![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Biochemistry and Molecular Biology, Program in Genes and Development, Graduate School of Biological Sciences, University of Texas M. D. Anderson Cancer Center, Houston, Texas1
Received 10 September 2004/ Returned for modification 18 October 2004/ Accepted 10 December 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To date, there is considerably less knowledge of changes in chromatin structure that promote repression, versus activation, of ongoing gene expression, especially during mammalian development. Early studies of rat skeletal muscle differentiation in vivo documented a decrease in global levels of acetylated histones from 3 days postpartum (pp) to the age of 1 month (54). More recently, the essential roles that class II histone deacetylases (HDACs) play in muscle differentiation and the signaling pathways that control their activities have been defined (reviewed in reference 44). Detailed studies of thymocyte maturation have shown that an ordered process of histone modification occurs: deacetylation of H3K9, loss of H3K4 methylation, and increased H3K9 methylation, concomitant with gene-specific silencing during differentiation (65).
Active alpha-fetoprotein (AFP) gene expression occurs during the rapid growth and replication periods of fetal hepatic development. After concomitant tissue-specific activation of the highly homologous AFP and albumin (ALB) genes in fetal liver, the expression levels of each are regulated autonomously. As the postnatal liver differentiates and gains full metabolic function, AFP gene activity is repressed to nearly undetectable levels and ALB expression is maintained (reviewed in references 8, 66, and 73). Renewed AFP expression occurs only when the differentiated liver exits G0 and enters a program of resumed cellular proliferation, as a consequence of hepatic tumorigenesis, liver regeneration, or tissue damage due to chronic disease (reviewed in references 4 and 63). Reactivation of AFP gene expression in hepatocellular carcinomas is widespread, with 70 to 85% of all hepatocellular carcinoma patients expressing the gene at varying levels (48), underscoring one role of AFP as a diagnostic tumor marker.
Previously, we showed that the tumor suppressor p53 is a sequence-specific repressor of AFP transcription which binds at –850 within the identified developmental repressor and represses transcription of chromatin-assembled AFP in vitro (39, 52). Chromatin immunoprecipitation (ChIP) and expression analyses of developmentally staged wild-type (WT) and p53-null liver tissue, presented here, support the function of p53 as a direct developmental repressor of AFP expression in vivo. These studies suggest a mechanism whereby repression-associated histone modifications, histone-modifying complexes, and heterochromatin protein 1 (HP1) are targeted specifically to AFP by p53 during hepatic development.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ChIP of solid tissues. Liver and brain tissues from C57BL/6J WT and p53–/– mice were isolated, cross-linked, and processed for ChIP analyses as described previously, with some modifications (71). Modifications to this protocol included sonication of the cross-linked chromatin with glass beads (Sigma G-1277), followed by digestion with micrococcal nuclease (4 U/µl; Worthington Biochemicals) to generate fragments with an average length of less than 400 to 500 bp, as determined empirically by agarose gel electrophoresis of fragmented chromatin samples. The fragmented chromatin lysate was incubated with nonspecific immunoglobulin G (IgG) for 1 h to preclear the lysate. This precleared lysate was incubated overnight with specific antibodies, and protein A-Sepharose beads (preblocked with salmon sperm DNA) were added for a 1-h incubation, followed by recovery of antibody precipitates (6, 7).
Antibodies against the following proteins and residues were added to 20 µl of lysate for ChIP: p53 (Ab1 OP03, 15 µl; Oncogene), normal sheep IgG (12-369, 5 µl; Upstate), acetylated histone H4 (AcH4) (06-860, ChIP grade, 5 µl; Upstate), acetylated histone H3 lysine 9 (AcH3K9) (06-942, 5 µl; Upstate), dimethylated H3 K4 (DiMetH3K4) (07-030, 5 µl; Upstate), DiMetH3K9 (07-212, 5 µl; Upstate), trimethylated H3 K4 (TriMetH3K4) (ab8580-50, 5 µl; Abcam), H3 (ab1791-100, 10 µl; Abcam), FoxA (ab5089-100, 6 µl; Abcam), RNA polymerase II phosphoserine 5 (MMS-134R, 2 µl; Covance), mSin3A (06-913, 3 µl; Upstate), HDAC1 (06-720, 5 µl; Upstate), HP1
(05-689, 5 µl; Upstate), and TFIID/TATA-binding protein (TBP) (sc-273, 30 µl; Santa Cruz).
To analyze specific antibody-bound DNA fractions, quantitative PCRs were performed using Taq polymerase (Continental Labs) and primers were generated to detect the AFP SBE/p53RE region of –887 to –762 (forward primer, TAAAAAATAAACTCAACTACATATG; reverse primer, GAAAACTTTTAAAACTTCCC), the AFP start site region of –82 to +94 (forward primer, CATATGTTTGCTCACTGAAGGTTAC; reverse prime, CGCAGCGAAATGTAGCAGGAGGA), the ALB enhancer region of 151 bp, 11 kb upstream of the transcription start site (7, 40, 45) (forward primer, GGGACGAGATGTACTTTGTG; reverse primer, GATCAGTCCAAACTTCTTTCTG), and the Brn-3b region from 151 bp 5' of the stop codon to 186 bp downstream (46) (forward primer, TCTGGAAGCCTACTTCGCCA; reverse primer, CCGGTTCACAATCTCTCTGA).
To ensure that the PCRs were in linear range, several serial dilutions of the input DNA and two dilutions of each of the bound DNA fractions were used to quantify products. In addition, 24 to 27 PCR cycles were performed for each bound DNA fraction and input. PCR products were separated on 6% polyacrylamide gels and stained with Sybr Green (Sigma). DNA bands were visualized and quantified by using ImageQuant 5.2 and NIH Image 1.63 software. The percentage of the input that was bound was calculated by dividing the value of the bound fraction by the average of values for the input dilutions in the linear range and multiplying by the respective dilution factor. Additionally, we used an antibody that recognizes the C-terminal tail of histone H3, which is not modification specific, as an internal control and a measure of chromatin recovery for each lysate. Quantifications from multiple individual experiments were taken, and the average values were plotted graphically using Microsoft Excel software. Error bars represent standard deviations.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
In order to assess chromatin structural alterations, which occur during development and in specific tissues, and the transcription factors that regulate and target these changes in chromatin and expression, we performed ChIP analyses of mouse liver and brain tissue at specific times of development. Formaldehyde-cross-linked chromatin fragments were isolated from mouse tissues at 8 days and 2 months after birth and were sheared by sonication and micrococcal nuclease digestion to less than 500 bp. We chose 8-day pp liver as our source of AFP-expressing tissue, because the amount of tissue needed for ChIP analyses is significant (70), and AFP expression levels at this stage are comparable to those in tumor-derived Hepa 1-6 cells. At the age of 2 months, AFP expression is fully repressed in WT mouse liver.
DNA-associated histones and transcription factors were compared at two specific regions of the AFP gene: the SBE/p53RE region (–850) within the previously identified developmental repressor of AFP, which we found is a regulatory center for cooperative p53- and transforming growth factor ß-mediated repression of AFP (data not shown), and the core promoter surrounding the transcription start site at position +1 of AFP. Antibodies that recognize specific modifications of residues within histone H3 amino tails—AcH3K9, DiMetH3K9, DiMetH3K4, and tetra-acetylated histone H4 (K5, K8, K12, and K16)—were used to precipitate cross-linked chromatin fragments. Multiple analyses were performed for each test antibody, and a titration of the input lysate was used to establish the linear range of PCR detection for each lysate. An antibody that recognizes the C-terminal tail of histone H3, which is not modification specific, was also used to standardize chromatin lysates with regard to protein-chromatin recovery. Representative data are shown in each figure, along with quantified results of multiple lysates and analyses.
The general paradigms of the "histone code," which holds that histone acetylation is indicative of transcription activation and that H3K9 methylation, concomitant with histone deacetylation, is associated with repression, are illustrated by analysis of the AFP developmental repressor (Fig. 2A, SBE/p53RE) and core promoter (Fig. 2B, start site) regions. At 8 days of development, histones H3 and H4 are highly acetylated, but they are considerably less so at 2 months, when AFP is fully repressed. Methylation of H3K4 is correlated with active transcription, as well, and decreases with repression. Histone H3K9 cannot be simultaneously acetylated and methylated within an individual histone amino tail, and reciprocal changes in acetylation and methylation of H3K9 occur during developmental repression at both the AFP distal repressor and the core promoter. DiMetH3K9 levels are very low in both chromatin regions at 8 days but are readily detectable at the age of 2 months.
|
Histone modifications of silenced versus developmentally repressed chromatin. Although AFP expression is undetectable by 2 months of development, AFP chromatin may differ between adult liver tissue, which has a developmental history of expression and the possibility of reactivation during liver regeneration or tumorigenesis, and a tissue source where there is neither a history nor the potential for expression. Brain tissue from mice at the age of 2 months was processed for ChIP analysis of AFP chromatin, as described for liver tissue. We also determined specific histone modifications present at the Brn-3b gene locus, as a control gene actively expressed within brain tissue at this stage of development (Fig. 1).
Comparison of modifications of histones H3 and H4 within brain tissue shows that patterns of AFP and Brn-3b expression correlate with alterations in histone methylation rather than acetylation (Fig. 3A). Silenced AFP chromatin has low dimethylation of H3K4 and abundant DiMetH3K9, while Brn-3b chromatin exhibits high levels of DiMetH3K4 and low levels of DiMetH3K9. However, both silenced AFP chromatin and expressed Brn-3b chromatin display relatively low levels of histone H3 and H4 acetylation. The comparable levels of histone acetylation within expressed and silenced chromatin in the brain are unexpected, supporting the existence of tissue-specific and combinatorial patterns of histone modifications at individual genes and the complexity of histone code interpretation.
|
At 2 months in liver tissue, DiMetH3K9 is present in abundance within silenced Brn-3b chromatin and is nearly absent at the ALB enhancer (Fig. 3B). Levels of DiMetH3K9 in Brn-3b are six- to eightfold greater than DiMetH3K9 levels in ALB in the liver, proving to be the best indicator of chromatin silencing. DiMetH3K4 is detectable in both active ALB and silenced Brn-3b chromatin, but it is present at higher levels in ALB chromatin. However, DiMetH3K4 is not correlated as tightly with active expression in the liver as in brain tissue. We have not tested whether this is due to regional localization of DiMetH3K4 at upstream distal regulatory regions (ALB enhancer) versus a 3' open reading frame (Brn-3b). Locus-wide analyses of ß-type globin genes support localized concentration of DiMetH3K4 modification within the gene body and core promoter (58).
There are limited developmental changes in the histone modification states of ALB and Brn-3b between 8 days and 2 months pp in the liver. DiMetH3K9 is nearly undetectable in ALB chromatin at 8 days and remains so in the 2-month pp liver. In a mirror image of the DiMetH3K9 marker, AcH4 levels correlate closely with active ALB expression and remain high throughout development. Abundant AcH3K9 and DiMetH3K4 levels decrease, and AcH4 levels increase, all approximately 30%, at the ALB enhancer, although ALB is constitutively expressed in the adult liver (Fig. 1). Silenced Brn-3b chromatin exhibits a similar rise in AcH3K9 levels but remains relatively consistent otherwise (Fig. 3B). Interestingly, recent studies reveal that the capacity for liver regeneration decreases greatly with age (reviewed in references 42 and 69). Whether global or gene-specific chromatin alterations track these and other aging-related changes in the liver is not known.
When the AFP repressor (Fig. 2A) is compared with the ALB enhancer in 8-day pp liver (Fig. 3B), where both genes are actively transcribed, there is little difference at the level of histone modifications. Both genes lack significant H3K9 methylation, and both have relatively high levels of H3 and H4 acetylation and DiMetH3K4. Major differences between AFP and ALB, which occur from 8 days to 2 months of development, lie in the appearance of abundant methylation of H3K9 and loss of H3K4 methylation at the AFP repressor, concomitant with transcriptional repression of AFP.
Developmentally regulated transcription factor interactions at the AFP repressor. The enzymatic complexes mediating histone modifications are targeted by proteins that interact directly or indirectly with DNA, potentially nucleating alterations in chromatin that can serve as platforms for additional chromatin modifiers or cofactors (17, 29, 43). We investigated whether specific activating and repressing transcription factor interactions occurred at AFP regulatory regions and compared them to those at the ALB enhancer (Fig. 4). FoxA (HNF-3) is an important mediator of liver-specific gene activation and, as a winged-helix/forkhead family member, may assume a function similar to that of linker histone and position nucleosomes within the ALB enhancer (7, 10-12, 45). FoxA has been proposed as a "pioneer transcription factor," which binds its chromatin-assembled regulatory element in fetal liver and generates flanking chromatin accessible to downstream interactions between transcription activators, expressed later in development, and the ALB enhancer. We showed previously that FoxA also activated AFP expression in opposition to p53-mediated repression in vitro. We proposed that mutually exclusive occupation of the AFP developmental repressor (SBE/p53RE, at –850) by FoxA and p53 was, in part, responsible for their opposing effects on AFP transcription (14, 39).
|
Recruitment of chromatin-silencing complexes. AFP chromatin is altered in parallel with transcription repression, exhibiting deacetylation of H3 and H4, methylation of H3K9, and loss of H3K4 methylation (Fig. 2). We investigated whether protein complexes known to mediate some of these changes in histone modification could be detected at the AFP repressor element and/or at the transcription start site in 2-month postnatal liver. Interestingly, mSin3A, a member of class I HDAC complexes, which include HDAC1 and HDAC2 (reviewed in references 18 and 24), is detected at the SBE/p53RE but not at the AFP transcription start site (Fig. 4A), though decreased acetylation is observed at both sites (Fig. 2). Further support for a biased association of mSin3A with the SBE/p53RE and not the core promoter is provided by analysis of HDAC1 interactions (Fig. 5A). There is no detectable binding of HDAC1 at either SBE/p53RE or the start site region at 8 days pp, when AFP is highly transcribed and chromatin is acetylated (Fig. 4A and 5A). HDAC1 binding occurs at the distal repressor, SBE/p53RE, when AFP is repressed at 2 months, but is not detectable at the core promoter, confirming the mSin3A distribution. The alterations in histone acetylation found at the AFP start site region may be due to spreading of deacetylation by HDAC complexes targeted along with Sin3A to the distal repressor region (SBE/p53RE) or by deacetylase activity directed to the core promoter by HDAC complexes lacking an mSin3A component. Interestingly, HDAC1 binding to the silenced Brn-3b locus is readily detectable in 8-day pp liver (Fig. 5A) but is considerably diminished in 2-month liver, coincident with the observed increase in AcH3K9 levels in Brn-3b chromatin (Fig. 3B). Whether this represents a transient association of HDAC complexes with silenced chromatin in tissues that are still undergoing differentiation, such as the liver at 8 days pp, remains to be determined.
|
We asked if permanently silenced chromatin would have larger amounts of associated HP1 protein than repressed chromatin that is established over a time course of development. We compared HP1 levels in silenced Brn-3b to those in developmentally regulated AFP. In both 8-day pp and 2-month liver tissue, Brn-3b chromatin is associated with detectable HP1 protein (Fig. 5A). HP1 levels decreased approximately twofold over the time course of development for Brn-3b. Contrary to our expectations, levels of HP1 at silenced Brn-3b were somewhat lower than those observed at the repressed AFP locus (2 months). Our determinations included only analysis of HP1, and there may be tissue- and developmental-stage-specific differences between HP1 isoforms not apparent in these studies. Specific protein complexes of HP1 isoforms and the Su(var)3-9 HMT, which associate at different chromosomal and subnuclear sites during development, have been identified in Drosophila melanogaster (28).
In a reciprocal determination using brain tissue, where AFP and ALB are permanently silenced, HP1 was abundant at both gene loci but was absent from actively expressed Brn-3b (Fig. 5C and D). There are likely several nonspecific factors that come into play when lysates from two different tissues, such as brain and liver, are compared. However, using an antibody specific for total histone H3 (unmodified C-terminal) as a measure of chromatin recovery, we estimated that HP1 levels at the AFP distal repressor SBE/p53RE were equivalent in the liver and the brain but higher at the silenced AFP core promoter in the brain compared with the liver (Fig. 5D).
The p53 tumor suppressor protein targets chromatin repression. Mice genetically null for p53 exhibit a delay in repression of AFP expression during liver development, while constitutively expressed ALB and GAPDH genes are unaffected (Fig. 1). Therefore, there must be compensatory mechanisms for the loss of p53 or additive repressor proteins at work to effect robust repression of AFP during hepatic development. We determined a specific end point for AFP expression in p53-null mouse liver by increasing the number of PCR amplification cycles and the sensitivity of AFP RNA detection (Fig. 6A). These analyses showed that AFP is transcribed at low levels in both WT and p53-null mice at the age of 1 month. The low level of AFP transcription continues through early adulthood in p53-null mice but ceases before the age of 2 months in the WT. AFP expression is repressed in both p53-null and WT mice within 4 months.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We find that robust AFP expression in the liver is coincident with the presence of acetylated histones H3 and H4 as well as methylated H3K4. Recruitment of mSin3A/HDAC1, decreases in methylation at H3K4, and acetylation of H4 and H3K9 follow this period of active expression to effect developmentally regulated repression of AFP transcription. Hepatic differentiation is accompanied by decreased cell cycle progression and DNA replication, which precede AFP developmental repression (reviewed in reference 66). Previous studies of DNA replication and cell cycle status in p53-null liver showed a twofold increase in the number of cells undergoing S phase in adult p53-null versus WT liver (22). The increase in replication levels, combined with loss of p53-targeted HDACs and increased acetylation of H3K9, may contribute to depletion of methylated histones and decreased DiMetH3K9 levels in p53-null liver. Decreased Suv39h activity in cycling versus differentiated cells, as suggested by studies of Suv39h-depleted muscle cells, may also contribute to a specific loss of DiMetH3K9 relative to MetH3K4 (2).
Previous work showing interactions of transcription factors, KRAB/KAP-1 proteins, and tumor suppressor Rb with HMT enzymes and HP1 established that methylated H3K9 and HP1 proteins were involved in targeted repression of euchromatic genes in addition to heterochromatic silencing (50, 61). Similarly, we find a p53-dependent association between DiMetH3K9 and HP1 at AFP chromatin during developmental repression in vivo. DiMetH3K9 and HP1 association and repression of transcription do not spread to the distal enhancer of AFP or to the highly homologous, but constitutively expressed, ALB gene, which lies upstream of AFP. The considerable homology between the ALB and AFP genes, which arose by duplication from a common precursor and exhibit more than 30% primary sequence identity within their coding regions (27), does not extend to the AFP repressor region. This lends further support to localized targeting of HP1 by p53-mediated enrichment of DiMetH3K9 within AFP chromatin, and lack of heterochromatic spreading throughout the gene locus. Recently, a pathway of heterochromatin silencing, which is nucleated by ATF/CREB family members binding to their sequence-specific binding elements, was defined (34). In contrast with repression of euchromatin targeted by p53, Rb, or KRAB/KAP1, this transcription factor-dependent means of silencing the mating-type locus of Schizosaccharomyces pombe induced heterochromatin formation and spreading, like the parallel RNA interference-dependent mechanism.
We compared histone modifications and HP1 association during developmental repression with silencing of AFP in a nonexpressing tissue. Unlike the situation in developmental repression, HP1 protein was abundant at both the AFP and ALB gene loci in brain tissue. The relative levels of HP1 interaction at the AFP core promoter were higher in the brain but did not differ between the liver and brain at the distal repressor region. Interestingly, sites at nucleotide +3 and the first intronic region of the AFP gene exhibit increased CpG methylation during developmental repression in the liver and silenced expression in fibroblasts (38, 53). DNA methylation and H3K9 methylation have been linked with HP1 in chromatin silencing (reviewed in references 19, 23, 26, and 33), and more recently a direct association between enzymes that methylate DNA and HP1ß protein has been reported (25).
Our analyses of p53-null mice reveal that relatively small differences in transcription levels are marked by more obvious distinctions in chromatin modifications and bound transcription factors. As ChIP analyses of solid tissues develop, and analytical systems become more sensitive, their use in early detection of changes in tumor marker gene regulation may be more direct than assays of RNA or protein levels, which are also altered by posttranscriptional and posttranslational mechanisms. The DiMetH3K9 histone modification, which is abundant in silenced AFP chromatin within brain tissue and is easily detected in developmentally repressed AFP chromatin in WT liver tissue, may be especially useful in establishing a normal signature for tissue-specific chromatin structure and as a marker of aberrant gene activation or repression when altered.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grants GM53683 and GM60213 from the National Institutes of Health to M.C.B. and, in part, by an NCI Cancer Center support grant to the U.T. M. D. Anderson Cancer Center.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Ait-Si-Ali, S., V. Guasconi, L. Fritsch, H. Yahi, R. Sekhri, I. Naguibneva, P. Robin, F. Cabon, A. Polesskaya, and A. Harel-Bellan. 2004. A Suv39h-dependent mechanism for silencing S-phase genes in differentiating but not in cycling cells. EMBO J. 23:605-615.[CrossRef][Medline]
3. Camper, S. A., R. Godbout, and S. M. Tilghman. 1989. The developmental regulation of albumin and alpha-fetoprotein gene expression. Prog. Nucleic Acid Res. Mol. Biol. 36:131-143.[Medline]
4. Camper, S. A., and S. M. Tilghman. 1991. The activation and silencing of gene transcription in the liver. Bio/Technology 16:81-87.[Medline]
5. Camper, S. A., and S. M. Tilghman. 1989. Postnatal repression of the alpha-fetoprotein gene is enhancer independent. Genes Dev. 3:537-546.
6. Chadee, D. N., M. J. Hendzel, C. P. Tylipski, C. D. Allis, D. P. Bazett-Jones, J. A. Wright, and J. R. Davie. 1999. Increased Ser-10 phosphorylation of histone H3 in mitogen-stimulated and oncogene-transformed mouse fibroblasts. J. Biol. Chem. 274:24914-24920.
7. Chaya, D., T. Hayamizu, M. Bustin, and K. S. Zaret. 2001. Transcription factor FoxA (HNF3) on a nucleosome at an enhancer complex in liver chromatin. J. Biol. Chem. 276:44385-44389.
8. Chen, H., J. O. Egan, and J. F. Chiu. 1997. Regulation and activities of alpha-fetoprotein. Crit. Rev. Eukaryot. Gene Expr. 7:11-41.[Medline]
9. Choi, J., and L. A. Donehower. 1999. p53 in embryonic development: maintaining a fine balance. Cell. Mol. Life Sci. 55:38-47.[CrossRef][Medline]
10. Cirillo, L. A., F. R. Lin, I. Cuesta, D. Friedman, M. Jarnik, and K. S. Zaret. 2002. Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol. Cell 9:279-289.[CrossRef][Medline]
11. Cirillo, L. A., C. E. McPherson, P. Bossard, K. Stevens, S. Cherian, E. Yon Shim, K. L. Clark, S. K. Burley, and K. S. Zaret. 1998. Binding of the winged-helix transcription factor HNF3 to a linker histone site on the nucleosome. EMBO J. 17:244-254.[CrossRef][Medline]
12. Cirillo, L. A., and K. S. Zaret. 1999. An early developmental transcription factor complex that is more stable on nucleosome core particles than on free DNA. Mol. Cell 4:961-969.[CrossRef][Medline]
13. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97:299-311.[CrossRef][Medline]
14. Crowe, A. J., L. Sang, K. K. Li, K. C. Lee, B. T. Spear, and M. C. Barton. 1999. Hepatocyte nuclear factor 3 relieves chromatin-mediated repression of the -fetoprotein gene. J. Biol. Chem. 274:25113-25120.
15. Dahmus, M. E. 1996. Reversible phosphorylation of the C-terminal domain of RNA polymerase II. J. Biol. Chem. 271:19009-19012.
16. Darlington, G. J. 1987. Liver cell lines. Methods Enzymol. 151:19-38.[Medline]
17. Davie, J. K., and S. Y. Dent. 2004. Histone modifications in corepressor functions. Curr. Top. Dev. Biol. 59:145-163.[Medline]
18. de Ruijter, A. J., A. H. van Gennip, H. N. Caron, S. Kemp, and A. B. van Kuilenburg. 2003. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem. J. 370:737-749.[CrossRef][Medline]
19. Dillon, N., and R. Festenstein. 2002. Unravelling heterochromatin: competition between positive and negative factors regulates accessibility. Trends Genet. 18:252-258.[CrossRef][Medline]
20. Dilworth, F. J., C. Fromental-Ramain, K. Yamamoto, and P. Chambon. 2000. ATP-driven chromatin remodeling activity and histone acetyltransferases act sequentially during transactivation by RAR/RXR in vitro. Mol. Cell 6:1049-1058.[CrossRef][Medline]
21. Donehower, L. A. 2002. Does p53 affect organismal aging? J. Cell. Physiol. 192:23-33.[CrossRef][Medline]
22. Dumble, M. L., B. Knight, E. A. Quail, and G. C. Yeoh. 2001. Hepatoblast-like cells populate the adult p53 knockout mouse liver: evidence for a hyperproliferative maturation-arrested stem cell compartment. Cell Growth Differ. 12:223-231.
23. Elgin, S. C., and S. I. Grewal. 2003. Heterochromatin: silence is golden. Curr. Biol. 13:R895-R898.[CrossRef][Medline]
24. Fleischer, T. C., U. J. Yun, and D. E. Ayer. 2003. Identification and characterization of three new components of the mSin3A corepressor complex. Mol. Cell. Biol. 23:3456-3467.
25. Fuks, F., P. J. Hurd, R. Deplus, and T. Kouzarides. 2003. The DNA methyltransferases associate with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids Res. 31:2305-2312.
26. Fuks, F., P. J. Hurd, D. Wolf, X. Nan, A. P. Bird, and T. Kouzarides. 2003. The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. J. Biol. Chem. 278:4035-4040.
27. Gorin, A. G., D. L. Cooper, F. Eiferman, P. van de Rijn, and S. Tilghman. 1981. The evolution of -fetoprotein and albumin. J. Biol. Chem. 256:1954-1959.
28. Greil, F., I. van der Kraan, J. Delrow, J. F. Smothers, E. de Wit, H. J. Bussemaker, R. van Driel, S. Henikoff, and B. van Steensel. 2003. Distinct HP1 and Su(var)3-9 complexes bind to sets of developmentally coexpressed genes depending on chromosomal location. Genes Dev. 17:2825-2838.
29. Grewal, S. I., and S. C. Elgin. 2002. Heterochromatin: new possibilities for the inheritance of structure. Curr. Opin. Genet. Dev. 12:178-187.[CrossRef][Medline]
30. Hatzis, P., and I. Talianidis. 2002. Dynamics of enhancer-promoter communication during differentiation-induced gene activation. Mol. Cell 10:1467-1477.[CrossRef][Medline]
31. Ho, J., and S. Benchimol. 2003. Transcriptional repression mediated by the p53 tumour suppressor. Cell Death Differ. 10:404-408.[CrossRef][Medline]
32. Hoffman, W. H., S. Biade, J. T. Zilfou, J. Chen, and M. Murphy. 2002. Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J. Biol. Chem. 277:3247-3257.
33. Jaenisch, R., and A. Bird. 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33(Suppl.):245-254.
34. Jia, S., K. Noma, and S. I. Grewal. 2004. RNAi-independent heterochromatin nucleation by the stress-activated ATF/CREB family proteins. Science 304:1971-1976.
35. Jin, D. K., J. Vacher, and M. H. Feuerman. 1998. -Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration. Proc. Natl. Acad. Sci. USA 95:8767-8772.
36. Koumenis, C., R. Alarcon, E. Hammond, P. Sutphin, W. Hoffman, M. Murphy, J. Derr, Y. Taya, S. W. Lowe, M. Kastan, and A. Giaccia. 2001. Regulation of p53 by hypoxia: dissociation of transcriptional repression and apoptosis from p53-dependent transactivation. Mol. Cell. Biol. 21:1297-1310.
37. Krumlauf, R., R. E. Hammer, S. M. Tilghman, and R. L. Brinster. 1985. Developmental regulation of alpha-fetoprotein genes in transgenic mice. Mol. Cell. Biol. 5:1639-1648.
38. Kunnath, L., and J. Locker. 1983. Developmental changes in the methylation of the rat albumin and alpha-fetoprotein genes. EMBO J. 2:317-324.[Medline]
39. Lee, K. C., A. J. Crowe, and M. C. Barton. 1999. p53-mediated repression of alpha-fetoprotein gene expression by specific DNA binding. Mol. Cell. Biol. 19:1279-1288.
40. Liu, J. K., Y. Bergman, and K. S. Zaret. 1988. The mouse albumin promoter and a distal upstream site are simultaneously DNase I hypersensitive in liver chromatin and bind similar liver-abundant factors in vitro. Genes Dev. 2:528-541.
41. Luo, J., F. Su, D. Chen, A. Shiloh, and W. Gu. 2000. Deacetylation of p53 modulates its effect on cell growth and apoptosis. Nature 408:377-381.[CrossRef][Medline]
42. Mackey, S., P. Singh, and G. J. Darlington. 2003. Making the liver young again. Hepatology 38:1349-1352.[Medline]
43. Maison, C., and G. Almouzni. 2004. HP1 and the dynamics of heterochromatin maintenance. Nat. Rev. Mol. Cell Biol. 5:296-304.[CrossRef][Medline]
44. McKinsey, T. A., C. L. Zhang, and E. N. Olson. 2001. Control of muscle development by dueling HATs and HDACs. Curr. Opin. Genet. Dev. 11:497-504.[CrossRef][Medline]
45. McPherson, C. E., R. Horowitz, C. L. Woodcock, C. Jiang, and K. S. Zaret. 1996. Nucleosome positioning properties of the albumin transcriptional enhancer. Nucleic Acids Res. 24:397-404.
46. Mu, X., P. D. Beremand, S. Zhao, R. Pershad, H. Sun, A. Scarpa, S. Liang, T. L. Thomas, and W. H. Klein. 2004. Discrete gene sets depend on POU domain transcription factor Brn3b/Brn-3.2/POU4f2 for their expression in the mouse embryonic retina. Development 131:1197-1210.
47. Murphy, M., J. Ahn, K. K. Walker, W. H. Hoffman, R. M. Evans, A. J. Levine, and D. L. George. 1999. Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a. Genes Dev. 13:2490-2501.
48. Nakabayashi, H., T. Hashimoto, Y. Miyao, K. K. Tjong, J. Chan, and T. Tamaoki. 1991. A position-dependent silencer plays a major role in repressing alpha-fetoprotein expression in human hepatoma. Mol. Cell. Biol. 11:5885-5893.
49. Nakayama, J., J. Rice, B. D. Strahl, C. D. Allis, and S. Grewal. 2001. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly. Science 292:110-113.
50. Nielsen, S. J., R. Schneider, U. M. Bauer, A. J. Bannister, A. Morrison, D. O'Carroll, R. Firestein, M. Cleary, T. Jenuwein, R. E. Herrera, and T. Kouzarides. 2001. Rb targets histone H3 methylation and HP1 to promoters. Nature 412:561-565.[CrossRef][Medline]
51. Ninkina, N. N., G. E. Stevens, J. N. Wood, and W. D. Richardson. 1993. A novel Brn3-like POU transcription factor expressed in subsets of rat sensory and spinal cord neurons. Nucleic Acids Res. 21:3175-3182.
52. Ogden, S. K., K. C. Lee, K. Wernke-Dollries, S. A. Stratton, B. Aronow, and M. C. Barton. 2001. p53 targets chromatin structure alteration to repess -fetoprotein gene expression. J. Biol. Chem. 276:42057-42062.
53. Opdecamp, K., M. Riviere, M. Molne, J. Szpirer, and C. Szpirer. 1992. Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity. Nucleic Acids Res. 20:171-178.
54. Pandey, R. S., and M. S. Kanungo. 1984. Developmental changes in chromatin of skeletal muscle of rats: acetylation of chromosomal proteins and transcription. Mol. Biol. Rep. 10:79-81.[CrossRef][Medline]
55. Parrizas, M., M. A. Maestro, S. F. Boj, A. Paniagua, R. Casamitjana, R. Gomis, F. Rivera, and J. Ferrer. 2001. Hepatic nuclear factor 1- directs nucleosomal hyperacetylation to its tissue-specific transcriptional targets. Mol. Cell. Biol. 21:3234-3243.
56. Ramesh, T. M., A. W. Ellis, and B. T. Spear. 1995. Individual mouse alpha-fetoprotein enhancer elements exhibit different patterns of tissue-specific and hepatic position-dependent activities. Mol. Cell. Biol. 15:4947-4955.[Abstract]
57. Richards, E. J., and S. C. Elgin. 2002. Epigenetic codes for heterochromatin formation and silencing: rounding up the usual suspects. Cell 108:489-500.[CrossRef][Medline]
58. Schneider, R., A. J. Bannister, F. A. Myers, A. W. Thorne, C. Crane-Robinson, and T. Kouzarides. 2004. Histone H3 lysine 4 methylation patterns in higher eukaryotic genes. Nat. Cell Biol. 6:73-77.[CrossRef][Medline]
59. Schreiber, S. L., and B. E. Bernstein. 2002. Signaling network model of chromatin. Cell 111:771-778.[CrossRef][Medline]
60. Schroeder, S. C., B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 14:2435-2440.
61. Schultz, D. C., K. Ayyanathan, D. Negorev, G. G. Maul, and F. J. Rauscher III. 2002. SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins. Genes Dev. 16:919-932.
62. Soutoglou, E., and I. Talianidis. 2002. Coordination of PIC assembly and chromatin remodeling during differentiation-induced gene activation. Science 295:1901-1904.
63. Spear, B. T. 1999. Alpha-fetoprotein gene regulation: lessons from transgenic mice. Semin. Cancer Biol. 9:109-116.[CrossRef][Medline]
64. Strahl, B. D., and C. D. Allis. 2000. The language of covalent histone modifications. Nature 403:41-45.[CrossRef][Medline]
65. Su, R. C., K. E. Brown, S. Saaber, A. G. Fisher, M. Merkenschlager, and S. T. Smale. 2004. Dynamic assembly of silent chromatin during thymocyte maturation. Nat. Genet. 36:502-506.[CrossRef][Medline]
66. Tilghman, S. M. 1985. The structure and regulation of the alpha-fetoprotein and albumin genes. Oxf. Surv. Eukaryot. Genes 2:160-206.[Medline]
67. Turner, B. M. 2000. Histone acetylation and an epigenetic code. Bioessays 22:836-845.[CrossRef][Medline]
68. Wang, L., Q. Wu, P. Qiu, A. Mirza, M. McGuirk, P. Kirschmeier, J. R. Greene, Y. Wang, C. B. Pickett, and S. Liu. 2001. Analyses of p53 target genes in the human genome by bioinformatic and microarray approaches. J. Biol. Chem. 276:43604-43610.
69. Wang, X., H. Kiyokawa, M. B. Dennewitz, and R. H. Costa. 2002. The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc. Natl. Acad. Sci. USA 99:16881-16886.
70. Wells, J., and P. J. Farnham. 2002. Characterizing transcription factor binding sites using formaldehyde crosslinking and immunoprecipitation. Methods 26:48-56.[CrossRef][Medline]
71. Wells, J., C. R. Graveel, S. M. Bartley, S. J. Madore, and P. J. Farnham. 2002. The identification of E2F1-specific target genes. Proc. Natl. Acad. Sci. USA 99:3890-3895.
72. Zaret, K. 1998. Early liver differentiation: genetic potentiation and multilevel growth control. Curr. Opin. Genet. Dev. 8:526-531.[CrossRef][Medline]
73. Zaret, K. 1994. Genes that control the formation of the liver. Hepatology 19:794-796.[Medline]
74. Zaret, K. S. 1994. Genetic control of hepatocyte differentiation, p. 53-68. In I. M. Arias, J. L. Boyer, N. Fausto, W. B. Jakoby, D. A. Schachter, and D. A. Shafritz (ed.), The liver: biology and pathobiology, 3rd ed. Raven Press, New York, N.Y.
75. Zaret, K. S. 1996. Molecular genetics of early liver development. Annu. Rev. Physiol. 58:231-251.[CrossRef][Medline]
76. Zaret, K. S. 1995. Nucleoprotein architecture of the albumin transcriptional enhancer. Semin. Cell Biol. 6:209-218.[CrossRef][Medline]
77. Zilfou, J. T., W. H. Hoffman, M. Sank, D. L. George, and M. Murphy. 2001. The corepressor mSin3a interacts with the proline-rich domain of p53 and protects p53 from proteasome-mediated degradation. Mol. Cell. Biol. 21:3974-3985.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||
