dependent on the timely expression of both cyclin D1 and D3 and highlights their distinctive cell cycle-independent roles during adipogenesis.

In the present study we have established a link between the cell cycle machinery and adipogenesis. The metabolic response needed for growth and/or calorie storage is under the direct control of extracellular nutrients, growth factors, and hormones. Growth stimuli, including glucose, insulin, and glucocorticoids, are known to have an immediate mitogenic effect, however, the pathways by which these nutrients initiate the metabolic response are poorly understood. Here, we shed new light on this question by showing how cyclin D3 can functionally bind and activate the master regulator of adipogenesis, PPAR{gamma}. Thus, we propose cyclin D3 as a type of metabolic sensor linking external nutritional stimuli with the metabolic growth response.


arrow
ACKNOWLEDGMENTS
 
Jacques Teyssier is acknowledged for his technical assistance. We thank P. Sicinski for providing the cyclin D3 knockout mice and E. Sicinska and J. S. Annicotte for their helpful support and discussion.

This work was supported by grants from INSERM (Avenir), FRM, Alfediam, and ARC. Anna Abella is supported by an Inserm Poste Vert grant, and Irena Iankova is supported by La Ligue National Contre le Cancer Ph.D. fellowship. David Sarruf is supported by the Boehringer Ingelheim Fonds Ph.D. scholarship program.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: INSERM, U540 Equipe Avenir, 60, rue de Navacelles. 34090 Montpellier, France. Phone: 33(0)4 67 04 30 82. Fax: 33 (0)4 67 54 05 98. E-mail: fajas{at}montp.inserm.fr. Back

{dagger} These authors contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Adnane, J., Z. Shao, and P. D. Robbins. 1999. Cyclin D1 associates with the TBP-associated factor TAF(II)250 to regulate Sp1-mediated transcription. Oncogene 18:239-247.[CrossRef][Medline]
  2. 2
  3. Al-Rasheed, N. M., R. S. Chana, R. J. Baines, G. B. Willars, and N. J. Brunskill. 2004. Ligand-independent activation of peroxisome proliferator-activated receptor-gamma by insulin and C-peptide in kidney proximal tubular cells: dependent on phosphatidylinositol 3-kinase activity. J. Biol. Chem. 279:49747-49754.[Abstract/Free Full Text]
  4. 3
  5. Bartkova, J., M. Thullberg, P. Slezak, E. Jaramillo, C. Rubio, L. H. Thomassen, and J. Bartek. 2001. Aberrant expression of G1-phase cell cycle regulators in flat and exophytic adenomas of the human colon. Gastroenterology 120:1680-1688.[CrossRef][Medline]
  6. 4
  7. Bates, S., D. Parry, L. Bonetta, K. Vousden, C. Dickson, and G. Peters. 1994. Absence of cyclin D/cdk complexes in cells lacking functional retinoblastoma protein. Oncogene 9:1633-1640.[Medline]
  8. 5
  9. Despouy, G., J. N. Bastie, S. Deshaies, N. Balitrand, A. Mazharian, C. Rochette-Egly, C. Chomienne, and L. Delva. 2003. Cyclin D3 is a cofactor of retinoic acid receptors, modulating their activity in the presence of cellular retinoic acid-binding protein II. J. Biol. Chem. 278:6355-6362.[Abstract/Free Full Text]
  10. 6
  11. Dyson, N. 1998. The regulation of E2F by pRB-family proteins. Genes Dev. 12:2245-2262.[Free Full Text]
  12. 7
  13. Evans, T., E. T. Rosenthal, J. Youngblom, D. Distel, and T. Hunt. 1983. Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell 33:389-396.[CrossRef][Medline]
  14. 8
  15. Fajas, L., M. B. Debril, and J. Auwerx. 2001. Peroxisome proliferator-activated receptor-gamma: from adipogenesis to carcinogenesis. J. Mol. Endocrinol. 27:1-9.[Abstract]
  16. 9
  17. Fajas, L., V. Egler, R. Reiter, J. Hansen, K. Kristiansen, S. Miard, and J. Auwerx. 2002. The retinoblastoma-histone deacetylase 3 complex inhibits the peroxisome proliferator-activated receptor gamma and adipocyte differentiation. Dev. Cell. 3:903-910.[CrossRef][Medline]
  18. 10
  19. Fajas, L., J. C. Fruchart, and J. Auwerx. 1998. Transcriptional control of adipogenesis. Curr. Opin. Cell Biol. 10:165-173.[CrossRef][Medline]
  20. 11
  21. Fajas, L., R. L. Landsberg, Y. Huss-Garcia, C. Sardet, J. A. Lees, and J. Auwerx. 2002. E2Fs regulate adipogenesis. Dev. Cell. 3:39-49.[CrossRef][Medline]
  22. 12
  23. Furukawa, Y., J. Kikuchi, M. Nakamura, S. Iwase, H. Yamada, and M. Matsuda. 2000. Lineage-specific regulation of cell cycle control gene expression during haematopoietic cell differentiation. Br. J. Haematol. 110:663-673.[CrossRef][Medline]
  24. 13
  25. Gelman, L., G. Zhou, L. Fajas, E. Raspe, J. C. Fruchart, and J. Auwerx. 1999. p300 interacts with the N- and C-terminal part of PPARgamma2 in a ligand-independent and -dependent manner, respectively. J. Biol. Chem. 274:7681-7688.[Abstract/Free Full Text]
  26. 14
  27. Green, H., and O. Kehinde. 1975. An established preadipose cell line and its differentiation in culture II. Factors affecting adipose conversion. Cell 5:19-27.[CrossRef][Medline]
  28. 15
  29. Horstmann, S., S. Ferrari, and K. H. Klempnauer. 2000. Regulation of B-Myb activity by cyclin D1. Oncogene 19:298-306.[CrossRef][Medline]
  30. 16
  31. Hu, E., J. B. Kim, P. Sarraf, and B. M. Spiegelman. 1996. Inhibition of adipogenesis through MAP-kinase mediated phosphorylation of PPAR{gamma}. Science 274:2100-2103.[Abstract/Free Full Text]
  32. 17
  33. Inoue, K., and C. J. Sherr. 1998. Gene expression and cell cycle arrest mediated by transcription factor DMP1 is antagonized by D-type cyclins through a cyclin-dependent-kinase-independent mechanism. Mol. Cell. Biol. 18:1590-1600.[Abstract/Free Full Text]
  34. 18
  35. Kato, J. Y., M. Matsuoka, D. K. Strom, and C. J. Sherr. 1994. Regulation of cyclin D-dependent kinase 4 (cdk4) by cdk4-activating kinase. Mol. Cell. Biol. 14:2713-2721.[Abstract/Free Full Text]
  36. 19
  37. Kato, J. Y., and C. J. Sherr. 1993. Inhibition of granulocyte differentiation by G1 cyclins D2 and D3 but not D1. Proc. Natl. Acad. Sci. USA 90:11513-11517.[Abstract/Free Full Text]
  38. 20
  39. Krstic, M. D., I. Rogatsky, K. R. Yamamoto, and M. J. Garabedian. 1997. Mitogen-activated and cyclin-dependent protein kinases selectively and differentially modulate transcriptional enhancement by the glucocorticoid receptor. Mol. Cell. Biol. 17:3947-3954.[Abstract]
  40. 21
  41. Kubota, N., Y. Terauchi, H. Miki, H. Tamemoto, T. Yamauchi, K. Komeda, S. Satoh, R. Nakano, C. Ishii, T. Sugiyama, K. Eto, Y. Tsubamoto, A. Okuno, K. Murakami, H. Sekihara, G. Hasegawa, M. Naito, Y. Toyoshima, S. Tanaka, K. Shiota, T. Kitamura, T. Fujita, O. Ezaki, S. Aizawa, R. Nagai, K. Tobe, S. Kimura, and T. Kadowaki. 1999. PPARg mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell. 4:597-609.[CrossRef][Medline]
  42. 22
  43. Lazaro, J. B., P. J. Bailey, and A. B. Lassar. 2002. Cyclin D-cdk4 activity modulates the subnuclear localization and interaction of MEF2 with SRC-family coactivators during skeletal muscle differentiation. Genes Dev. 16:1792-1805.[Abstract/Free Full Text]
  44. 23
  45. Lefebvre, A. M., B. Paulweber, L. Fajas, J. Woods, C. McCrary, J.-F. Colombel, J. Najib, J.-C. Fruchart, C. Datz, H. Vidal, P. Desreumaux, and J. Auwerx. 1999. Peroxisome proliferator-activated receptor gamma is induced during differentiation of colon epithelium cells. J. Endocrinol. 162:331-340.[Abstract]
  46. 24
  47. Lin, H. M., L. Zhao, and S. Y. Cheng. 2002. Cyclin D1 is a ligand-independent co-repressor for thyroid hormone receptors. J. Biol. Chem. 277:28733-28741.[Abstract/Free Full Text]
  48. 25
  49. Liu, W., M. Sun, J. Jiang, X. Shen, Q. Sun, H. Shen, and J. Gu. 2004. Cyclin D3 interacts with human activating transcription factor 5 and potentiates its transcription activity. Biochem. Biophys. Res. Commun. 321:954-960.[CrossRef][Medline]
  50. 26
  51. Matsumura, I., H. Tanaka, A. Kawasaki, J. Odajima, H. Daino, K. Hashimoto, H. Wakao, K. Nakajima, T. Kato, H. Miyazaki, and Y. Kanakura. 2000. Increased D-type cyclin expression together with decreased cdc2 activity confers megakaryocytic differentiation of a human thrombopoietin-dependent hematopoietic cell line. J. Biol. Chem. 275:5553-5559.[Abstract/Free Full Text]
  52. 27
  53. McMahon, C., T. Suthiphongchai, J. DiRenzo, and M. E. Ewen. 1999. P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc. Natl. Acad. Sci. USA 96:5382-5387.[Abstract/Free Full Text]
  54. 28
  55. Meyerson, M., and E. Harlow. 1994. Identification of G1 kinase activity for cdk6, a novel cyclin D partner. Mol. Cell. Biol. 14:2077-2086.[Abstract/Free Full Text]
  56. 29
  57. Morrison, R. F., and S. R. Farmer. 1999. Role of PPARgamma in regulating a cascade expression of cyclin-dependent kinase inhibitors, p18(INK4c) and p21(Waf1/Cip1), during adipogenesis. J. Biol. Chem. 274:17088-17097.[Abstract/Free Full Text]
  58. 30
  59. Naaz, A., D. R. Holsberger, G. A. Iwamoto, A. Nelson, H. Kiyokawa, and P. S. Cooke. 2004. Loss of cyclin-dependent kinase inhibitors produces adipocyte hyperplasia and obesity. FASEB J. 18:1925-1927.[Abstract/Free Full Text]
  60. 31
  61. Petre, C. E., Y. B. Wetherill, M. Danielsen, and K. E. Knudsen. 2002. Cyclin D1: mechanism and consequence of androgen receptor co-repressor activity. J. Biol. Chem. 277:2207-2215.[Abstract/Free Full Text]
  62. 32
  63. Phelps, D. E., and Y. Xiong. 1998. Regulation of cyclin-dependent kinase 4 during adipogenesis involves switching of cyclin D subunits and concurrent binding of p18INK4c and p27Kip1. Cell Growth Differ. 9:595-610.[Abstract]
  64. 33
  65. Picard, F., M. Wanatabe, K. Schoonjans, J. Lydon, B. W. O'Malley, and J. Auwerx. 2002. Progesterone receptor knockout mice have an improved glucose homeostasis secondary to beta-cell proliferation. Proc. Natl. Acad. Sci. USA 99:15644-15648.[Abstract/Free Full Text]
  66. 34
  67. Rao, S. S., C. Chu, and D. S. Kohtz. 1994. Ectopic expression of cyclin D1 prevents activation of gene transcription by myogenic basic helix-loop-helix regulators. Mol. Cell. Biol. 14:5259-5267.[Abstract/Free Full Text]
  68. 35
  69. Rocchi, S., F. Picard, J. Vamecq, L. Gelman, N. Potier, D. Zeyer, L. Dubuquoy, P. Bac, M. F. Champy, K. D. Plunket, L. M. Leesnitzer, S. G. Blanchard, P. Desreumaux, D. Moras, J. P. Renaud, and J. Auwerx. 2001. A unique PPARgamma ligand with potent insulin-sensitizing yet weak adipogenic activity. Mol. Cell. 8:737-747.[CrossRef][Medline]
  70. 36
  71. Rogatsky, I., J. M. Trowbridge, and M. J. Garabedian. 1999. Potentiation of human estrogen receptor alpha transcriptional activation through phosphorylation of serines 104 and 106 by the cyclin A-CDK2 complex. J. Biol. Chem. 274:22296-22302.[Abstract/Free Full Text]
  72. 37
  73. Rosen, E. D., C. J. Walkey, P. Puigserver, and B. M. Spiegelman. 2000. Transcriptional regulation of adipogenesis. Genes Dev. 14:1293-1307.[Free Full Text]
  74. 38
  75. Schoonjans, K., B. Staels, and J. Auwerx. 1996. The peroxisome proliferator activated receptors (PPARs) and their effects on lipid metabolism and adipocyte differentiation. Biochim. Biophys. Acta 1302:93-109.[Medline]
  76. 39
  77. Sicinska, E., I. Aifantis, L. Le Cam, W. Swat, C. Borowski, Q. Yu, A. A. Ferrando, S. D. Levin, Y. Geng, H. von Boehmer, and P. Sicinski. 2003. Requirement for cyclin D3 in lymphocyte development and T cell leukemias. Cancer Cell 4:451-461.[CrossRef][Medline]
  78. 40
  79. Skapek, S. X., J. Rhee, D. B. Spicer, and A. B. Lassar. 1995. Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase. Science 267:1022-1024.[Abstract/Free Full Text]
  80. 41
  81. Tang, Q. Q., T. C. Otto, and M. D. Lane. 2003. Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. USA 100:44-49.[Abstract/Free Full Text]
  82. 42
  83. Tontonoz, P., E. Hu, R. A. Graves, A. I. Budavari, and B. M. Spiegelman. 1994. mPPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Genes Dev. 8:1224-1234.[Abstract/Free Full Text]
  84. 43
  85. Tontonoz, P., E. Hu, and B. M. Spiegelman. 1994. Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147-1156.[CrossRef][Medline]
  86. 44
  87. Wang, C., M. Fu, M. D'Amico, C. Albanese, J. N. Zhou, M. Brownlee, M. P. Lisanti, V. K. Chatterjee, M. A. Lazar, and R. G. Pestell. 2001. Inhibition of cellular proliferation through IkappaB kinase-independent and peroxisome proliferator-activated receptor gamma-dependent repression of cyclin D1. Mol. Cell. Biol. 21:3057-3070.[Abstract/Free Full Text]
  88. 45
  89. Wang, C., N. Pattabiraman, J. N. Zhou, M. Fu, T. Sakamaki, C. Albanese, Z. Li, K. Wu, J. Hulit, P. Neumeister, P. M. Novikoff, M. Brownlee, P. E. Scherer, J. G. Jones, K. D. Whitney, L. A. Donehower, E. L. Harris, T. Rohan, D. C. Johns, and R. G. Pestell. 2003. Cyclin D1 repression of peroxisome proliferator-activated receptor gamma expression and transactivation. Mol. Cell. Biol. 23:6159-6173.[Abstract/Free Full Text]
  90. 46
  91. Zhang, Y., C. A. Beck, A. Poletti, J. P. t. Clement, P. Prendergast, T. T. Yip, T. W. Hutchens, D. P. Edwards, and N. L. Weigel. 1997. Phosphorylation of human progesterone receptor by cyclin-dependent kinase 2 on three sites that are authentic basal phosphorylation sites in vivo. Mol. Endocrinol. 11:823-832.[Abstract/Free Full Text]
  92. 47
  93. Zwijsen, R. M., E. Wientjens, R. Klompmaker, J. van der Sman, R. Bernards, and R. J. Michalides. 1997. CDK-independent activation of estrogen receptor by cyclin D1. Cell 88:405-415.[CrossRef][Medline]


Molecular and Cellular Biology, November 2005, p. 9985-9995, Vol. 25, No. 22
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.22.9985-9995.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Nadaf, J., Pitel, F., Gilbert, H., Duclos, M. J., Vignoles, F., Beaumont, C., Vignal, A., Porter, T. E., Cogburn, L. A., Aggrey, S. E., Simon, J., Le Bihan-Duval, E. (2009). QTL for several metabolic traits map to loci controlling growth and body composition in an F2 intercross between high- and low-growth chicken lines. Physiol. Genomics 38: 241-249 [Abstract] [Full Text]  
  • Jin, J., Wang, G.-L., Shi, X., Darlington, G. J., Timchenko, N. A. (2009). The Age-Associated Decline of Glycogen Synthase Kinase 3{beta} Plays a Critical Role in the Inhibition of Liver Regeneration. Mol. Cell. Biol. 29: 3867-3880 [Abstract] [Full Text]  
  • Araujo-Vilar, D, Lattanzi, G, Gonzalez-Mendez, B, Costa-Freitas, A T, Prieto, D, Columbaro, M, Mattioli, E, Victoria, B, Martinez-Sanchez, N, Ramazanova, A, Fraga, M, Beiras, A, Forteza, J, Dominguez-Gerpe, L, Calvo, C, Lado-Abeal, J (2009). Site-dependent differences in both prelamin A and adipogenic genes in subcutaneous adipose tissue of patients with type 2 familial partial lipodystrophy. J. Med. Genet. 46: 40-48 [Abstract] [Full Text]  
  • Ikeda, D., Sakaue, S., Kamigaki, M., Ohira, H., Itoh, N., Ohtsuka, Y., Tsujino, I., Nishimura, M. (2008). Knockdown of Macrophage Migration Inhibitory Factor Disrupts Adipogenesis in 3T3-L1 Cells. Endocrinology 149: 6037-6042 [Abstract] [Full Text]  
  • Bai, P., Houten, S. M., Huber, A., Schreiber, V., Watanabe, M., Kiss, B., de Murcia, G., Auwerx, J., Murcia, J. M.-d. (2007). Peroxisome Proliferator-activated Receptor (PPAR)-2 Controls Adipocyte Differentiation and Adipose Tissue Function through the Regulation of the Activity of the Retinoid X Receptor/PPAR{gamma} Heterodimer. J. Biol. Chem. 282: 37738-37746 [Abstract] [Full Text]  
  • De Santa, F., Albini, S., Mezzaroma, E., Baron, L., Felsani, A., Caruso, M. (2007). pRb-Dependent Cyclin D3 Protein Stabilization Is Required for Myogenic Differentiation. Mol. Cell. Biol. 27: 7248-7265 [Abstract] [Full Text]  
  • Dragunow, M., Cameron, R., Narayan, P., O'Carroll, S. (2007). Image-Based High-Throughput Quantification of Cellular Fat Accumulation. J Biomol Screen 12: 999-1005 [Abstract]  
  • Ertesvag, A., Aasheim, H.-C., Naderi, S., Blomhoff, H. K. (2007). Vitamin A potentiates CpG-mediated memory B-cell proliferation and differentiation: involvement of early activation of p38MAPK. Blood 109: 3865-3872 [Abstract] [Full Text]  
  • Fumoto, T., Yamaguchi, T., Hirose, F., Osumi, T. (2007). Orphan Nuclear Receptor Nur77 Accelerates the Initial Phase of Adipocyte Differentiation in 3T3-L1 Cells by Promoting Mitotic Clonal Expansion. J Biochem 141: 181-192 [Abstract] [Full Text]  
  • Annicotte, J.-S., Iankova, I., Miard, S., Fritz, V., Sarruf, D., Abella, A., Berthe, M.-L., Noel, D., Pillon, A., Iborra, F., Dubus, P., Maudelonde, T., Culine, S., Fajas, L. (2006). Peroxisome Proliferator-Activated Receptor {gamma} Regulates E-Cadherin Expression and Inhibits Growth and Invasion of Prostate Cancer.. Mol. Cell. Biol. 26: 7561-7574 [Abstract] [Full Text]  
  • Wang, G.-L., Shi, X., Salisbury, E., Sun, Y., Albrecht, J. H., Smith, R. G., Timchenko, N. A. (2006). Cyclin D3 Maintains Growth-Inhibitory Activity of C/EBP{alpha} by Stabilizing C/EBP{alpha}-cdk2 and C/EBP{alpha}-Brm Complexes.. Mol. Cell. Biol. 26: 2570-2582 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sarruf, D. A.
Right arrow Articles by Fajas, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sarruf, D. A.
Right arrow Articles by Fajas, L.