Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2005, p. 1228-1237, Vol. 25, No. 4
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.4.1228-1237.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Cancer Biology and Genetics Program,1 Department of Pathology,2 Computational Biology Program,3 Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York,5 Department of Pathology, Albert Einstein College of Medicine, Bronx, New York4
Received 11 June 2004/ Returned for modification 30 July 2004/ Accepted 18 November 2004
|
|
|---|
|
|
|---|
HCC is strongly associated with chronic infection by hepatitis B virus (HBV) and hepatitis C virus (HCV): incidence of HCC correlates with HBV and HCV infection rates within a population, and the average age of onset is inversely correlated with the prevalence of HBV infection (4, 39, 45). Although the precise mechanisms by which HBV and HCV predispose to HCC are unclear, the current belief is that the liver damage and regeneration associated with chronic viral infection provide a context where oncogenic genetic alterations can occur and become fixed. The X protein encoded by HBV, through its regulation of calcium signaling that is critical for HBV replication, is thought to play an important role in this process (6). Other factors that predispose to the occurrence of HCC are prolonged exposure to aflatoxin B1, cirrhosis of any etiology, hemochromatosis, congenital hepatic fibrosis, and biliary atresia (22).
Alterations in the TP53 gene are frequently found in HCC. Further, the absence of TP53 gene alterations in hepatic adenomas suggests that this is a late event in tumor progression (7). Silencing of the INK4A locus has also been observed in a majority of HCC patients (7, 26, 28). In addition, several chromosome armsincluding 1p, 4q, 6q, 9p, 13q, and 17pare deleted in significant subsets of human HCC, suggesting the presence of important tumor suppressor genes at those loci (7). Interestingly, deregulation of the Wnt signaling pathway appears to be an important event in a subset of HCC tumors. Activating mutations in the positive effector ß-catenin have been described, as have inactivating mutations in axin, a negative regulator of the Wnt signaling pathway (7). Furthermore, amplifications of the c-myc and CCND1 oncogenes, which are downstream targets of the Wnt signaling pathway, have been described in HCC patients (1, 32).
Mouse models for HCC have been generated by several investigators using traditional transgenic approaches and tetracycline-regulated transgene expression (5, 8, 9, 18, 27, 31, 42, 44, 48). These models have yielded important information about HCC but have two very important limitations. First, the transgene is expressed in all of the target cells, creating a field effect in which every hepatocyte within the liver has altered gene expression. Indeed, in some of the published models mice die shortly after birth with hepatic defects and atypical liver architecture (42). Second, it is very expensive and time consuming to cross these models to generate models with combinations of genetic lesions. This has prevented direct comparison of different mouse models for HCC. Clearly, a mouse model in which the effects of different oncogenes could be directly compared would represent a significant advance in the field. Recently, Harada et al. have described an HCC mouse model that bypasses some of these deficiencies by using adenovirus-mediated delivery of Cre recombinase to activate expression of constitutively active forms of the H-Ras and ß-catenin oncoproteins (14).
We report here the generation of a mouse model for HCC through the targeted delivery of oncogene-bearing avian leukosis sarcoma virus subgroup A (ALSV-A)-based RCAS vectors (replication-competent ALSV retroviral vectors) into transgenic mice in which expression of the ALSV-A receptor TVA is regulated by the albumin gene promoter and enhancer sequences. Mammalian cells are normally resistant to infection by ALSV and ALSV-based vectors (49). However, expression of the ALSV-A receptor, TVA, renders mammalian cells susceptible to infection by ALSV-A and ALSV-A-based vectors (3, 51). Delivery of avian cells that produce RCAS viruses encoding mouse polyoma virus middle T antigen (PyMT) induces the formation of liver adenomas with high levels of penetrance. The induced tumors display increased proliferation, low apoptotic rates, induction of angiogenesis, and activation of downstream effectors of PyMT, including Akt and Erk (extracellular signal-regulated kinase). Delivery of RCAS-PyMT producer cells to TVA-expressing mice deficient for the tumor suppressor protein p53 induces progression to invasive carcinomas that metastasize to the lung. Introduction of phosphorylation site mutants of PyMT into TVA-positive, p53 null mice demonstrates that the activity of the oncogene is critical for the invasive and metastatic behavior of tumors in p53 null mice. Finally, utilizing gene expression microarrays, we have identified several potential mediators of the metastatic tumor behavior. Thus, we have generated a somatic model for HCC that can be utilized to dissect the molecular pathways involved in the initiation and progression of this malignancy.
|
|
|---|
Virus delivery. The RCAS-green fluorescent protein (GFP), RCAS-PyMT, and RCAS-c-myc vectors have been previously described (12, 16, 35). DF1 chicken fibroblasts (15, 43) transfected with RCAS vectors were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum in humidified 37°C incubators under 5% CO2. Cells to be injected were harvested, washed once with phosphate-buffered saline (PBS), and resuspended in PBS at a final concentration of 2 x 105 cells/µl. A total of 5 µl of the cell suspension was delivered by injection into the liver parenchyma of 2- or 3-day old animals with Hamilton syringes attached to 26-gauge needles.
Tumor harvest and histology. Animals were sacrificed with a lethal dose of CO2 per institutional guidelines. Tumors, liver tissue, and lungs were removed and either fixed in 10% buffered formalin overnight at room temperature or snap-frozen in liquid nitrogen. Fixed tissues were paraffin embedded, and 5-µm sections were placed on sialynated slides at Histoserv, Inc. (Gaithersburg, Md.).
Magnetic resonance imaging. Mice were assessed individually by magnetic resonance imaging (MRI) for tumor establishment. Images were obtained on a 1.5T General Electric LX Echo Speed Signa scanner (General Electric Medical Systems, Milwaukee, Wis.) with homemade foil solenoid coils (inner diameter, 27 mm). The mice were anesthetized with isofluorane throughout image acquisition. Images were acquired with a two-dimensional spin-echo pulse sequence. Initially, the animal was positioned in the coil in a holder, and sagittal scout T1 weighted spin-echo images and axial scout T2 weighted spin-echo images were obtained to localize the region of interest. For tumor detection, high-quality T1 and T2 (spin-spin relaxation time) weighted fast spin-echo transverse images were obtained with in-plane resolution of 156 by 156 µm or 156 by 208 µm and 1.5-mm-thick slices.
Immunohistochemistry. Paraffin sections were deparaffinized and rehydrated by passage through Clear-Rite 3 and a graded alcohol series. Endogenous peroxidase activity was inactivated by treatment with 3% hydrogen peroxide, after which antigen retrieval was performed utilizing heated citric buffer. Slides were blocked for 1 h and then incubated with a rabbit anti-Ki67 antibody (Novocastra) at a dilution of 1:1,000 for 1 h at room temperature. After being washed with PBS, slides were incubated with secondary antibody according to the manufacturer's instructions (Vector Labs, Burlingame, Calif.). Substrate incubation and color development were performed according to the manufacturer's instructions (Vector Labs).
In situ hybridization. Freshly generated paraffin sections were rehydrated as described above. After being blocked for 3 h in prehybridization solution (21), slides were hybridized to 4 x 106 cpm of 33P-labeled antisense RNA probes specific for PyMT. Washes were performed as previously described (50). Slides were then dipped in warm photographic emulsion and exposed for 2 weeks before development.
RNA isolation. Frozen tissue samples were pulverized with a mortar and pestle, the ground tissue was lysed in Trizol reagent (Invitrogen), and RNA was extracted according to the manufacturer's instructions. The isolated RNA was purified over an RNeasy column (QIAGEN) according to the manufacturer's protocol. The RNA concentration was determined by a spectrophotometer, ethanol precipitated, and resuspended at a final concentration of 1 µg/µl.
Immunoblotting.
DF1 cells were collected in cell-scraping buffer, pelleted, and lysed in 10% sodium dodecyl sulfate by being boiled for 10 min. Chromatin was then sheared by passage through a 27-gauge needle. Protein concentration was determined with the BCA assay kit (Pierce, Rockford, Ill.), and equal amounts of protein were loaded per lane. Ground frozen tissue samples were lysed in 10% sodium dodecyl sulfate by being boiled as described above. Protein concentrations were determined as described above, and equal amounts of protein were loaded per lane. After being transferred to nitrocellulose membranes, primary antibodies were incubated overnight at 4°C in Tris-buffered saline-1% Tween 20 and the appropriate blocking reagent, according to the manufacturer's instructions. After being washed with Tris-buffered saline-0.1% Tween 20, blots were incubated with the appropriate secondary antibodies (Jackson Immunochemicals) at room temperature for 45 min. Chemiluminescence was performed with Super Signal reagent (Pierce). Primary antibodies used were as follows: rat anti-polyoma T antigens, 1:3,000 dilution (gift of Michelle Fluck); rabbit anti-phosphorylated AKT (anti-p-AKT), 1:1,000 dilution (Cell Signaling); rabbit anti-p-mitogen-activated protein kinase (anti-p-MAPK), 1:1,000 dilution (Cell Signaling); rabbit anti-Akt, 1:1,000 dilution (Cell Signaling); rabbit anti-MAPK, 1:1,000 dilution (Cell Signaling); mouse anti-
-tubulin, 1:2,000 dilution (Sigma).
Reverse transcription-PCR (RT-PCR). A total of 0.5 µg of purified total RNA was utilized for RT-PCR. All RT-PCRs were performed with the Superscript One-Step RT-PCR kit (Invitrogen). For amplification of cathepsin E, reverse transcription was performed at 55°C for 30 min, followed by denaturing at 94°C for 2 min and amplification for 35 cycles with the following parameters: denaturing at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1 min. Amplification conditions for insulin-like growth factor 2 (Igf2) and H19 were as above for cathepsin E, except the annealing temperature was 60°C for Igf2 and 58°C for H19. For ß-actin, reactions were performed under identical conditions except the amplification was performed for 25 cycles. For tv-a, reactions were performed at an annealing temperature of 55°C for 35 cycles in the presence of 5% dimethyl sulfoxide.
Primers were as follows: tva5, 5'CTGCTGCCCGGTAACGTGACCGG 3'; tva31, 5'GCCCTGGGGAAGGTCCTGCCC 3'; cathepsin E F1, 5'ATAAGAGTTGCTTAAAGTCG 3'; cathepsin E B1, 5'GAGAAATGATTCCCTACCTC 3'; Igf2 F2, 5'TGGTCCCAGAGAGGTTTTAGGTGG 3'; Igf2 B2, 5'ACTTGCTCCCGCCTGATGTAAC 3'; H19 F1, 5'AGGGGGCCTGGTGAGAAGAA 3'; H19 B1, 5'ATGGGAATGGTGTGTCTGCA 3'; actin F1, 5'GGCTGTATTCCCCTCCATCG 3'; and actin B1, 5'AGATGGGCACAGTGTGGGTG 3'.
Gene expression array analysis.
The quality of RNA was ensured before labeling by analysis of 20 to 50 ng of each sample with the RNA 6000 NanoAssay and a Bioanalyzer 2100 (Agilent). Samples with a 28S/18S ribosomal peak ratio of 1.8 to 2.0 were considered suitable for labeling. For samples meeting this standard, 5 µg of total RNA was used for cDNA synthesis with an oligo(dT)-T7 primer and the SuperScript Double-Stranded cDNA Synthesis kit (Invitrogen). Synthesis, linear amplification, and labeling of cRNA were accomplished by transcription in vitro with the MessageAmp cRNA Kit (Ambion) and biotinylated nucleotides (Enzo Diagnostics). Ten micrograms of labeled and fragmented cRNA was then hybridized to the murine genome array U74A, version 2.0 (Affymetrix), which contains
12,000 oligonucleotide-based probe sets, at 45°C for 16 h. Automated washing and staining were performed with the Affymetrix Fluidics Station 400 according to the manufacturer's protocols, and probe intensities were measured with the argon laser confocal GeneArray scanner (Hewlett-Packard). Raw expression data were analyzed with Microarray Analysis 5.0 software (Affymetrix). Data were normalized to a target intensity of 500 to account for differences in global chip intensity. The data were then clustered both by genes and by samples. For gene clustering, the data were filtered with the P value from a Wilcoxon test between tumor and normal samples. The genes selected in this manner were then clustered with the angle correlation metric and a variant of the k means-clustering algorithm (46). For the clustering of samples, the genes were first filtered to include only those that scored present in at least four of the samples. The correlation metric was used with average linkage hierarchical clustering. To assess the robustness of the clustering results, a parametric bootstrapping procedure was done. The data was resampled and clustered 1,000 times, and a final tree was built by the consensus tree method (11). In addition, to find genes that discriminated between the tumor classes (p53 wild type versus p53 null) a variant of the t test was used. In this t test, the variance was regularized by a term that depended on the overall intensity of the samples (2).
|
|
|---|
![]() View larger version (80K): [in a new window] |
FIG. 1. Characterization of albumin-tv-a transgenic mice. (Top) Ethidium bromide-stained agarose gel showing the presence of TVA mRNA in selected tissues in albumin-tv-a transgenic mice, as detected by RT-PCR. Amplification of ß-actin mRNA is shown as a control in the lower panel. (Bottom) Identification of proliferating cells in the liver of 2-day-old mice (left) and 6-week-old mice (right) by immunohistochemical staining for the proliferation-associated marker Ki67. Original magnification, x100.
|
RCAS-PyMT induces liver tumors with high penetrance. To attempt to induce liver tumors, we injected DF-1 chicken fibroblasts producing RCAS viruses encoding PyMT into the livers of 2- or 3-day-old albumin-tv-a transgenic animals, when the organ is easily visualized beneath the skin. A pilot experiment was performed on a litter of three tv-a-positive mice. Sacrifice of the litter at 3 months of age identified a single tumor-bearing animal. Given these findings, we subsequently injected other litters with RCAS-PyMT and sacrificed the mice at either 4 or 6 months of age to identify the presence of tumors. Of the animals analyzed in this fashion, 8 of 11 mice sacrificed at 4 months of age, and 9 of 15 mice sacrificed at 6 months of age displayed grossly visible liver tumors (Table 1). Further, tumor formation was dependent on the presence of TVA, as none of 11 tv-a-negative littermates injected with RCAS-PyMT developed tumors. In addition, only 1 of 16 tv-a-positive animals injected with RCAS-GFP and aged for 13 months developed a liver tumor (Table 1). This tumor may have occurred as a result of insertional mutagenesis, although we have not assayed for the presence of integrated proviral DNA.
|
View this table: [in a new window] |
TABLE 1. Tumor induction by RCAS-PyMT in albumin-tv-a transgenic micea
|
![]() View larger version (90K): [in a new window] |
FIG. 2. RCAS-PyMT induces liver tumors in albumin-tv-a transgenic mice. (A) Hematoxylin and eosin (H&E)-stained sections demonstrating the presence of liver lesions in a 6-month-old albumin-tv-a transgenic animal injected with RCAS-PyMT. Magnification, x25 (left), x100 (right). N, normal liver tissue; T, tumor. (B) Determination of hepatocyte plate size by reticulin staining for basement membrane in normal adult liver tissue (left) and tumor tissue (right) sections. Green bars indicate widths of hepatocyte plates. Original magnification, x200. (C) Detection of liver tumors by MRI. (Left) T2 weighted MRI image demonstrating the presence of liver tumors (red arrows); (right) a photograph of the liver of the animal after euthanasia 24 h later. Arrows indicate the location of the tumors.
|
Characterization of PyMT-induced tumors. To confirm that the tumors in mice exposed to RCAS-PyMT arose from RCAS-infected cells, we first determined whether the identified tumors expressed PyMT. Protein lysates from tumors and normal liver tissue were analyzed by immunoblotting with a rat serum raised against mouse polyoma virus T antigens. PyMT was readily detected in all tumor samples but not in normal liver tissue from an uninfected transgenic mouse (Fig. 3A). We then assayed the activation state of the Akt and Erk kinases, which are known to act downstream of PyMT-mediated signaling pathways (13). Western blot analysis showed that both Akt and Erk are more highly phosphorylated, and presumably more active, in tumors than in normal tissue (Fig. 3B).
![]() View larger version (60K): [in a new window] |
FIG. 3. Characterization of induced liver tumors. (A) Detection of PyMT by immunoblotting with anti-PyMT serum of protein lysates from normal adult liver tissue (N) and three representative tumors (T1 to T3). (B) Increased p-Akt/total Akt, and p-MAPK/total MAPK ratios in RCAS-PyMT-induced liver tumors in comparison to age-matched adult liver tissue detected by immunoblotting. (C) Enhanced proliferation in induced liver tumor (left) in comparison to adjacent normal tissue (right) as determined by immunohistochemical staining for Ki67.
|
The loss of the TP53 tumor suppressor gene is a common event in HCC. We therefore sought to determine whether loss of this tumor suppressor was required for tumor formation. We analyzed genomic DNA from three tumors induced in albumin-tv-a mice for the presence of the p53 locus by PCR. All tumors were positive for the presence of p53. We next amplified cDNA from four tumors corresponding to nucleotides 719 to 1150 of the p53 coding sequence, which contains several mutation hotspots found in human tumors, and sequenced the PCR products. No mutations were identified in any of the tumors. Thus, inactivation of p53 does not appear to be required for tumor formation.
The p19ARF tumor suppressor mediates oncoprotein signaling to p53 (53). We therefore determined whether this tumor suppressor was inactivated during tumor formation. We performed RT-PCR on RNA isolated from four tumor samples and four normal liver tissue samples. All tumors displayed elevated p16 and p19 mRNA levels compared to normal liver tissue, indicating that the Ink4a locus is intact and not silenced by gene methylation (data not shown).
The absence of p53 induces lung metastasis. The TP53 tumor suppressor is frequently inactivated in human HCC. We therefore sought to determine the effect of p53 deficiency on tumor formation. Albumin-tv-a transgenic mice were bred to animals null for p53 as a result of gene targeting to generate cohorts of transgenic mice that were either heterozygous or null for p53 (17). Newborn mice from these crosses were injected with RCAS-PyMT producer cells and monitored for tumor formation. Of 38 TVA-positive, p53 heterozygous animals injected with RCAS-PyMT, 14 were found to have tumors after sacrifice at either 4 or 6 months of age (Table 1). Similarly, tumor incidence in the injected p53 null littermates was not increased, with 18 of 43 animals found to have tumors after sacrifice (Table 1). These data suggest that the absence of p53 does not promote tumor initiation in this model. It should be noted, however, that some of the p53 null animals were sacrificed as early as 9 weeks of age due to the presence of thymic lymphomas, sarcomas, or hemangiosarcomas and were maintained for no longer than 4 months. The reduced life span of these mice may have reduced tumor occurrence or detection of liver tumors.
Although the absence of p53 appeared to have no effect on tumor initiation, it greatly influenced tumor behavior. While only 1 of 17 p53 wild-type and 1 of 14 p53 heterozygous tumor-bearing mice developed lung metastases, 6 of 16 tumor-bearing p53 null mice analyzed displayed lung metastases (Table 1). Furthermore, in p53 null animals bearing primary tumors larger than 6 mm in diameter, lung metastases were observed in six of seven animals. By contrast, only one of six p53 wild-type mice bearing tumors larger than 6 mm in diameter had lung metastases. On histologic examination, the tumors in p53 null mice were shown to contain regions that resembled the tumors induced in p53 wild-type mice. However, the tumors from p53 null animals also contained regions with highly disorganized and undifferentiated cells (Fig. 4A). Such regions were not seen in tumors identified in p53 wild-type or p53 heterozygous animals, including those that exceeded 6 mm in diameter. Histologically, the pulmonary lesions resembled the undifferentiated regions identified within the primary tumors, suggesting that the metastatic cells were derived from these regions (Fig. 4B).
![]() View larger version (79K): [in a new window] |
FIG. 4. RCAS-PyMT-induced tumors in p53 null mice. (A) H&E-stained tissue sections demonstrating the histologic features of p53-deficient liver tumors. Three regions of a single tumor are shown. (B) Histologic features of lung metastasis identified in the same animal. Note that the metastasis most closely resembles region 2 of the primary tumor. (C) Detection of PyMT RNA in the lung metastasis by in situ hybridization with 33P-labeled antisense PyMT RNA.
|
p53 null and p53 wild-type tumors display different gene expression profiles.
The difference in metastatic potential displayed by tumors in p53 null and wild-type mice raised the possibility that these effects may be mediated by differences in gene expression. We therefore determined the gene expression profiles of a subset of tumors from p53 wild-type and p53 null mice, as well as normal liver tissue obtained from p53 wild-type and p53 null adult animals, by Affymetrix oligonucleotide arrays. Unsupervised hierarchical clustering of the expression array data demonstrated that the tumor samples were readily distinguished from the normal tissue samples (Fig. 5A). We used the Wilcoxon rank sum test to find genes that differentiated between normal and tumor samples. Over 500 genes were identified that differentiated between normal and tumor samples with a P value of
0.00067 (see Table S1 in the supplemental material). Among the genes more highly expressed in tumors was the proliferation marker Ki67, reflecting the increased proliferation of the tumor cells compared to normal cells (Fig. 2C), and JunB, a member of the AP-1 transcription factor family. We also identified elevated expression of another AP-1 family member, JunD, by immunohistochemical staining (data not shown). Interestingly, several proapoptotic genes, including Bax and 24p3 (lipocalin), were elevated in the tumors compared to normal tissues. However, increased mRNA levels were detected for the antiapoptotic gene TIAP (survivin), suggesting a possible mechanism for the absence of increased apoptosis in the tumors.
![]() View larger version (49K): [in a new window] |
FIG. 5. p53 null and p53 wild-type tumors have different gene expression profiles. (A) Hierarchial clustering of normal liver tissue and tumor samples using 532 genes that most strongly discriminate between the two classes. The sample marked by an asterisk (*) shows data from a small p53 null tumor that clusters with normal tissue from p53 null livers, indicating possible contamination with normal tissue. The genes present in the cluster are identified in Table S1 in the supplemental data. (B) Analysis of clustering of p53 null and p53 wild-type tumors using 100 genes that most strongly discriminate between the two tumor groups. The genes present in the cluster are identified in Table S2 in the supplemental data. (C) Confirmation of differential expression by RT-PCR. RT-PCR assays demonstrating elevated expression of cathepsin E, Igf2, and H19 genes in p53 null tumors relative to p53 wild-type tumors.
|
The gene expression studies further demonstrated that the tumors with the ability to metastasize have an expression profile that is distinct from that of the nonmetastatic tumors induced in p53 wild-type mice. To identify genes that differentiated between these two groups, a variant t test was used (see Materials and Methods) which corrects the variance with a term that depends on the intensity of the samples. (There were not enough samples in each group to use the Wilcoxon test.) By means of the variance-corrected t test, 105 genes were identified as highly differentially expressed between the two tumor types (Fig. 5B; see Table S2 in the supplemental material). The greatest fold-change in expression was found for the cathepsin E gene, which encodes a protein previously shown to colocalize to the invasive edge of gastric tumors (29). RT-PCR of RNA extracted from tumors from p53 null and p53 wild-type animals confirmed the strongly elevated expression of this gene in the p53 null tumors (Fig. 5C). Several other genes of potential significance were also differentially expressed between the two tumor groups. These differences include an increase in Igf2 gene mRNA, and decreased RNA carrying the insulin-like growth factor binding protein 2 gene (Igfbp2), a negative regulator of Igf2 signaling. Both Igf2 and Igfbp2 have been previously implicated in tumor cell migration and invasion (37, 41, 52). We confirmed by RT-PCR the differential expression of Igf2 and H19, a gene located adjacent to Igf2 and shown to be elevated in p53 null tumors compared to tumors induced in p53 wild-type mice (Fig. 5C). Interestingly, differences in the mRNA levels for known p53 target genes such as p21 and mdm2 were not detected by the gene array studies. Thus, gene expression profiling of liver tumors induced in this model system identifies a set of changes that are associated with, and might be responsible for, invasion and metastasis.
PyMT phosphorylation mutants fail to induce lung metastasis. The above findings demonstrated that PyMT can induce liver tumors with metastatic potential in the absence of p53. We therefore sought to identify the signaling pathways induced by PyMT that might be crucial to this process. PyMT is activated by binding to the c-Src protein, followed by Src-mediated phosphorylation of several critical tyrosine residues. We therefore generated RCAS vectors encoding PyMT proteins with mutations at tyrosine residues previously demonstrated to play critical roles in cellular transformation in other systems (33). One mutant, RCAS-PyMT Y250A, expresses a protein with a tyrosine-to-alanine change at residue 250 that eliminates binding of ShcA to PyMT and prevents activation of Ras-mediated signaling pathways downstream of PyMT (13). Another mutant, RCAS-PyMT Y315 322A, expresses a protein with tyrosine-to-alanine changes at residues 315 and 322 which have been demonstrated to be critical for activation of phosphatidylinositol 3 (PI3)-kinase-mediated signaling pathways by PyMT (13). Production of the mutant PyMT proteins with the expected size was verified by immunoblotting of extracts from DF1 cells infected with RCAS vectors encoding the PyMT mutants (Fig. 6A).
![]() View larger version (71K): [in a new window] |
FIG. 6. Phosphorylation site mutants of PyMT fail to induce lung metastasis. (A) Western blot demonstrating the expression of wild-type and mutant PyMT proteins in DF-1 fibroblasts (top). -Tubulin is shown as a loading control (bottom). (B) Histology of tumors induced by RCAS-PyMT Y315 322A in albumin-tv-a p53 null mice. H&E-stained tissue sections from normal liver tissue (left) and two regions of a single tumor (middle and right). Note the retention of hepatocyte cords in region 2 of the tumor (right).
|
|
View this table: [in a new window] |
TABLE 2. Tumor induction by RCAS viruses encoding PyMT phosphorylation site mutantsa
|
|
|
|---|
While the tumors induced in albumin-tv-a transgenic mice with an otherwise normal genetic background can grow to sizes exceeding 1 cm in diameter, they rarely metastasize to the lung or other organs. This suggests that additional genetic alterations are required to produce an invasive and metastatic phenotype. In agreement with this hypothesis, we find that while p53 nullizygosity does not enhance tumor initiation, the resulting tumors are more aggressive and have a greater capacity for invasion and metastasis to the lung. This increased aggressiveness is not simply due to increased proliferation or decreased apoptosis, as these occur at rates similar to those of p53 wild-type tumors (data not shown). Despite our use of mice with mixed genetic backgrounds, the phenotypic changes seen in the p53 null background are unlikely to be the result of strain background changes, as tumors induced in p53 heterozygous littermates are nonmetastatic and display the histologic features of tumors induced in p53 wild-type animals.
Interestingly, we find that inactivation of one or both alleles encoding the p53 tumor suppressor protein does not enhance the appearance of liver tumors. These findings are consistent with those reported by Balmain and colleagues a decade ago that demonstrated that loss of p53 did not promote tumor initiation in a skin carcinogenesis model (19). They are also consistent with findings in human hepatic adenomas and HCC that suggest that mutation of TP53 is a late event in HCC development (7). In agreement with this, we find that tumors induced in p53 wild-type mice retain p53 and do not lose expression of the p19Arf tumor suppressor protein, which mediates oncoprotein stimulation of p53 activity (53).
The differences in tumor behavior may be mediated through changes at multiple levels, including transcription regulation and mRNA stability. To determine the contribution of changes in mRNA levels, we used Affymetrix oligonucleotide arrays to explore the gene expression profiles of tumors identified in tv-a transgenic mice in p53 null and p53 wild-type backgrounds. Statistical analysis of the gene expression data identified over 100 genes that were differentially expressed between the two groups and which therefore represent potential mediators of the metastatic phenotype of the p53 null tumors. Consistent with this hypothesis, among the genes shown to be differentially expressed are the cathepsin E, Igf2, and Igfbp2 genes. These three genes encode proteins that have been demonstrated to be involved in tumor cell invasion and metastasis in various experimental systems, and their expression correlates with the invasive capacity of human tumors in vivo (29, 37, 41, 52). Whether these molecules play important roles in tumor invasion in human HCC is yet to be determined and provides an avenue for further exploration. Interestingly, our gene expression studies did not identify any known p53 transcriptional targets, such as p21CIP1, as molecules that differentiate between tumors induced in p53 wild-type and p53 null animals.
Our gene expression arrays also identified more than 500 genes whose mRNA levels distinguish RCAS-PyMT-induced liver tumors from normal liver tissue, independent of p53 gene status. Several of these genes or their family members, such as JunB and Rbl2, have been identified as misexpressed in human HCC or are critical mediators of tumor initiation in animal models of HCC (7, 10). These findings validate our model and suggest that there are common critical signaling pathways required for HCC tumor formation independent of the identity of the initiating oncogenic lesion. Interestingly, we identified elevated expression of multiple members of the AP-1 transcription factor family in the PyMT-induced tumors, irrespective of p53 gene status. These data are consistent with findings in other HCC models, suggesting a critical role for AP-1-mediated transcription in the initiation of liver tumorigenesis (10). However, the identity of the AP-1 transcription targets involved in HCC initiation remains to be elucidated. Importantly, because it is not necessary to generate a new transgenic line for each oncogene to be evaluated, the hypothesis that there are common pathways to HCC initiation can be readily tested in our model system through the introduction of other oncogene-bearing RCAS virusesincluding those encoding c-Myc, ß-catenin, and cyclin D1which have all been implicated in the pathogenesis of the human disease (7).
The induction of tumors by RCAS-PyMT in genetically normal mice suggests that the activation of Ras- and PI3-kinase-mediated signaling pathways downstream of PyMT is sufficient for the initiation of tumorigenesis in the liver. Moreover, activation of these pathways is required as reduced signaling through either of these pathways impairs tumor initiation, consistent with findings reported in other model systems (33). Interestingly, impairment of signaling through these pathways inhibits the formation of lung metastases in a p53-deficient genetic background. Thus, the development of lung metastasis is dependent on both the absence of p53 function and signaling through Ras- and PI3-kinase-dependent signaling pathways.
In the experiments described here, we illustrated the utility of somatic delivery of oncogenes to the liver using the potent mouse PyMT oncoprotein. However, the model is also amenable to testing the requirements for the induction of liver tumors by the c-Myc, cyclin D1, and ß-catenin oncoproteins, all of which are either overexpressed or activated in a significant fraction of human HCC. Indeed, we have analyzed the ability of c-Myc to induce liver tumors when delivered in RCAS vectors and have not observed liver tumors even in the absence of p53 (B. C. Lewis and H. E. Varmus, unpublished results). These findings suggest that additional mutations are required for initiation of liver tumorigenesis by c-Myc. The additional mutations may include expression of the HBV X protein or silencing of the INK4A locus, both highly prevalent events in HCC (7). These findings are consistent with earlier transgenic mouse models that demonstrated that c-Myc required the presence of other oncogenic lesions to induce liver tumors (31, 47). Further, the requirements for tumor induction by c-Myc can be compared to those for ß-catenin and cyclin D1, using a single transgenic mouse line, as can the molecular characteristics of the induced tumors. Thus, the tumor model described here should prove to be a valuable tool in the elucidation of the molecular features of HCC development.
This work was supported by NIH grants R24CA83084, CA08748, and CA94060 (J.A.K.). B.C.L. was supported by a Helen Hay Whitney Foundation postdoctoral fellowship and a Career Award in the Biomedical Sciences from the Burroughs Wellcome Fund.
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
|
|
|---|
ß3 negatively modulates IGF-I-mediated migration and tumor growth. Cancer Res. 64:977-984.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»