Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2005, p. 10454-10464, Vol. 25, No. 23
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.23.10454-10464.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
MRC Protein Phosphorylation Unit, School of Life Sciences, University of Dundee, Dundee, Scotland DD1 5EH, United Kingdom,1 Division of Immunology and Cell Biology, School of Life Sciences, University of Dundee, Dundee, Scotland DD1 5EH, United Kingdom,2 School of Life Sciences, University of Dundee, Dundee, Scotland DD1 5EH, United Kingdom,3 Institute of Immunology, Biomedical Sciences Research Centre Al. Fleming, Vari 162-72, Greece4
Received 27 July 2005/ Accepted 23 August 2005
|
|
|---|
and p38ß MAPKs have shown potential for the treatment of inflammatory disease. Here we report the generation and initial characterization of a knockout of the p38ß (MAPK11) gene. p38ß/ mice were viable and exhibited no apparent health problems. The expression and activation of p38
, ERK1/2, and JNK in response to cellular stress was normal in embryonic fibroblasts from p38ß/ mice, as was the activation of p38-activated kinases MAPKAP-K2 and MSK1. The transcription of p38-dependent immediate-early genes was also not affected by the knockout of p38ß, suggesting that p38
is the predominant isoform involved in these processes. The p38ß/ mice also showed normal T-cell development. Lipopolysaccharide-induced cytokine production was also normal in the p38ß/ mice. As p38 is activated by tumor necrosis factor, the p38ß/ mice were crossed onto a TNF
ARE mouse line. These mice overexpress tumor necrosis factor, which results in development symptoms similar to rheumatoid arthritis and inflammatory bowel disease. The progression of these diseases was not however moderated by knockout of p38ß. Together these results suggest that p38
, and not p38ß, is the major p38 isoform involved in the immune response and that it would not be necessary to retain activity against p38ß during the development of p38 inhibitors. |
|
|---|
In mammalian cells, four isoforms of the p38 MAPKs have been described, p38
(also referred to as SAPK2a), p38ß (SAPK2b), p38
(SAPK3), and p38
(SAPK4). The p38 MAPKs are activated primarily in response to proinflammatory cytokines and cellular stress such as UV irradiation and osmotic and chemical shock (reviewed in references 43, 47, and 58). Activation of p38 occurs by dual phosphorylation of a Thr-Xaa-Tyr motif, where Xaa is any amino acid, in the p38 kinase domain by an upstream MAPK kinase (MKK). Using MKK knockouts, it has been shown that in response to most stimuli MKK3 and MKK6 are the main MKKs activating p38
, although in some circumstances, such as UV-C stimulation, MKK4 may also play a role (3).
The major MKK required for p38 activation may also be affected by cell type and stimulus, for instance, MKK3 has been shown to be the major p38 activator in mesangial cells stimulated by transforming growth factor beta (53), while MKK6 appears to be the predominant isoform in thymocytes (52). Unlike p38
, the activation of p38 ß,
, and
isoforms has not been extensively examined in MKK knockouts, however, it is probable that MKK6, and possibly MKK3, are required for the activation of these p38 isoforms (9, 10, 18, 38). MKK6 and MKK3 are in turn activated by phosphorylation by a MAPK kinase kinase (MKKK). The MKKK responsible for activating the p38 cascade appears to be cell type and stimulus specific, and several MKKKs have been implicated in the activation of p38. These MKKKs include MLKs, Ask, and Tak (4, 13, 20, 21, 37, 57).
p38 isoforms have been implicated in several processes including cell survival, apoptosis, and immune function (reviewed in references 8, 40, 43, 45, 47, 49, and 58). Much of the information on p38 function comes from the use of the relatively specific p38 inhibitors SB203580 and SB202190, members of a class of pyridinyl imidazoles. These compounds were originally identified as inhibitors that were able to suppress the bacterial lipopolysaccharide (LPS)-induced production of tumor necrosis factor (TNF) and have also been shown to be effective in animal models of chronic inflammatory disease (reviewed in references 29, 31, 32, and 44), findings that have stimulated a considerable amount of work on the role of p38 in the immune system.
SB203580 and SB202190 are able to inhibit both p38
and ß by binding to the ATP binding pocket of the p38 kinase domain and preventing ATP binding. SB203580 and SB202190 are able to bind here in p38
and ß due to the presence of a threonine side chain (Thr106 in p38
) in the ATP binding pocket of these kinases. Other MAPKs, including ERK1/2, p38
, and p38
, are not inhibited by SB203580 and SB202190 due to the presence of a large side chain, such as methionine or glutamine, in the equivalent position in the ATP binding pocket that prevents inhibitor binding (11, 12, 16). While these inhibitors were originally thought to be selective for p38
and ß, some other kinases have also been reported to be inhibited by SB203580 at concentrations similar to or lower than that required to inhibit p38
, including Raf (17), RICK, GAK, and CK1 (14).
While the use of p38 inhibitors has been critical in establishing roles for p38 in cellular function, they have not been able to distinguish between the functions of p38
and ß. One possible way in which this issue could be addressed is through the use of knockout or knockin mice. Knockout of p38
has been reported by four groups. In each case, p38
deficiency was found to result in embryonic lethality, although some variability in the age at which lethality occurred was seen (1, 2, 39, 51). These studies did however reveal a role for p38
in placental development (1, 39) and erythropoietin expression (51). Tetraploid rescue of the placental defect in p38
/ embryos demonstrated that while p38
was essential for extraembryonic development, it was not essential for development of the embryo or survival of the adult mice. Consistent with the phenotype of p38
knockouts, double knockout of the p38 activators MKK 3 and 6 also resulted in embryonic lethality due to placental and vascular defects (3). Single knockouts of MKK 3 and 6 were however found to be viable, although defects in T-cell function and cytokine production were reported (33, 52, 56). Knockouts of p38
or p38
, as well as a double knockout of p38
and
, have however been found to be viable (46). Here we report the generation and initial characterization of a p38ß knockout.
|
|
|---|
and
were generated in house and have been described previously (46). Antibodies against p38
and ß were raised in sheep against the peptides VPPPLDQEEMES and KPLEPSQLPGTHEIEQ, respectively, and the antibodies purified against their respective peptides before use. Generation of p38ß/ mice. Targeting vectors were constructed to generate a deletion of exons 2 to 7 of p38ß, or to introduce an Asp168Ala mutation in the p38ß gene (Fig. 1 and 2). The targeting vector for the knockout consisted of a 1.5-kb 5' arm of homology, neomycin resistance cassette, 5.2-kb 3' arm of homology followed by a thymidine kinase cassette. For the Asp168Ala mutation, the sequence around exons 2 to 7 was generated by PCR and mutated using the QuikChange PCR mutagenesis system (Stratagene) and inserted in the knockout vector. Arms of homology were generated by PCR using the primers CTGAGATGGGTAGGCTTGTTCTCGCG and CTGGCAGAGAACCGGTGATTCTAGC for the 5' arm, TCATGCCTCTTCTCAGGACAGGG and AACGGGCTGCAGGTCTTGGTACACG for the 3' arm, and AGAACGCTTTGTCCACTCAAAGGGG and GGACAGACACCCATCAGCTTAGAAGCC for the region encoding exons 2 to 7. Further details of the cloning can be provided on request. The correct cloning of the targeting vector was confirmed by DNA sequencing.
![]() View larger version (30K): [in a new window] |
FIG. 1. Generation of p38ß kinase-dead knockin mice. To generate p38ß knockin mice a targeting vector was made to introduce an Asp168Ala point mutation in exon 7 of the p38ß/MAPK11 gene (A). This vector was used to target ES cells which were screened for homologous recombination using a probe 3' to the targeting vector. The neomycin resistance cassette was removed from correctly targeted cells by transient expression of CRE recombinase. Removal of the neomycin resistance cassette was confirmed by Southern blotting after EcoRI/SspI digestion of genomic DNA with a probe 5' to the targeting vector. Southern blotting with this probe resulted in a 10.5-kb band for the wild-type locus, and a 3.5-kb band for a correctly targeted p38b locus (B). Heterozygous ES cells were used to generate mice which were genotypes using a PCR-based strategy, described in the Materials and Methods, that generated a 236-bp fragment for the targeted genes and 100-bp fragment for the wild-type gene (C). To analyze expression of the Asp168Ala protein, primary MEF cells were cultured from p38ß+/+, p38ß/ and p38ßki/ki mice. MEF protein lysates were immunoblotted for expression of p38ß (D). To analyze expression of p38ß mRNA in the same cells, total RNA was extracted and p38ß mRNA levels determined by quantitative reverse transcription-PCR using 18s rRNA levels as a loading control. Two primer sets were used, designated p38ß1 (black bars) and p38ß2 (white bars), for which sequences are given in Table 1. Error bars represent the standard error of duplicate assays on three separate plates of cells per genotype (E). To analyze the stability of D168A, C211R, and D168A/C211R mutations of p38ß compared to the wild-type sequence, HA-tagged p38ß was transfected into HeLa cells. Lysates were immunoblotted using an HA tag antibody to detect p38ß, and a ribosomal protein S6 kinase (RSK) antibody as a loading control (F).
|
![]() View larger version (20K): [in a new window] |
FIG. 2. Generation of p38ß knockout mice. To generate p38ß knockout mice a targeting vector was constructed to delete exons 2 to 7 in the p38ß/MAPK11 gene (A). This vector was used to target ES cells which were screened for homologous recombination using a probe 3' to the targeting vector (A). Southern blotting after EcoR1/SspI digestion of genomic DNA with this probe resulted in a 10.5kb band for the wild-type locus, and a 7kb band for a correctly targeted p38ß locus (B). Heterozygous ES cells were used to generate mice which were genotyped using a PCR based strategy, described in the Materials and Methods, that generated a 900-bp fragment for the targeted genes and 500-bp fragment for the wild-type gene (C).
|
For routine genotyping of mice, PCR was used to genotype DNA isolated from ear biopsies. For genotyping of knockouts three primers were used (GCATCTCTGGAGCTCTGTGAGAGG, GGAGACTATCAGTCTGCCAACCC, and GGCGATGCCTGCTTGCCGAATATCATGG) which resulted in a product of 900 bp for the wild-type gene and 500 bp for the targeted gene. Mice targeted with the knockin mutation were genotyped using two primers (ATTCTCTCGCCTCTCCCTCTCTCC and CCGACCCTCCTGATCCTCCCTTAG), which generated a 373-bp wild-type product and a 567-bp knockin product. Mice were kept under specific-pathogen-free conditions and in accordance with local ethical guidelines and United Kingdom law.
Cell culture. HeLa cells were maintained in DMEM containing 10% fetal bovine serum (Sigma), 2 mM L-glutamine, 50 units/ml penicillin G, and 50 µg/ml streptomycin (Invitrogen). Primary mouse embryonic fibroblast (MEF) cells were isolated as described (54) and cultured in DMEM containing 10% fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin G, and 50 µg/ml streptomycin. HeLa and MEF cells were serum starved in DMEM containing 2 mM L-glutamine, 50 units/ml penicillin G, and 50 µg/ml streptomycin (Invitrogen) for 16 h before use.
To generate bone marrow derived macrophages, bone marrow cells were isolated from the femurs of mice. Cells were cultured on bacterial grade plastic in DMEM supplemented with 10% heat inactivated fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin G 50 µg/ml streptomycin and 5 ng/ml recombinant CSF. After 7 days cells in suspension were discarded and adherent cells removed by washing in versene (Invitrogen). The adherent cells were then replated in DMEM supplemented with 10% heat inactivated fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin G, 50 µg/ml streptomycin and 25 ng/ml recombinant colony-stimulating factor and used 24 h later.
Cells were stimulated with either anisomycin, arsenite or LPS using the concentrations and times indicated. For kinase assays and immunoblotting, cells were lysed in 50 mM Tris-HCl (pH 7.5), 1 mM EGTA, 1 mM EDTA, 1 mM sodium orthovanadate, 50 mM sodium fluoride, 1 mM sodium pyrophosphate, 0.27 M sucrose, 1% (vol/vol) Triton X-100, 0.1% (vol/vol) 2-mercaptoethanol, and complete proteinase inhibitor cocktail (Roche, East Sussex, United Kingdom). The lysates were centrifuged at 13,000 rpm for 5 min at 4°C, and the supernatants were removed, quick-frozen in liquid nitrogen, and stored at 80°C until use.
Immunoprecipitation kinase assay. Kinases were immunoprecipitated from cell lysate using an appropriate antibody coupled to protein G-Sepharose. For assay of MAPKAP-K2 50 µg of cell lysate was used; however, for MSK1 1 mg of lysate was required in addition to a preclearing step by incubation with protein G-Sepharose for 30 min at 4°C to reduce nonspecific binding to the beads during immunoprecipitation (54). The immunoprecipitate was then washed with lysis buffer containing 0.5 M NaCl, with 50 mM Tris-HCl (pH 7.5), 0.1 mM EGTA, and 0.5 M NaCl, and twice with 50 mM Tris-HCl (pH 7.5) and 0.1 mM EGTA prior to assaying for protein kinase activity.
Protein kinases were assayed in 50-µl reactions by measuring the incorporation of radioactive [32P]phosphate from [
-32P]ATP into substrate peptides. The assay was initiated by the addition of 35 µl of a mix of 50 mM Tris-HCl (pH 7.5), 100 µM EGTA, 2.5 µM PK1, 0.1% (vol/vol) 2-mercaptoethanol, 30 µM substrate peptide, 100 µM [
-32P]ATP, and 10 mM MgCl2. For MSK1 Crosstide (GRPRTSSFAEG) was used as the substrate peptide, while for MAPKAP-K2 the substrate peptide used was KKLNRTLSVA. Reactions were stopped by pipetting 40 µl onto P81 paper followed by washing in 75 mM orthophosphoric acid. Incorporation of 32P was measured by Cerenkov counting in a Wallac 1409 liquid scintillation counter. One unit was defined as the incorporation of 1 nmol of phosphate into the substrate peptide in 1 min.
Immunoblotting. Soluble protein extract (20 to 30 µg) was run on 4 to 12% polyacrylamide gels (Novex, Invitrogen) and transferred to nitrocellulose membranes. Proteins were detected using primary antibodies in combination with horseradish peroxidase (Pierce) and chemiluminescent substrate (Amersham).
Real-time PCR.
Cells were treated as indicated, then lysed and RNA isolated using the NucleoSpin RNA purification method (Macherey-Nagel). RNA was reverse transcribed (iScript; Bio-Rad) and real-time PCR carried out using Sybr green-based detection. 18s rRNA levels were used as normalization controls and relative mRNA levels calculated using the equation
![]() |
, and 18s RNA are shown in Table 1. |
View this table: [in a new window] |
TABLE 1. Primers used for PCR
|
Analysis of LPS-induced cytokine production.
Age-matched (10 to 12 weeks) mice were administered an intraperitoneal injection of 37.5 µg of LPS (Escherichia coli 055B5 Sigma L6529) dissolved in sterile saline solution. Control mice were given an intraperitoneal injection of the equivalent volume of saline. At the times indicated mice were culled by CO2 asphyxiation and blood was taken by cardiac puncture. Plasma levels of cytokines (TNF-
, interleukins 1
, 1ß, 6, 12p40, and 13, Mip1a, Mip1b, and RANTES) were determined using a Luminex-based multiplex assay from Bio-Rad.
Analysis of p38ß/TNF
ARE mice.
The generation and characterization of Tnf
ARE mice has been previously described (27). Tnf
ARE/+/p38ß/ mice were generated by breeding Tnf
ARE/+ mice into a p38ß-deficient background. Development of chronic inflammatory arthritis and Crohn's-like inflammatory bowel disease pathology was evaluated at 8, 12, and 16 weeks of age in Tnf
ARE/+/p38ß/ compared to Tnf
ARE/+/p38ß+/+ littermates. Wild-type and p38ß/ mice were also included as additional control mice. All the mice used for assessment of pathology were kept in a mixed C57/129 background.
Clinical symptoms of arthritis were evaluated in ankle joints in a blind manner using a semiquantitative arthritis score ranging from 0 to 3, where 0 equated to no arthritis (normal appearance and grip strength), 1 equated to mild arthritis with some joint swelling, 2 equated to moderate arthritis (severe joint swelling and digit deformation, reduced grip strength), and 3 equated to severe arthritis (severe joint swelling and digit deformation, impaired movement, no grip strength).
For histological assessment of arthritis, paraffin-embedded joint tissue samples were sectioned and stained with hematoxylin and eosin and they were histologically evaluated in a blind fashion. Arthritic pathology was assessed separately for synovial hyperplasia, existence of inflammatory sites, cartilage destruction, and bone erosion and scored as 0 for normal, 1 for mild inflammation in periarticular tissue and/or mild edema, 2 for moderate inflammation and pannus formation with superficial cartilage and bone destruction, 3 for marked inflammation with pannus formation and moderate cartilage and bone destruction (depth to middle zone), and 4 for severe inflammation with pannus formation and marked cartilage and bone destruction (depth to tidemark).
For Inflammatory bowel disease, a histopathological score of inflammation in the terminal ileum was evaluated after hematoxylin/eosin staining of paraffin sections from the gastrointestinal tract of the mice, where 0 equated to no detectable pathology, 1 equated to isolated inflammatory cells in the stroma, 2 equated to the presence of inflammatory cells in groups (up to five cells) with focal infiltration to mucosa and submucosa layer (more than five groups of cells and less than 10 groups per 10 HPF), 3 equated to inflammatory cells in groups (up to five cells) with extensive mucosal and submucosal inflammation (more than 10 groups of cells per 10 HPF), and 4 equated to to transmural inflammation.
|
|
|---|
The homozygous knockin (p38ßki/ki) mice were viable and fertile and showed no apparent health problems when maintained under specific-pathogen-free conditions. Surprisingly, when the expression of p38ß was analyzed in the p38ßki/ki mice, no p38ß expression was seen in either the cortex (the tissue in which highest levels of p38ß was seen in p38ß+/+ animals) of these mice (data not shown), or in primary embryonic fibroblasts derived from these mice (Fig. 1D).
To ensure that the targeting had not disrupted the expression of the p38ß gene, mRNA was isolated from wild-type, p38ß/ and p38ßki/ki MEF cells and analyzed for p38ß mRNA expression by real-time PCR. Levels of p38ß mRNA in p38ßki/ki cells were similar to that in wild-type cells, while as expected no p38ß mRNA was seen in p38ß/ cells (Fig. 1E).
To determine if the Asp168Ala mutation affected the stability of p38ß protein, hemagglutinin (HA)-tagged wild-type and Asp168Ala protein was transiently expressed in HeLa cells. Both proteins were expressed at similar levels, as judged by immunoblotting for the HA tag (Fig. 1F). The knockin mutation was generated in E14 ES cells, and further analysis of the p38ß gene in the parent E14 cells, and also in the p38ßki/ki mice, revealed a single nucleotide polymorphism that would result in the mutation of Cys211 to Arg. To determine the effect of single nucleotide polymorphism on p38ß expression, Cys211Arg HA-p38ß, and also Asp168Ala/Cys211Arg were expressed in HeLa cells. Mutation of Cys211 to Arg, either as a single mutation or as a double mutation with Asp168Ala, greatly reduced the expression of p38ß in these cells (Fig. 1F). As this single nucleotide polymorphism may result in a natural knockout of p38ß, this region of the p38ß gene was sequenced in DNA from C57BL/6 or Sv129 mice. We have not however been able to establish the presence of this single nucleotide polymorphism in these strains of mice.
To generate p38ß knockout mice, a targeting vector was used to delete exons 2 to 7 of the p38ß (MAPK11) gene in embryonic stem cells (Fig. 2, Materials and Methods). These ES cells were used to obtain p38ß knockout mice as described in the Materials and Methods. The mice were genotyped by PCR (Fig. 1C) and p38ß/ mice were found to be born at approximately the expected frequency from p38+/ matings (30% wild type, 48% heterozygous. and 22% knockout; n = 403). p38ß/ mice were fertile and of normal size, and had no apparent health problems or phenotype when maintained under specific-pathogen-free conditions.
To ensure that the knockout had been effective, the expression of p38ß protein was examined in p38ß+/+ and p38ß/ mice. To facilitate this, a p38ß-specific antibody was generated by injection of a p38ß-specific peptide (KPLEPSQLPGTHEIEQ) into sheep. The resulting antibody was found to recognize recombinant p38ß but not p38
(data not shown). In p38ß+/+ mice high levels of p38ß were detected in the brain, thymus, and spleen, with lower levels found in the adrenals, lung, kidney, liver, pancreas, and heart (Fig. 3A). Little or no expression of p38ß was seen in skeletal muscle. As expected, no p38ß expression was seen in tissues from the p38ß/ mice.
![]() View larger version (46K): [in a new window] |
FIG. 3. Expression of p38 isoforms in p38ß+/+ and p38ß/ tissues. Lysates were prepared from the total brain, cerebellum, cortex, adrenals, thymus, spleen, liver, pancreas, kidney, lung, heart, and skeletal muscle of p38ß+/+ and p38ß/ mice; 30 µg of soluble protein was run on 4 to 12% polyacrylamide gels and immunoblotted for total p38ß (A), p38 (B), p38 (C), and p38 (D).
|
expression showed it was more ubiquitously expressed than the p38ß isoform in p38ß+/+ mice, although lower levels of expression were seen in the brain, liver, and pancreas compared to other tissues. There was no upregulation of p38
in any of the tissues from the p38ß/ mice (Fig. 3B). Levels of p38
were found to be highest in skeletal muscle, although expression was also seen in most other tissues. Interestingly, in some tissues, particularly the cortex and pancreas, there appeared to be a moderate increase in p38
levels in the p38ß/ mice (Fig. 3C). In p38ß+/+ mice, levels of p38
were found to be highest in the adrenal gland, kidney, and heart, and these levels were not significantly changed in the p38ß/ mice (Fig. 3D).
Stress-activated signaling in MEF cells.
The role that p38ß plays in downstream signaling pathways known to be regulated by p38 isoforms was investigated in primary MEF cells. Serum-starved MEF cells isolated from p38ß+/+ and p38ß/ mice were stimulated with anisomycin to activate the p38 signaling pathway. Cells isolated from p38ß+/+ and p38ß/ mice expressed comparable levels of p38
as well as ERK1/2, and JNK as judged by immunoblotting (Fig. 4A). Anisomycin strongly activated p38
and JNK, and neither of these activations was affected by knockout of p38ß. ERK1/2 were only weakly activated in response to anisomycin, and this was also not affected by p38ß knockout (Fig. 4A). Similar results were obtained for stimulation of the cells with arsenite, with the exception that a stronger activation of ERK1/2 was observed (data not shown).
![]() View larger version (41K): [in a new window] |
FIG. 4. Characterization of p38 dependent signaling in p38ß/ MEF cells. Primary MEF cells were isolated from p38ß+/+ and p38ß/ mice. Cells were serum starved for 16 h and then left unstimulated (control), incubated with 5 µM SB 203580 for 1 h, and then stimulated with 10 µg/ml anisomycin (aniso + SB) for a further hour or stimulated with 10 µg/ml anisomycin for 1 h (A and B) or for the times indicated (C) without any addition of SB203580. (A) Cells were then lysed and protein extracts were immunoblotted for p38 , p38ß, phosphorylated p38 , ERK1/2, phosphorylated ERK1/2, JNK, or phosphorylated JNK. (B) Cells were lysed and MAPKAP-K2 or MSK1 was immunoprecipitated and assayed for activity as described in the Materials and Methods. One unit was defined as the incorporation of 1 nmol of phosphate into the substrate peptide in 1 min. Black bars represent results from p38ß+/+ cells, while white bars represent results from p38ß/ cells. Error bars represent the standard errors of duplicate assays on three independent stimulations per condition. (C) Total RNA was isolated from cells and quantitative reverse transcription-PCR carried out as described in the Materials and Methods. Levels of c-jun, c-fos, junB, and nur77 were determined relative to 18s rRNA and fold stimulation calculated relative to the levels of the mRNA in unstimulated p38ß+/+ cells. Black bars represent results from p38ß+/+ cells, while white bars represent results from p38ß/ cells. Error bars represent the standard errors of duplicate assays on three independent stimulations per condition.
|
Cellular stress has been shown to result in the induction of several immediate-early genes in MEF cells, including c-fos, junB, c-jun, and nur77, in a p38-dependent manner (19, 54). In p38ß+/+ cells the transcription of these genes in response to anisomycin was blocked by SB203580, consistent with a role for p38
or p38ß in the induction of these genes. The transcription of these genes in MEF cells was not however affected by the knockout of p38ß (Fig. 4C).
T-cell development is normal in p38ß/ mice. T-cell precursors can be developmentally identified by the expression of the cell surface molecules CD4, CD8, CD25, and CD44. Early T-cell progenitors lack both CD4 and CD8 and are referred to as double-negative (DN) cells. This stage of development can be further characterized by expression of CD25 and CD44; early precursors are CD25CD44+ (DN1), CD25 is the upregulated (DN2) then CD44 downregulated (DN3) and in the DN4 stage of development cells are negative for both CD44 and CD25. Both CD4 and CD8 are then upregulated to give double-positive cells. Either CD4 or CD8 is then downregulated to give CD4+ or CD8+ single-positive thymocytes that then exit the thymus and move into the periphery.
Previous studies have shown that during T-cell development high levels of p38 activity can be found in CD4CD8 T cells, and that this activity is down-regulated as the cells become CD44CD25 cells (7, 48). Overexpression of MKK6 in T cells resulted in sustained activation of p38 and inhibited the CD25+CD44 to CD25CD44 transition. Overexpression of dominant negative p38
in T cells resulted in decreased T-cell number, suggesting that p38 activity may help the survival of double-negative T cells (7).
To determine if p38ß could play an important role in T-cell development, fluorescence-activated cell sorting analysis was performed on thymocytes from these mice. No significant differences were seen in total lymphocyte cell number in the thymus or spleen of p38ß+/+ and p38ß/ mice (Fig. 5A). In the thymus of p38ß/ mice, the numbers of double-negative cells were normal, as was the development of double- and single-positive CD4+ and CD8+ cells (Fig. 5B and C). Normal ratios of CD4 and CD8 cells were also found in the spleens of p38ß/ mice.
![]() View larger version (29K): [in a new window] |
FIG. 5. p38ß is not required for T-cell development. Thymi and spleens were isolated from 6-week-old p38ß+/+ and p38ß/ mice and analyzed as described in the Materials and Methods. (A) Total cell numbers, determined by counting isolated cell suspensions, were determined for both the thymus and spleen of p38ß+/+ and p38ß/ mice. (B) Fluorescence-activated cell sorting plot of CD4 and CD8 stained Thy1-positive cells in the thymus. Results are representative plots from the analysis of three p38ß+/+ and p38ß/ mice. (C) Quantification of the total numbers of double-negative cells from p38ß+/+ and p38ß/ thymi. (D) p38ß+/+ and p38ß/ mice were injected with either PBS or anti-CD3 antibody (50 ng). Mice were culled 48 h after injection and numbers of double-positive and CD4 and CD8 single-positive thymocytes were determined by counting and fluorescence-activated cell sorting analysis.
|
p38ß is not required for cytokine production in vivo in response to LPS.
As p38 isoforms have been implicated in the expression of cytokines, including interleukins 1, 6, and 12 and TNF, in response to inflammatory agents through the use of p38
/ß inhibitors (8, 29, 31, 33, 47), the ability of the p38ß/ macrophages or mice to produce cytokines in response to an LPS challenge was examined. Stimulation of bone marrow-derived macrophages from p38ß+/+ and p38ß/ mice with LPS resulted in similar increases in the levels of mRNA for both interleukin-6 and TNF-
in both genotypes (Fig. 6A). Cytokine levels in blood were also examined following intraperitoneal injections of LPS into mice. LPS stimulated the transient production of TNF-
, which was upregulated at 1 h but not 4 h post injection. Interleukin-6, Mip1a, and Mip1b were also upregulated by 1 h, however the levels of these proteins were still high 4 h post injection. Interleukins 1a, 1b, 13, and 12p40 and RANTES were also induced, however these cytokines were found to be higher at 4 h than 1 h. No significant difference was seen in the levels of these cytokines between p38ß+/+ and p38ß/ mice.
![]() View larger version (34K): [in a new window] |
FIG. 6. p38ß is not required for cytokine production. A) Macrophages were derived from the bone marrow of p38ß+/+ and p38ß/ mice. Cells were stimulated with 10 ng/ml of LPS for the times indicated and the induction of interleukin-6 (Il-6) and TNF- mRNAs was measured by real-time PCR as described in the Materials and Methods. B) Mice were given an intraperitoneal injection of 37.5 µg of LPS in a sterile saline solution, or an injection equivalent volume of saline. Mice were sacrificed after 1 or 4 h and plasma levels of interleukins 1a, 1b, 6, 12p40, and 13, TNF- , Mip1a, Mip1b, and RANTES were measured by a Luminex-based multiplex assay as described in the Materials and Methods. All mice were 10 to 12 weeks of age and error bars represent the standard deviation of measurement on five individual mice.
|
ARE mice were used as a model for TNF-induced pathology. These mice have a mutation in the 3' untranslated region of the TNF gene that disrupts an AU-rich region, which results in an increased translation and stability of the TNF mRNA and elevated levels of TNF in these animals, leading to the development of both arthritis and inflammatory bowel disease (27).
p38ß/ mice were crossed to Tnf
ARE mice and the development of arthritis and inflammatory bowel disease was determined in Tnf
ARE/+/p38ß+/+ and Tnf
ARE/+/p38ß/ mice at 8, 12, and 16 weeks of age as described in the Materials and Methods (Fig. 7). Wild-type and p38ß/ mice were also analyzed as additional controls. Gross examination of Tnf
ARE/+/p38ß+/+ and Tnf
ARE/+/p38ß/ mice showed no significant differences in disease onset, as at week 8 both genotypes exhibited moderate joint swelling and reduced grip strength. Over the following weeks of study, full-blown disease developed in all groups.
![]() View larger version (27K): [in a new window] |
FIG. 7. Inflammatory arthritis and inflammatory bowel disease in Tnf ARE/+/p38ß+/+ and Tnf ARE/+/p38ß/ mice. Histologic examination (A) of ankle joints showed formation of the inflammatory pannus, and areas of cartilage and bone erosion are evident in both genotypes (B) of portions of ileum. Villous blunting and inflammatory infiltration are evident. Inflammatory bowel disease was evaluated histologically (C), while levels of arthritis were evaluated histologically (D) and clinically (E) as described in the Materials and Methods.
|
ARE/+/p38ß+/+ and Tnf
ARE/+/p38ß/ mice (Fig. 7) and in agreement with the clinical evaluation. In Fig. 7, both genotypes present all the hallmarks of full-blown arthritis: inflammation and pannus formation with superficial cartilage and bone destruction of ankle joints.
Crohn's-like inflammatory bowel disease developed by the Tnf
ARE mice is restricted to the terminal ileum and occasionally to the proximal colon. For this, we histologically examined the terminal ileum and proximal colon of Tnf
ARE/+/p38ß+/+ and Tnf
ARE/+/p38ß/ mice and based on the inflammation in the terminal ileum, inflammatory bowel disease development was evaluated as described in the Materials and Methods. Both genotypes developed inflammatory bowel disease with histopathological characteristics of villus blunting and infiltration of inflammatory cells to mucosal and submucosal gut layers (Fig. 7) becoming transmural with disease progression.
|
|
|---|
, we report here that mice with knockouts of p38ß are viable with no obvious health problems. One possible reason for this mild phenotype could be compensation between different p38 isoforms. This has been seen previously in p38
knockouts, where the phosphorylation of the p38
substrate SAP97 was insensitive to the p38
/ß inhibitor SB203850 in wild-type cells but became sensitive to SB203580 in p38
knockout cells (46). One possible way to reduce compensation would be to introduce point mutations to inactivate rather than delete p38ß. As a result the kinase would still be expressed in cells from its endogenous promoter and be able to interact with but not phosphorylate its substrates. Similar knockin approaches have been used to successfully study other kinases, such as PDK1 and phosphatidylinositol 3-kinase (36, 42). Mutation of the aspartic acid in the DGF motif of kinases to alanine has been used previously to generate inactive kinases. This mutation did not significantly the affect the stability of p38ß as judged by transient expression in HeLa cells (Fig. 3) but did result in an inactive kinase (data not shown). Surprisingly, however, when the mutation was used to make p38ßki/ki mice, these mice did not appear to express p38ß protein, although expression of the p38ß mRNA was normal. Further analysis revealed the presence of a single nucleotide polymorphism in the p38ß gene in the wild-type and targeted E14 ES cells, and as would be expected, this single nucleotide polymorphism was also present in the p38ßki/ki mice. The single nucleotide polymorphism would result in the mutation of cysteine 211 to arginine, and when the effect of this mutation was tested in transient transfection assays it destabilized the p38ß protein. As a result the p38ßki/ki mice were effectively similar to a knockout as they lacked detectable levels of the p38ß protein, and the Cys211Arg single nucleotide polymorphism would need to be changed in the ES cells before an effective kinase-dead knockin could be made. The origin of the single nucleotide polymorphism is unclear, as while we were able to detect it in E14 ES cells, we have not yet been able to find the corresponding single nucleotide polymorphism in mice.
Using MEF cells we have shown that knockout of p38ß does not affect the expression or activation of the ERK1/2 or JNK MAPK in response to cellular stress. Similarly knockout of p38ß did not affect the expression or activation of p38
. As SB203580, which inhibits both p38
and ß, blocks the phosphorylation and activation of MSK1, MSK2, and MAPKAP-K2 in MEF cells in response to cellular stress (54), the activation of these kinases in the p38ß/ cells was also examined. Lack of p38ß only slightly reduced the activation of MAPKAP-K2. Consistent with this, it has been reported that the activation of MAPKAP-K2 is significantly reduced, but not completely abolished in p38
/ ES cells in response to arsenite stimulation (2). Together these results suggest that in MEF cells p38
is the main p38 isoform responsible for MAPKAP-K2 activation, but that there may be a minor contribution from p38ß.
In vitro, MSK1 can be activated by both p38
and p38ß but not p38
or
(6, 35). We found that the activation of MSK1 was normal in p38ß/ MEF cells, suggesting that p38ß is not responsible for MSK activation in vivo. Consistent with this, the activation of MSK1 by anisomycin has recently been reported to be greatly reduced in MEF cells from p38
/ mice (5). Several immediate early genes have been suggested to be regulated by p38 in response to cellular stress, including c-fos, c-jun, junB, and nur77. The induction of these genes was not affected by knockout of p38ß, although it was blocked by preincubation with SB203580. Consistent with this the induction of these genes is reduced or abolished in p38
/ cells (5; V. Beardmore, unpublished observations). Together these results suggest that in MEF cells p38
is the main p38 isoform involved in the activation of downstream kinases and IE gene induction.
p38 has been implicated in T-cell development through the use of both specific inhibitors such as SB203580 and the expression of dominant negative or active p38
or MKK6 (7). These results have suggested that p38 activity is required to maintain normal numbers of CD4/CD8 double-negative thymocytes, but that p38 activity inhibits the formation of double-positive cells. Recently however it has been shown that p38
knockout does not result in defects in thymocyte development (23), suggesting that another isoform may be responsible. We show here that p38ß knockout does also not result in major problems in thymocyte development. This suggests that either p38
or ß is dispensable for thymocyte development or that in T cells there is compensation by other p38 isoforms in the single knockouts.
Inhibitors of p38, such as SB203580, have been used extensively to study p38 function and have demonstrated a role for p38
or ß in the production of pro-inflammatory cytokines, particularly TNF-
and interleukin-6. p38 inhibitors are also shown to have anti-inflammatory effects in animal models of inflammation, and clinical trials have been started for the use of some of these compounds to treat inflammatory disease (44). The role of p38 MAPKs in the immune system is likely to be complex, and p38 potentially plays roles both in the production of TNF and in mediating its downstream effects. p38
controls TNF production at least in part through the action of MAPKAP-K2, which is involved in the regulation of TNF translation via AU-rich regions in the TNF 3' untranslated region (26, 28, 41, 50).
Consistent with the finding that p38
is the major activator of MAPKAP-K2 activation, the production of TNF was not compromised in p38ß/ mice or in LPS stimulated macrophages derived from these mice. The production of other cytokines including interleukins 1 and 6 and Mip1 was also not affected by the p38ß knockout. TNF appears to play a central role in inflammatory disease, as mice with elevated TNF levels develop arthritis and inflammatory bowel disease. Consistent with this anti-TNF antibodies have been able to reduce the symptoms of both arthritis and inflammatory bowel disease (15). TNF can activate p38 in several cell types and has a potential role mediating the inflammatory effects of TNF. p38ß however does not appear to be critical for these processes, as p38ß knockout was found not to affect the development of arthritis or inflammatory bowel disease in a Tnf
ARE mouse model of these diseases. This again suggests that p38
, or other MAPKs such as JNK or ERK, and not p38ß are the critical MAPK signaling pathways downstream of TNF in the immune system. These results therefore suggest that maintaining potency against p38ß is not necessary, and may even not be desirable, during the development of inhibitors of p38
for inflammatory disease.
In summary, p38ß/ mice have no apparent adverse phenotype and display normal stress-activated signaling in MEF cells as well as normal T-cell development and responses to TNF and LPS in the immune system. This suggests that p38ß is not critical for these functions, however, the possibility that other p38 isoforms compensate for p38ß in the knockout cannot be ruled out. Analysis of compound knockout or knockin mutations of p38 isoforms will be required to fully answer these questions.
This research was supported by the United Kingdom Medical Research Council, Astra-Zeneca, Boehringer-Ingelheim, GlaxoSmithKline, Merck and Co., Merck KGaA, and Pfizer.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»