![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
,
Nichole M. Danzl,
Celestine Wanjalla, and
Konstantina Alexandropoulos*
Department of Pharmacology, College of Physicians and Surgeons of Columbia University, New York, New York 10032
Received 25 April 2005/ Returned for modification 3 June 2005/ Accepted 30 September 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We are interested in the molecular mechanisms that govern the development and function of T lymphocytes. Our recent experiments have concentrated on elucidating the role of the adapter protein Sin (Src interacting protein) in these processes. Sin is highly expressed in the thymus and was isolated as a ligand for the Src homology 3 (SH3) domain of Src kinases such as Fyn, an important regulator of T-lymphocyte signaling (2, 3). Sin, also known as embryonal Fyn substrate (Efs), belongs to a small family of adapter molecules, the Cas proteins, which include the prototype member p130Cas and HEF1/CasL (31). As adapter molecules, all three members contain conserved modular domains and motifs capable of mediating multiple protein-protein interactions. The conserved features of the Cas proteins include (i) proline-rich sequences that show binding specificity for the Src, Fyn, and phospholipase C-
SH3 domains; (ii) tyrosine-based motifs which, when phosphorylated, bind to different Src homology 2 (SH2) domains on other proteins (36); (iii) an N-terminal SH3 domain that is highly conserved among the three family members and has the potential to bind to phosphatases (10, 31); (iv) and a conserved C terminus which can mediate homo- or heterotypic interactions between the different family members (20). All three members of the Cas family are substrates for Src kinases, and Src kinase-mediated phosphorylation of these proteins is important for their adapter signaling properties (3).
In previous experiments, we generated transgenic mice and T-cell lines expressing Sin to gain insight into the function of this protein in T lymphocytes. We found that overexpression of Sin results in defective thymocyte development and interleukin-2 (IL-2) production by mature T cells, suggesting a negative role for Sin in T-lymphocyte function (11, 49). In this report, we show that mice deficient in Sin expression exhibit exaggerated immune responses. More importantly, we found that aged Sin heterozygous and homozygous mice develop inflammatory lesions in their small intestine in the form of infiltrating CD4+ T cells and B cells in the lamina propria. The presence of infiltrates correlates with villus expansion and/or destruction. Inflammatory infiltrates were also found in the liver and kidney of Sin-deficient mice and to a lesser extent in the lung and skin. Our results support a role for Sin as an important regulator of T-lymphocyte function and suggest that Sin deficiency leads to aberrant T-cell-mediated immune responses and tissue-specific inflammation.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PCR and Southern blot analysis. The long-template PCR kit (Roche) was used for PCR genotyping. Two 5' primers for the Sin wild-type locus (GAGGAGGAGTGTGCCCTCCATGACGCTGGCAGG) and the targeted locus (ATGGGATCGGCCATTGAACAAGATGGATTG) were used for amplification. The 3' primer for both loci was GGGACATGATGAGCCAGGCTGGGTGGGAGATGC. For Southern blot analysis, 5 µg of purified tail DNA was loaded on a 0.8% Tris-borate-EDTA agarose gel and run overnight at 30 V. The DNA in the gel was then depurinated in 0.25 N HCl, and DNA was transferred onto a nylon membrane (Nytran SPC; Schleicher & Schuell) overnight by capillary action in transfer buffer (0.4 N NaOH, 1 M NaCl). Posttransfer, the membrane was soaked in 2 x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), dried, and UV cross-linked. Hybridization was carried out in Ultrahyb buffer (Ambion, Inc.) with 0.5 x 106 cpm/ml of radiolabeled probe.
Flow cytometry analysis. A total of 106 freshly isolated thymocytes, splenocytes, or lymph node cells from 6- to 8-week-old mice were incubated with the specified antibodies and stained in MACS buffer (2 mM EDTA, 0.03% NaN3, 1% bovine serum albumin, 1x phosphate-buffered saline [PBS]) for 15 min on ice. Cells were spun down and washed three times with MACS buffer, fixed in BD Cytofix buffer (BD Pharmingen), and analyzed by flow cytometry using a FACSCalibur and CELLQUEST software (BD Biosciences). Anti-CD4-allophycocyanin (APC)-, anti-CD8-peridinin chlorophyll a protein (PerCP)-, anti-CD3-fluorescein isothiocyanate (FITC)-, anti-CD69-FITC-, anti-CD5-FITC-, anti-T-cell receptor ß (TCR-ß)-FITC-, anti-CD62L-FITC-, anti-CD44-PE-, and anti-CD45-R(B220)-APC-conjugated antibodies were purchased from BD Pharmingen.
Immunoprecipitations and Western blots. These assays were performed as previously described (2). Mouse monoclonal antibody against Sin was obtained from BD Transduction Laboratories.
T-cell purification and proliferation/cytokine assays.
Splenic CD4+ T cells were purified by using the Dynabead/DETACHaBEAD mouse CD4+ system (DYNAL Biotech). This protocol routinely yielded CD4+ T-cell populations that were >95% pure, determined by staining cells with anti-CD4 antibody and analyzing them by fluorescence-activated cell sorting (FACS). A total of 1 x 105 to 2 x 105 CD4+ T cells per well of a 96-well plate were plated. Cells were left untreated or induced with plate-bound mouse anti-CD3
, anti-CD3/CD28 antibodies, or phorbol myristate acetate (PMA) and ionomycin. To measure proliferative responses, 48 h after stimulation, cells were labeled overnight with 1 µCi [3H]thymidine, and T-cell proliferation was determined by levels of [3H]thymidine incorporation on a scintillation counter. To measure cytokine secretion, culture supernatants were collected at 24 (IL-2) or 48 h and assayed for cytokine secretion by using a Luminex cytokine/chemokine sixplex bead and enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer's protocol (Biosource).
ELISAs. To measure T-cell-dependent responses, mice were immunized with 100 µg NP-keyhole limpet hemocyanin (KLH) by intraperitoneal injection, and blood was collected on day 14 after injection. NP12-bovine serum albumin-coated plates were incubated with serially diluted sera for 2 h at 37°C. After washing the plates the levels of NP-specific immunoglobulin (Ig)-isotype production in response to immunization were determined using an isotype-specific ELISA kit (Southern Biotech) containing anti-isotype-specific secondary antibodies and anti-IgH-IgL for total Ig detection according to manufacturer's protocol and as previously described (41, 43). Titration curves of the different dilutions were constructed by measuring the absorbance of alkaline phosphatase color reactions at 405 nm. Antibody presence was expressed as absorbance at 405 nm from the 1:300 (or 1:3,600 in the case of IgG1) dilution, which was within the linear part of the titration curve. For statistical analysis, Student's t test was used to calculate statistical significance for differences in measurements between two different groups. A P value of <0.05 was considered statistically significant. Serum Ig levels from unimmunized aged mice were determined using the same isotype-specific ELISA kit (Southern Biotech).
Histological analysis. Various organs removed from aged mice were fixed in 10% buffered formalin and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) and examined under a microscope with the help of a pathologist. The severity of the lesions was determined by light microscopy and staining of small intestine sections with anti-CD3 and anti-kappa light chain antibodies to determine the extent of infiltration and expansion/damage of villi. To classify severity of mucosal lesions, three distinct stages of villous damage relating to the extent of epithelium and lamina propria destruction were taken into consideration (mild, moderate, and severe).
Immunohistochemistry. Immunohistological staining was performed on paraffin-embedded or frozen sections of various organs by using alkaline phosphatase (AP)-, horseradish peroxidase (HRP)-, or fluorophore-conjugated secondary antibodies. For staining paraffin-embedded sections, slides were deparaffinized with xylene, washed with ethanol, and after antigen retrieval (boiling for 15 min, in 1 mM EDTA, pH 7.5, followed by methanol washes), slides were blocked in 5% dry milk in TBST (0.05 M Tris, pH 7.5, 0.15 M NaCl, 0.01% Tween 20) and incubated with primary antibodies (anti-CD3 [Dako], anti-kappa light chain [Cortex]) overnight at room temperature (RT) in a humidified chamber. Slides were then washed with TBST and incubated with AP- or HRP-conjugated secondary antibodies for 30 min at RT. After washing in TBST specific staining was visualized by incubating slides in developing solutions nitroblue tetrazolium/BCIP (5-bromo-4-chloro-3-indolylphosphate) (AP; Roche) or aminoethylcarbacole (HRP; Sigma). For staining frozen sections, slides were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 20 min, washed with PBS, and permeabilized/blocked with permeabilization buffer (RPMI medium, 0.05% saponin, 10 mM glycine, 5% normal donkey serum). After washing, the slides were incubated with primary antibodies at a 1:100 dilution (anti-CD4, -CD8, or -CD25-FITC [BD Pharmingen], or anti-F480 [Serotech]) and incubated for 30 min at RT. After a washing, slides were incubated with anti-rabbit antibody-AlexaFluor 488 (Molecular Probes) or anti-rat antibody-rhodamine (Jackson ImmunoResearch) at a 1:400 dilution for 30 min at RT, and specific staining was visualized by fluorescent microscopy using a Nikon eclipse E600 microscope.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
[2-fold]) and Th2 (IL-4 and IL-5 [
4-fold]) T-cell lineages (Fig. 2D). In contrast, T cells stimulated with PMA-ionomycin, a nonphysiological stimulus that bypasses the TCR, behaved no different that wild-type controls (Fig. 2D). To characterize the in vivo function of Sin-deficient T cells, we tested the T-cell-dependent antibody responses of normal and Sin-deficient mice. Mice were immunized with NP-KLH, and antibody levels in the sera of different mice were analyzed by ELISAs. In Sin-deficient mice, most NP-specific immunoglobulin isotype levels were similar to those of wild-type controls (Fig. 2E). However, significant increases were observed in the levels of IL-4- and transforming growth factor ß/IL-5-dependent IgG1 and IgA isotypes, respectively (38), which correlated with the enhanced IL-4/IL-5 cytokine production by Sin-deficient T cells (Fig. 2D). A concomitant significant increase in total Ig levels was also observed in the sera of Sin–/– mice compared to controls (Fig. 2E). The basal levels of serum immunoglobulin isotypes before immunization were within the normal range in all animals tested (Fig. 2E). Taken together, these data suggest that endogenous Sin plays an inhibitory role in T-lymphocyte function which is consistent with our previous studies showing a negative effect of Sin overexpression in T cells.
Spontaneous enteropathy in aged Sin-deficient mice. Previous studies on adapter proteins expressed in T cells have shown that the deletion of negative regulators in most cases results in increased proliferative responses and development of spontaneous autoimmunity in older mice (9, 17, 23, 28, 30, 37, 42, 47). To address the effect of Sin deficiency on development of spontaneous autoimmunity or inflammation, histopathological analyses were performed in older mice ranging in age from 7 to 14 months. While inflammatory infiltrates were detected in H&E sections of several organs derived from Sin–/– mice (see Table 3 below), we found that one of the tissues most seriously and consistently affected was the small intestine (Fig. 3A). H&E-stained sections of the duodenum/proximal jejunum revealed crypt hyperplasia and marked lymphocytic infiltration of the lamina propria, correlating with various degrees of damage in the intestinal mucosa of Sin–/– mice compared to intact wild-type controls (Fig. 3A, compare left and right panels). Interestingly, sections derived from heterozygous littermates exhibited an intermediate phenotype manifested as shortened, blunt villi, expanded laminae propriae, and enlarged crypts (Fig. 3A, middle panels).
|
|
30%) also exhibited mild destruction at the tips of their villi. More dramatically, the majority (5/7, 70%) of Sin-deficient mice exhibited marked infiltration of the lamina propria accompanied by moderate (3/5) or severe (2/5) villus destruction (Table 2; Fig. 3A, middle and bottom right panels, respectively). Similar effects were also observed in H&E sections derived from the ileum of Sin-deficient animals, 60% of which exhibited inflammation and expansion of the lamina propria, crypt enlargement, and altered epithelial cell morphology or damage (Fig. 3B). In all but one case, inflammation in the duodenum/proximal jejunum coincided with inflammation in the ileum. In contrast, we found no evidence of inflammation in the colon of Sin-deficient animals (Fig. 3C).
|
antibody to detect the presence of T cells. Immunostaining revealed increased presence of CD3+ T cells in the lamina propria in sections derived from Sin+/– and Sin–/– mice compared to wild-type controls (Fig. 4A). The presence of CD3+ T cells was less evident in the small intestine of Sin–/– mice with extensive villus damage, although dense staining was present in remnants of the villi (Fig. 4A, bottom left panel) and in mice with less extensive destruction (Fig. 4A, bottom right panel). Consistent with the increased CD3+ T-cell-specific staining in the laminae propriae of Sin-deficient mice, increased numbers of peripheral (splenic) CD3+ T cells were observed in aged mice analyzed by anti-CD3 antibody staining and flow cytometry (Fig. 4B). Splenic CD4+ T cells from Sin-deficient mice also exhibited increased levels of the surface marker CD44 with a concomitant decrease in CD62L expression, suggesting an activated, effector/memory T-cell phenotype (Fig. 4C). Serial sections of the same tissues used in Fig. 4A (left panels) were also stained with anti-kappa light chain antibody, which revealed increased presence of plasma B cells in a staining pattern similar to that obtained with anti-CD3 antibody (Fig. 4D). Serum concentrations of immunoglobulin isotypes were similar in aged unimmunized animals, with the exception of IgA, which showed a statistically significant threefold increase in Sin knockout animals (Fig. 4E).
|
ARE mice which exhibit enhanced production of tumor necrosis factor-
(18). To further characterize the nature of the infiltrates present in the small intestine of Sin-deficient mice, serial frozen sections of small intestine were stained with CD3/CD4, CD3/CD8, or CD4/CD25+ antibodies and analyzed by fluorescent microscopy. Sin knockout mice exhibited marked infiltration of the lamina propria by CD4+ T cells, which correlated with shortening and expansion of the villi (Fig. 5A, top right panel). The effect of Sin deficiency on infiltration of the lamina propria and intestinal epithelium by CD8+ T cells was less dramatic but consistent, particularly in the case of Sin heterozygous mice which exhibited significant differences in the presence of intraepithelial (IE) CD8+ T cells compared to controls (Fig. 5B). Costaining of the same sections with anti-CD3 and anti-CD4 or -CD8 antibodies and merging of the fluorescent images revealed that the infiltrates in the lamina propria consisted mostly of CD3+ CD4+ T cells, whereas CD3+ CD8+ cells were prominent in the intestinal epithelium (Fig. 5A and B, bottom right panels, and bar graphs in Fig. 5A).
|
Sin-deficient mice develop liver granulomas.
In addition to the effects of Sin deficiency in the gut, inflammatory infiltrates were also found in the liver of 70% (5/7) of Sin knockout animals. Inflammation in the liver consisted of infiltrates present around hepatic vessels and granulomas arising as multiple foci within the parenchyma (Fig. 6A). Granulomas in humans and mice arise as a result of diverse etiologies, are epithelioid in nature, and consist of both T cells and macrophages (21). Analysis of the cellular composition of liver sections with anti-CD3 antibody staining revealed the presence of CD3+ T-cell infiltrates in the liver of Sin knockout mice but not in wild-type controls (Fig. 6B). Staining of liver sections with the macrophage antigen F4/80 also revealed the presence of these cells in the granulomas (Fig. 6C). Liver granulomas coincided with the presence of infiltrates/damage in the small intestine in all cases examined suggesting a common link in the development of these inflammatory lesions. Inflammatory infiltrates were also found in the kidneys of most knockout animals that also developed intestinal and liver inflammation. Other tissues, such as the lung and skin, were less affected, and in some but not all cases, the lung inflammation occurred independently from that observed in the small intestine (Table 3).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The inflammation in the Sin knockout mice appears in a specific subset of tissues, namely, the small intestine, liver, and kidney tissues, and to a lesser extent, lung and skin tissues. Based on our results, we propose that these effects are mediated by aberrant immune responses, particularly in the T-cell compartment, and are not due to a disturbance of the different organs as a result of Sin deficiency as most of the organs examined do not express the Sin protein (unpublished observations). This is particularly true in the case of the small intestine, in which, although we observe extensive epithelial cell damage, we have found no evidence of Sin expression in the intestinal epithelium.
Consistent with the concept that an aberrant immune response mediates inflammation in Sin-deficient mice, we found that Sin–/– T cells exhibit enhanced cytokine secretion in young mice before the onset of tissue inflammation or damage. Enhanced cytokine secretion also correlates with inflammation in several mouse models, including the mouse model of oxazolone-induced colitis (7) and the IL-7 transgenic and IL-10-deficient animals (19, 46). T cells from these animals exhibit a three- to fivefold increase in cytokine production which correlates with exaggerated Th1 or Th2 effector T-cell responses (39). In the case of Sin-deficient mice, although both Th1 and Th2 cytokines were produced by Sin–/– T cells in vitro, IL-4/IL-5 production was more pronounced and was accompanied by an in vivo bias towards a Th2 response in the form of significantly increased IgG1 and IgA antibody production after NP-KLH immunization. These observations raise the possibility that inflammation in Sin-deficient mice may be mediated by aberrant Th2 effector T-cell responses; however, the exact nature of the responses and how it compares to other models of mucosal inflammation remain to be determined.
The conclusion that activated CD4+ T cells and increased cytokine production are responsible for the inflammation observed in Sin–/– mice is further supported by studies demonstrating that in vivo activation of T cells through anti-CD3 antibody injection into mice can lead to destruction of the villi in the small intestine (26, 29). Moreover, mice injected with various cytokines, such as IL-12, IFN-, and TNF develop severe damage of the intestinal epithelium (14). Again, these effects are similar to those observed in Sin–/– mice and support a role for exaggerated T-cell and cytokine responses in the development of inflammation in these mice.
Given the enhanced T-cell responses of Sin knockout animals, how does Sin deficiency induce spontaneous enteropathy and tissue-specific inflammation? It is well known that the mucosal surface of the gut is constantly exposed to high concentrations of antigens derived from food and microorganisms, leading to continuous stimulation of the intestinal immune system. Although the presence of these antigens is tolerated under normal conditions, disturbances in the function of the immune system lead to aberrant responses against these antigens and development of inflammation. Disturbances in the function of the immune system leading to mucosal inflammation can be caused by excessive effector or defective regulatory T-cell (Treg) function. For example, whereas the majority of mouse models exhibit excessive effector responses, the IL-10 knockout mice develop colitis as a result of defective function of Treg due to lack of suppressive function by IL-10 (19, 46). In the case of the Sin knockout mice, the presence of infiltrating CD4+ CD25+ T cells in the laminae propriae of Sin–/– mice and the normal percentages of CD4+ CD25+ T cells suggest that inflammation in these mice is likely due to chronically enhanced effector responses by activated CD4+ T cells rather than defective suppressor function by Treg. However, in the absence of direct evidence that the suppressor function of Sin–/– CD4+ T cells is intact, we currently cannot exclude the possibility that the Treg responses of Sin deficient mice are compromised.
In addition to perturbations in effector and/or Treg functions, CD8+ T-cell-mediated cytotoxicity has been implicated as a driving factor in the development of colitis in at least one other experimental model, the TNFARE mice mentioned above (18). Thus, the increased presence of cytotoxic CD8+ cells in the intestinal epithelia of Sin+/– and Sin–/– mice may lead to cytotoxic elimination of the intestinal epithelium, increased exposure of lymphoid cells to luminal antigens, and exacerbation of the inflammatory response. On the other hand, growing evidence suggests that CD8+ T cells are immunoregulatory and can protect host tissues from uncontrolled infiltration by systemic cells (15). Whether this is the case in Sin+/– mice, which as a whole exhibit an increased presence of CD8+ T cells and a milder form of the disease, is unclear. Our future experiments will examine the mechanisms through which Sin deficiency results in mucosal inflammation and whether effector and/or suppressor responses are perturbed, as well as the nature of the T-cell subpopulation(s) responsible for disease development in Sin knockout mice.
Finally, the inflammation evident in Sin-deficient mice differs from that observed in other mouse models of mucosal inflammation in that Sin–/– mice do not develop colitis. However, a histopathology similar to that of Sin–/– mice is observed in the SAMP/Yit animals which develop spontaneous and chronic ileitis with resemblance to human Crohn's disease (25). Similar to our Sin-deficient animals, the histopathology of mucosal inflammation in the SAMP/Yit mice is characterized by chronic inflammation, villus infiltration by CD3+ T cells, crypt enlargement, and changes in epithelial cell architecture (25). Interestingly, recent human linkage studies have identified a particular region on chromosome 14, q11.2-12, which correlates with Crohn's disease development and is designated as the inflammatory bowel disease 4 (IBD4) locus (1, 12, 22, 24, 44, 45). The sin/efs genomic locus also localizes in region 14q11.2-12 in close proximity to the IBD4 locus, raising the possibility that Sin plays a role in the development of a Crohn's disease-related enteropathy. In conclusion, as an animal model, the Sin knockout mice may contribute to a better understanding of the mechanisms that drive mucosal inflammation and combined with human studies may implicate Sin in the development of human disease.
|
ACKNOWLEDGMENTS |
|---|
This work was supported in part by the American Cancer Society grant RPG99-09-01MGO, by the Department of Defense grants DAMD17-99-1-9151 and DAMD17-99-1-915, and by the National Institute of Allergy and Infectious Disease grant RO1 AI49387-01.
|
FOOTNOTES |
|---|
L.T.D. and N.M.D. made equal contributions to this work.
Present address: Laboratory of Lymphocyte Signaling, The Rockefeller University, 1230 York Ave., New York, NY 10021.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Alexandropoulos, K., and D. Baltimore. 1996. Coordinate activation of c-Src by SH3- and SH2-binding sites on a novel p130Cas-related protein, Sin. Genes Dev. 10:1341-1355.
3. Alexandropoulos, K., L. T. Donlin, L. Xing, and A. G. Regelmann. 2003. Sin: good or bad? A T lymphocyte perspective. Immunol. Rev. 192:181-195.[CrossRef][Medline]
4. Azzam, H. S., A. Grinberg, K. Lui, H. Shen, E. W. Shores, and P. E. Love. 1998. CD5 expression is developmentally regulated by T cell receptor (TCR) signals and TCR avidity. J. Exp. Med. 188:2301-2311.
5. Bendelac, A., P. Matzinger, R. A. Seder, W. E. Paul, and R. H. Schwartz. 1992. Activation events during thymic selection. J. Exp. Med. 175:731-742.
6. Blumberg, R. S., L. J. Saubermann, and W. Strober. 1999. Animal models of mucosal inflammation and their relation to human inflammatory bowel disease. Curr. Opin. Immunol. 11:648-656.[CrossRef][Medline]
7. Boirivant, M., I. J. Fuss, A. Chu, and W. Strober. 1998. Oxazolone colitis: a murine model of T helper cell type 2 colitis treatable with antibodies to interleukin 4. J. Exp. Med. 188:1929-1939.
8. Bouma, G., and W. Strober. 2003. The immunological and genetic basis of inflammatory bowel disease. Nat. Rev. Immunol. 3:521-533.[CrossRef][Medline]
9. Chiang, Y. J., H. K. Kole, K. Brown, M. Naramura, S. Fukuhara, R. J. Hu, I. K. Jang, J. S. Gutkind, E. Shevach, and H. Gu. 2000. Cbl-b regulates the CD28 dependence of T-cell activation. Nature 403:216-220.[CrossRef][Medline]
10. Cote, J. F., A. Charest, J. Wagner, and M. L. Tremblay. 1998. Combination of gene targeting and substrate trapping to identify substrates of protein tyrosine phosphatases using PTP-PEST as a model. Biochemistry 37:13128-13137.[CrossRef][Medline]
11. Donlin, L. T., C. A. Roman, M. Adlam, A. G. Regelmann, and K. Alexandropoulos. 2002. Defective thymocyte maturation by transgenic expression of a truncated form of the T lymphocyte adapter molecule and Fyn substrate, Sin. J. Immunol. 169:6900-6909.
12. Duerr, R. H., M. M. Barmada, L. Zhang, R. Pfutzer, and D. E. Weeks. 2000. High-density genome scan in Crohn disease shows confirmed linkage to chromosome 14q11-12. Am. J. Hum. Genet. 66:1857-1862.[CrossRef][Medline]
13. Green, P. H., and B. Jabri. 2003. Coeliac disease. Lancet 362:383-391.[CrossRef][Medline]
14. Guy-Grand, D., J. P. DiSanto, P. Henchoz, M. Malassis-Seris, and P. Vassalli. 1998. Small bowel enteropathy: role of intraepithelial lymphocytes and of cytokines (IL-12, IFN-gamma, TNF) in the induction of epithelial cell death and renewal. Eur. J. Immunol. 28:730-744.[CrossRef][Medline]
15. Hayday, A., E. Theodoridis, E. Ramsburg, and J. Shires. 2001. Intraepithelial lymphocytes: exploring the Third Way in immunology. Nat. Immunol. 2:997-1003.[CrossRef][Medline]
16. Hibi, T., H. Ogata, and A. Sakuraba. 2002. Animal models of inflammatory bowel disease. J. Gastroenterol. 37:409-417.[CrossRef][Medline]
17. Kishihara, K., J. Penninger, V. A. Wallace, T. M. Kundig, K. Kawai, A. Wakeham, E. Timms, K. Pfeffer, P. S. Ohashi, M. L. Thomas, et al. 1993. Normal B lymphocyte development but impaired T cell maturation in CD45-exon6 protein tyrosine phosphatase-deficient mice. Cell 74:143-156.[CrossRef][Medline]
18. Kontoyiannis, D., G. Boulougouris, M. Manoloukos, M. Armaka, M. Apostolaki, T. Pizarro, A. Kotlyarov, I. Forster, R. Flavell, M. Gaestel, P. Tsichlis, F. Cominelli, and G. Kollias. 2002. Genetic dissection of the cellular pathways and signaling mechanisms in modeled tumor necrosis factor-induced Crohn's-like inflammatory bowel disease. J. Exp. Med. 196:1563-1574.
19. Kuhn, R., J. Lohler, D. Rennick, K. Rajewsky, and W. Muller. 1993. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 75:263-274.[CrossRef][Medline]
20. Law, S. F., Y. Z. Zhang, S. J. Fashena, G. Toby, J. Estojak, and E. A. Golemis. 1999. Dimerization of the docking/adaptor protein HEF1 via a carboxy-terminal helix-loop-helix domain. Exp. Cell Res. 252:224-235.[CrossRef][Medline]
21. Lefkowitch, J. H. 1999. Hepatic granulomas. J. Hepatol. 30(Suppl. 1):40-45.
22. Ma, Y., J. D. Ohmen, Z. Li, L. G. Bentley, C. McElree, S. Pressman, S. R. Targan, N. Fischel-Ghodsian, J. I. Rotter, and H. Yang. 1999. A genome-wide search identifies potential new susceptibility loci for Crohn's disease. Inflamm. Bowel Dis. 5:271-278.[Medline]
23. Majeti, R., Z. Xu, T. G. Parslow, J. L. Olson, D. I. Daikh, N. Killeen, and A. Weiss. 2000. An inactivating point mutation in the inhibitory wedge of CD45 causes lymphoproliferation and autoimmunity. Cell 103:1059-1070.[CrossRef][Medline]
24. Mathew, C. G., and C. M. Lewis. 2004. Genetics of inflammatory bowel disease: progress and prospects. Hum. Mol. Genet. 13:R161-R168.
25. Matsumoto, S., Y. Okabe, H. Setoyama, K. Takayama, J. Ohtsuka, H. Funahashi, A. Imaoka, Y. Okada, and Y. Umesaki. 1998. Inflammatory bowel disease-like enteritis and caecitis in a senescence accelerated mouse P1/Yit strain. Gut 43:71-78.
26. Merger, M., J. L. Viney, R. Borojevic, D. Steele-Norwood, P. Zhou, D. A. Clark, R. Riddell, R. Maric, E. R. Podack, and K. Croitoru. 2002. Defining the roles of perforin, Fas/FasL, and tumour necrosis factor alpha in T cell induced mucosal damage in the mouse intestine. Gut 51:155-163.
27. Morrissey, P. J., K. Charrier, S. Braddy, D. Liggitt, and J. D. Watson. 1993. CD4+ T cells that express high levels of CD45RB induce wasting disease when transferred into congenic severe combined immunodeficient mice. Disease development is prevented by cotransfer of purified CD4+ T cells. J. Exp. Med. 178:237-244.
28. Murphy, M. A., R. G. Schnall, D. J. Venter, L. Barnett, I. Bertoncello, C. B. Thien, W. Y. Langdon, and D. D. Bowtell. 1998. Tissue hyperplasia and enhanced T-cell signalling via ZAP-70 in c-Cbl-deficient mice. Mol. Cell. Biol. 18:4872-4882.
29. Musch, M. W., L. L. Clarke, D. Mamah, L. R. Gawenis, Z. Zhang, W. Ellsworth, D. Shalowitz, N. Mittal, P. Efthimiou, Z. Alnadjim, S. D. Hurst, E. B. Chang, and T. A. Barrett. 2002. T cell activation causes diarrhea by increasing intestinal permeability and inhibiting epithelial Na+/K+-ATPase. J. Clin. Investig. 110:1739-1747.[CrossRef][Medline]
30. Naramura, M., H. K. Kole, R. J. Hu, and H. Gu. 1998. Altered thymic positive selection and intracellular signals in Cbl-deficient mice. Proc. Natl. Acad. Sci. USA 95:15547-15552.
31. O'Neill, G. M., S. J. Fashena, and E. A. Golemis. 2000. Integrin signalling: a new Cas(t) of characters enters the stage. Trends Cell Biol. 10:111-119.[CrossRef][Medline]
32. Pizarro, T. T., K. O. Arseneau, G. Bamias, and F. Cominelli. 2003. Mouse models for the study of Crohn's disease. Trends Mol. Med. 9:218-222.[CrossRef][Medline]
33. Powrie, F., M. W. Leach, S. Mauze, L. B. Caddle, and R. L. Coffman. 1993. Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal inflammation in C. B-17 scid mice. Int. Immunol. 5:1461-1471.
34. Simpson, S. J., E. Mizoguchi, D. Allen, A. K. Bhan, and C. Terhorst. 1995. Evidence that CD4+, but not CD8+ T cells are responsible for murine interleukin-2-deficient colitis. Eur. J. Immunol. 25:2618-2625.[Medline]
35. Sollid, L. M. 2002. Coeliac disease: dissecting a complex inflammatory disorder. Nat. Rev. Immunol. 2:647-655.[CrossRef][Medline]
36. Songyang, Z., S. E. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W. G. Haser, F. King, T. Roberts, S. Ratnofsky, R. J. Lechleider, et al. 1993. SH2 domains recognize specific phosphopeptide sequences. Cell 72:767-778.[CrossRef][Medline]
37. Sosinowski, T., N. Killeen, and A. Weiss. 2001. The Src-like adaptor protein downregulates the T cell receptor on CD4+CD8+ thymocytes and regulates positive selection. Immunity 15:457-466.[CrossRef][Medline]
38. Stavnezer, J. 1996. Immunoglobulin class switching. Curr. Opin. Immunol. 8:199-205.[CrossRef][Medline]
39. Strober, W., I. J. Fuss, and R. S. Blumberg. 2002. The immunology of mucosal models of inflammation. Annu. Rev. Immunol. 20:495-549.[CrossRef][Medline]
40. Strober, W., I. J. Fuss, R. O. Ehrhardt, M. Neurath, M. Boirivant, and B. R. Ludviksson. 1998. Mucosal immunoregulation and inflammatory bowel disease: new insights from murine models of inflammation. Scand. J. Immunol. 48:453-458.[CrossRef][Medline]
41. Stuber, E., and W. Strober. 1996. The T cell-B cell interaction via OX40-OX40L is necessary for the T cell-dependent humoral immune response. J. Exp. Med. 183:979-989.
42. Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone, and A. H. Sharpe. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3:541-547.[CrossRef][Medline]
43. Tseveleki, V., J. Bauer, E. Taoufik, C. Ruan, L. Leondiadis, S. Haralambous, H. Lassmann, and L. Probert. 2004. Cellular FLIP (long isoform) overexpression in T cells drives Th2 effector responses and promotes immunoregulation in experimental autoimmune encephalomyelitis. J. Immunol. 173:6619-6626.
44. van Heel, D. A., S. A. Fisher, A. Kirby, M. J. Daly, J. D. Rioux, and C. M. Lewis. 2004. Inflammatory bowel disease susceptibility loci defined by genome scan meta-analysis of 1952 affected relative pairs. Hum. Mol. Genet. 13:763-770.
45. Vermeire, S., P. Rutgeerts, K. Van Steen, S. Joossens, G. Claessens, M. Pierik, M. Peeters, and R. Vlietinck. 2004. Genome wide scan in a Flemish inflammatory bowel disease population: support for the IBD4 locus, population heterogeneity, and epistasis. Gut 53:980-986.
46. Watanabe, M., Y. Ueno, T. Yajima, S. Okamoto, T. Hayashi, M. Yamazaki, Y. Iwao, H. Ishii, S. Habu, M. Uehira, H. Nishimoto, H. Ishikawa, J. Hata, and T. Hibi. 1998. Interleukin 7 transgenic mice develop chronic colitis with decreased interleukin 7 protein accumulation in the colonic mucosa. J. Exp. Med. 187:389-402.
47. Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K. P. Lee, C. B. Thompson, H. Griesser, and T. W. Mak. 1995. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270:985-988.
48. Wirtz, S., and M. F. Neurath. 2000. Animal models of intestinal inflammation: new insights into the molecular pathogenesis and immunotherapy of inflammatory bowel disease. Int. J. Colorectal Dis. 15:144-160.[CrossRef][Medline]
49. Xing, L., L. T. Donlin, R. H. Miller, and K. Alexandropoulos. 2004. The adapter molecule Sin regulates T-cell-receptor-mediated signal transduction by modulating signaling substrate availability. Mol. Cell. Biol. 24:4581-4592.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
