![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas
Received 27 September 2004/ Returned for modification 21 October 2004/ Accepted 3 January 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although distinct programs of recruitment of chromatin remodelers and other multiprotein complexes have been reported for various promoters (2, 13, 55), a common theme has emerged. Each transcriptional program is generally initiated by one or more site-specific activator proteins that access metazoan enhancers or upstream activating sequences (UASs) in yeast. Activation domains then mediate the high-affinity interaction and hence "recruitment" of specific chromatin modifiers and remodelers, which do not bind DNA with specificity (15, 23). Ultimately, changes in chromatin structure or remodeling facilitate the assembly of the transcription preinitiation complex onto the core promoter (2, 30, 37).
Although much is known about how coactivators are recruited, the reason why promoters vary in their requirements for chromatin modifiers and remodelers is unresolved. Given the central role of site-specific activators in coactivator recruitment, it seems reasonable that various activation domain subclasses might interact with and hence recruit distinct coactivators. However, acidic activators interact directly with a similar subset of chromatin-associated activities, including yeast NuA4, SAGA, and SWI/SNF as well as their human counterparts (15, 23, 27, 43, 67). The apparent absence in vitro of distinct interaction preferences among this subset of coactivators is consistent with in vivo studies suggesting that a variety of natural and chimeric activators are able to recruit overlapping sets of coactivators (7, 12, 49, 53, 56, 58, 66).
Recently, a few studies have suggested that promoter architecture, i.e., the relative location of cis-regulatory sequences with respect to nucleosomes, orchestrates a specific coactivator recruitment program and hence requirements for individual coactivator complexes (37, 52, 53, 56). Thus, in some cases, promoters with a nucleosomal TATA (yeast SUC2 and human beta interferon) require Gcn5 and SWI/SNF for activation (2, 21, 24). These coactivator dependencies are alleviated at other promoters where TATA is either naturally accessible or exposed artificially (37, 53, 56). However, the well-studied GAL1 and PHO5 promoters, at which TATA is occluded by nucleosomes, require neither SWI/SNF nor Gcn5 under fully activating conditions (6, 14, 16, 20, 42, 48). Interestingly, a prerequisite for both SWI/SNF and Gcn5 is imposed on GAL1 and PHO5 activation in mitosis (32, 42), possibly because the chromatin architecture is condensed. However, many promoters have an absolute requirement for these coactivators in interphase, indicating that additional factors must play a role in determining a promoter's need for specific chromatin modifiers and remodelers.
While PHO5 induction does not require these coactivators in strict genetic terms, we and others have shown that both Gcn5 and SWI/SNF are needed to achieve full rates of initial promoter activation (4, 5, 42). Further, under fully activating conditions of complete Pi starvation, PHO5 expression depends on Gcn5 when the promoter is weakened by mutations in either of the two UASs (20). Lastly, growth of yeast in rich medium, which is limiting for Pi, leads to partial activation of PHO5 in mitosis (
10% of the full activity achieved overnight in no-Pi medium) that is highly dependent on Gcn5 and SWI/SNF (42). These observations are consistent with the hypothesis that PHO5 promoter induction requires these remodelers when low levels of activator are associated with the promoter.
Testing this hypothesis, here we show that PHO5 transactivation is strongly reduced in the absence of either Gcn5 or SWI/SNF at low levels of UAS-bound Pho4. By contrast, the requirement for either remodeler is alleviated when Pho4 binding site occupancy is increased, suggesting that functional redundancy is established at promoters with robust activator interactions. Thus, we also find significant recruitment of Gcn5 and SWI/SNF to several promoters known to exhibit strong activator binding and transcription at which they are currently thought not to function. These results define a critical role for activator concentration and promoter occupancy in determining the extent to which transactivation depends on specific chromatin modifiers and remodelers. Moreover, our data suggest that Gcn5 and SWI/SNF have many genomic targets and support a model in which high levels of promoter-bound activator drive the genetic redundancy that is observed between various coactivators.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Pho4 cellular localization. For green fluorescent protein (GFP) studies, strains were grown for 12 h in defined medium with 13.4, 0.2, or 0 mM Pi. Cells (1 ml) were sonicated, washed with 1x phosphate-buffered saline (PBS), and fixed with 70% ethanol for 20 min. The cells were washed again with 1x PBS, resuspended in 10 µl of 1-µg/ml 6-diamidino-2-phenylindole (DAPI), and incubated at room temperature for 12 min. The cells were then washed with 1x PBS and viewed with an Axiovert 135 with a 100x Plan-Apochromat oil immersion objective (Carl Zeiss MicroImaging). Representative cell images were collected using Zeiss Axiovision ver. 3.1.
ChIP analysis.
Chromatin immunoprecipitation (ChIP) analysis was performed as described previously (11), except that the cells were cross-linked for 15 min at room temperature with 1% formaldehyde. After cross-linking and cell lysis, total-cell lysates containing soluble and pelleted chromatin were resolubilized and sheared by sonication. Aliquots of the fixed and sheared chromatin were deproteinized and analyzed by agarose gel electrophoresis to determine the amount of chromatin and verify shearing to an average length of 500 bp. Similar amounts of cross-linked chromatin were immunoprecipitated using rabbit A-14 anti-myc antibody (2 µl; SC-789; Santa Cruz Biotechnology). For PHO5 sequences, a single primer pair (ADO236, CATGTAAGCGGACGTC [–456 to –441 relative to the PHO5 ATG translation start], and LFO740, GCCTTGCCAAGTAAGGTGAC [–173 to –154]) was used to amplify sequences from the endogenous UASs of the PHO5 promoter as well as a negative control PHO5 promoter (pho5 
UASs) by quantitative competitive PCR. This negative control contains PHO5 sequences from –1537 to +9 with two 50-bp deletions (encompassing UASp1 and UASp2 from –401 to –352 and –258 to –209, respectively) and was integrated either by gene replacement of (strains ADY2459 and ADY2461) or by loop in at (strains ADY2695, ADY2701, ADY2719, ADY2727, ADY2915, ADY2921, and ADY2923) the CAN1 locus (11). Likewise, LFO644 (GGAAATGTAAAGAGCCCC [–547 to –530]) and LFO645 (TTGAAGGTTTGTGGGG [–270 to –255]) were used to simultaneously amplify the endogenous UASG region of the GAL1-10 promoter and a negative control gal1-10 UASG promoter. This negative control comprises the entire GAL1-10 intergenic region (–698 to +36 relative to the GAL1 ATG) with a deletion of all four Gal4 sites (UASG, –453 to –336), which was integrated by loop in at CAN1. Primers used for amplification of various yeast promoters (EFT2, PYK1, RPL19B, and RPS22B) were previously described (50).
Western blotting.
Yeast cells (100 ml) were grown in defined medium with or without Pi to an optical density at 600 nm of 1 and Western blot analyses were performed using standard techniques. Briefly, cells were lysed by addition of 0.3 g of ice-cold glass beads (425 to 600 µm) and 500 µl of lysis buffer and vortexing twice for 1 min. Cell debris was pelleted, total protein was quantified using the bicinchoninic acid assay kit (Pierce), and 70 µg of protein per lane was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (37.5:1 acrylamide-to-bisacrylamide ratio; 10% polyacrylamide). After transfer to a polyvinylidene difluoride (PVDF) membrane (Amersham Pharmacia), the blot was incubated overnight with rabbit anti-FLAG antibody (Sigma; F-742) and then with horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (Amersham Pharmacia). Protein was detected with the ECL PLUS kit (Amersham Pharmacia) and visualized using a Storm 860 phosphorimager. The blot was reprobed with mouse monoclonal anti-yeast Pgk1 (3-phosphoglycerate kinase) antibody (Molecular Probes, 22C5-D8) followed by HRP-conjugated anti-mouse immunoglobulin G.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or gcn5 strains (4, 5, 16, 20, 42). However, the kinetics of PHO5 induction are strongly dependent on Gcn5 (4, 42) and SWI/SNF (42). Ada2 is recruited to the PHO5 promoter by Pho4 as a component of SAGA (4); however, direct recruitment of SWI/SNF to PHO5 has not been shown.
We performed ChIP experiments on 13myc-tagged strains (Table 1) to assay for Gcn5 and Swi2 association at PHO5. ChIP analysis of the region of the PHO5 promoter (Fig. 1A) encompassing both UASp1 and UASp2 was performed at various times after shifting the cells to medium that lacks Pi. The two myc-tagged strains and the parent, untagged strain were assayed internally and in parallel for rAPase activity and were shown to exhibit induction profiles that are essentially identical (Fig. 1B). Since these strains also have PHO3 (coding for constitutive acid phosphatase) deleted, the measured activities essentially reflect PHO5 expression (31, 42). Besides the expected kinetic lag relative to accumulation of PHO5 transcript, we and others have shown that rAPase activities accurately reflect the state of PHO5 activation following Pi starvation (5, 42). The immunoprecipitated DNA was analyzed by quantitative competitive PCR (Fig. 1C, left). As can be seen in Fig. 1C (right), both SWI/SNF and Gcn5 are enriched over time at the endogenous PHO5 promoter compared to the internal negative control locus, pho5 UASs, lacking both UASp1 and UASp2. The fold enrichments of PHO5 compared to negative control sequences (normalized to the same ratio in the respective input sample) are shown in Fig. 1D. Similar Pi starvation-dependent enrichments for these coactivators compared to another negative control region in the WHI4 ORF are also observed (data not shown). Gcn5 and SWI/SNF are significantly enriched at the wild-type PHO5 promoter at 4 h of Pi starvation, consistent with an early role for both coactivators in chromatin remodeling and promoter activation. This is the first demonstration of the physical presence of Gcn5 and Swi2 (or any SWI/SNF subunit) at PHO5, since SWI/SNF recruitment has previously been detected only at the PHO84 promoter (57). Since Ada2 was previously shown to associate with the PHO5 promoter as a part of SAGA (4), it is likely that Gcn5 association is also occurring via SAGA. Maximal recruitment of both complexes requires many hours (
12 h) of Pi deprivation, consistent with the delay in activation observed in gcn5 (4, 5, 42) or swi2 (42) strains.
|
|
2.3-fold enrichment) after 2 h in Pi-free medium. Additionally, as shown above for Gcn5 and SWI/SNF, many hours of Pi withdrawal are required for high levels of the activator to associate with the PHO5 promoter. In accord with the recruitment paradigm, these results demonstrate that Pho4 binding precedes the recruitment of Gcn5 and Swi2. However, since transport of Pho4 from the nucleus to cytoplasm is complete by 1 h at very low or no Pi (5, 28), it is surprising that so many hours are required for Pho4 binding to plateau at the PHO5 promoter.
|
Our ChIP results, showing that recruitment of Pho4, Gcn5, and Swi2 all peak at 12 h of PHO5 induction, are most consistent with a model in which nucleosome –2 is disrupted over time to enable access of Pho4. Moreover, we hypothesized that the combined action of distinct classes of coactivator complexes might be required to achieve full induction at lower levels of Pho4 site occupancy when, on average, only UASp1 rather than the nucleosomal UASp2 is occupied. Conversely, high-level association of Pho4 and hence recruitment of coactivators might suppress the need for a particular chromatin-associated complex.
To test this hypothesis, we regulated the nuclear concentration of Pho4 to effect different steady-state levels of UAS occupancy at the PHO5 promoter in wild-type, gcn5, and swi2 cells. The nucleocytoplasmic distribution of Pho4 is controlled through its phosphorylation by the Pho80-Pho85 cyclin-cyclin-dependent kinase (28, 29, 31, 46). Under conditions of high Pi availability, phosphorylation blocks nuclear import and promotes nuclear export, leading to cytoplasmic localization of Pho4. When Pi is limiting, PHO4 expression is not affected (34), Pho80-Pho85 activity is inhibited, and unphosphorylated Pho4 accumulates in the nucleus (35). Thus, the most physiologically relevant way to regulate nuclear levels of Pho4 is to grow cells in the presence of different concentrations of Pi (62), leading to different degrees of Pho80-Pho85 activity and redistribution of Pho4 between the nucleus and cytoplasm. We first tested and found that the nuclear level of Pho4-GFP increased in a graded manner across the population of cells at successively lower concentrations of Pi (Fig. 3). This excludes the alternative scenario of an all-or-none binary response where the fraction of cells with nucleus-localized Pho4 increases as the concentration of Pi is decreased.
|
, and swi2 strains (Fig. 4). The cells were internally assayed for rAPase activity (and/or PHO5 mRNA) and subjected to ChIP analysis after 12 h, when steady-state levels of Pho4 binding are achieved (Fig. 2B). At lower Pi availability (0.01 and 0 mM), when Pho4 is mainly nuclear, PHO5 expression showed essentially no dependence on either Gcn5 or SWI/SNF. However, at higher concentrations of Pi (0.2 mM), when the nuclear levels of Pho4 are relatively low, both mutant strains showed severely reduced rAPase activity compared to the wild type (Fig. 4A and C). Northern analysis of the PHO5 transcript showed the same result as the assayed rAPase activities (Fig. 4E). ChIP analysis showed that, in the wild-type strain, Pho4 binding occurred at 0.25 mM Pi. By comparison, a lower Pi concentration (0.1 mM Pi), i.e., more nuclear Pho4, was needed for the activator to associate with PHO5 at similar levels in the gcn5 and swi2 strains (Fig. 4B and D). There was also a clear delay in the kinetics of Pho4 binding at the PHO5 promoter in gcn5 and swi2 mutants (data not shown).
|
, and swi2 strains (Fig. 3). Furthermore, the levels of rAPase activity were the same in wild-type and coactivator mutant cells at 0.01 mM and 0 mM Pi (Fig. 4A and C). Nevertheless, we directly determined by Western blotting that levels of a fully active FLAG-tagged version of Pho4 were unaffected in wild-type, gcn5, and swi2 strains in medium containing or lacking Pi (Fig. 5). We conclude that the degree of Pho4 binding site occupancy at PHO5 is a crucial determinant of the promoter's need for the chromatin remodelers Gcn5 and SWI/SNF in activation, ranging from essentially complete dependence to independence at low and high levels of promoter occupancy, respectively. Moreover, Gcn5 and SWI/SNF are required for maximal association of Pho4 with the PHO5 promoter at intermediate concentrations of Pi. This probably reflects the necessity for Gcn5 and SWI/SNF activity in exposing the high-affinity UASp2 in nucleosome –2 (see Discussion).
|
As above, we performed ChIP with strains expressing Swi2-13myc and Gcn5-13myc that, in addition to the normal genomic GAL1-10 locus, also contain a negative control locus, gal1-10 UASG. This control comprises the entire GAL1-10 promoter with UASG (all four Gal4 sites) deleted, eliminating Gal4 binding and hence recruitment of chromatin modifiers and remodelers. Figure 6A demonstrates that both SWI/SNF and Gcn5 are recruited to the endogenous GAL1-10 UASG in galactose medium when the promoter is transcriptionally active but not in repressive glucose medium. Strong recruitment of both coactivators lends further support to the results of studies suggesting that Gcn5 and SWI/SNF perform partially redundant functions at the GAL1 promoter (7, 49, 51). Moreover, GAL1 expression becomes strongly dependent on Gcn5 and SWI/SNF after deletion of the two high-affinity Gal4 sites of UASG (16, 22, 39), consistent with our working model that high levels of activator binding establish functional redundancy.
|
To test this hypothesis, we used ChIP analysis to assay for the association of Gcn5 and SWI/SNF at representative Rap1 targets for which transcript levels are unaffected in gcn5 or swi2 strains (25, 59), including RPL19B (ribosomal protein), PYK1 (glycolysis), and EFT2 (protein synthesis). Consistent with our working model, in Fig. 6B, D, and E, each of the Rap1 target genes shows significant association with Gcn5 and SWI/SNF relative to the gal1-10 UASG negative control, at which the coactivators were not detected (Fig. 6A). Both coactivators were also recruited to the RPS22B promoter (Fig. 6C), which is a target for Abf1 but not Rap1 (36, 50). This is consistent with studies showing that the activation domains of Abf1 and Rap1 are interchangeable and that both factors can function with core promoters from nonribosomal genes (10, 12, 18). Thus, we conclude that Gcn5 and SWI/SNF associate with a variety of heavily transcribed promoters, despite the observation that they are not needed for expression (25, 59).
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
12 h (Fig. 2); the approximate time needed to overcome the kinetic delay in PHO5 activation in single gcn5 and swi2/snf2 mutants (4, 5, 42). This suggests that each remodeling enzyme is needed primarily when Pho4 binding is limiting. Indeed, PHO5 activation is markedly dependent on both Gcn5 and SWI/SNF at low steady-state promoter occupancy (Fig. 4). Conversely, high nuclear levels of Pho4 lead to marked increases in Pho4 binding and promoter activation in the absence of either Gcn5 or SWI/SNF. Our data suggest, therefore, that the necessity for a specific remodeler can be circumvented by driving promoter occupancy, thereby establishing functional redundancy through increased recruitment of coactivators that normally associate with the promoter. In support of this model, Gcn5 and SWI/SNF are strongly recruited to PHO5 when Pho4 occupancy is high and to representative promoters that are robustly occupied by the abundant transactivators Abf1 or Rap1 (Fig. 6). Association of Pho4 with PHO5 UASp2 requires chromatin modifiers and remodelers. When yeast cells are deprived of Pi, Pho4 is imported into the nucleus and activates genes in the PHO cluster (35). It is thought that at the PHO5 promoter, Pho4 first binds cooperatively with the homeodomain factor Pho2 to the accessible, low-affinity UASp1 (CACGTT) and then to the high-affinity UASp2 (CACGTG), located in nucleosome –2 in the repressed promoter (60). The absolute correlation of PHO5 induction with chromatin disruption has led to the widely accepted view that binding of Pho4 to UASp2 requires remodeling of nucleosome –2. Consistent with this view, several chromatin modifiers and remodelers are recruited to PHO5, including SAGA (4) (Fig. 1), NuA4 (45), and INO80 com (57). We report for the first time that SWI/SNF is also brought directly to the activated PHO5 promoter (Fig. 1).
Our results provide further evidence that efficient association of Pho4 with UASp2 requires chromatin remodeling. The resolution of the ChIP analysis precludes assignment of the relative amounts of Pho4 bound to UASp1 versus UASp2, since they are only 103 bp apart. However, our results in Fig. 4 are clearly consistent with initial, limited Pho4 binding at the nonnucleosomal low-affinity UASp1 followed by a large cooperative increase in binding on chromatin remodeling and exposure of the high-affinity UASp2, as we observed previously (11). The requirement for a higher nuclear concentration of Pho4 in gcn5 and swi2/snf2 mutants suggests that SAGA and SWI/SNF facilitate high-level binding of the activator to UASp2 in nucleosome –2 (Fig. 4) (57). Furthermore, in the absence of Esa1 histone acetyltransferase activity, PHO5 chromatin remodeling and activation under Pi-free conditions is severely deficient and Pho4 binding achieves only about 10% of wild-type levels (45). This suggests that Pho4 binds approximately nine times better to the high-affinity UASp2 than to the low-affinity UASp1 in vivo, in good agreement with gel shift experiments using purified Pho4 protein (65). The need for Esa1 can be overcome only by Pho4 overexpression. By contrast, we and others find that the loss of PHO5 induction in gcn5 and swi2/snf2 mutants can be fully suppressed by wild-type levels of Pho4 expression following many hours in Pi-free medium (4, 5, 16, 20, 42). Taken together, this suggests a greater need for acetylation by Esa1 in NuA4 than by Gcn5 in SAGA for PHO5 induction (45). However, a striking finding of our work is that, even in the presence of a wild-type copy of ESA1, PHO5 induction requires Gcn5 and SWI/SNF at intermediate Pi concentrations (0.2 to 0.25 mM [Fig. 4]). Thus, in the absence of efficient chromatin remodeling, increased activator concentration is again required to achieve high levels of activator binding.
High activator binding site occupancy confers functional redundancy for coactivators. Yeast genes have been classified into three major groups with respect to their need for Gcn5 and SWI/SNF, i.e., those requiring both, either, or neither activity, suggesting that the remodelers have overlapping but independent functions (7, 25, 59). Our results with the PHO5 system show that increases in coactivator recruitment (Fig. 1) correlate well with the time-averaged level of activator binding or promoter occupancy (Fig. 2). We propose that when UASp1 is primarily occupied (rather than UASp2) at intermediate Pi concentrations, the activities of SAGA and SWI/SNF, and perhaps INO80 com and NuA4 (45, 57), are requisite for PHO5 promoter induction. Thus, Gcn5 and SWI/SNF function is required at low levels of activator binding, which probably reflects natural conditions of Pi depletion in which Pi is not completely absent.
Increasing the nuclear level of Pho4 at successively lower concentrations of Pi (Fig. 3) is an effective means of mounting a physiological response of the appropriate magnitude (Fig. 4). Under extreme conditions of sustained growth in the absence of Pi, a robust level of activator binding drives the recruitment of multiple remodeling activities by simple chemical principles, ensuring chromatin disruption and increased transcription. In good agreement with this model, we have observed a strong correlation between the extents of promoter occupancy and chromatin disruption by using a galactose-regulated allele of PHO4 (S. Hoose, A. Dhasarathy, W. Jessen, and M. P. Kladde, unpublished data). Moreover, loss of Gcn5 and SWI/SNF activity delays chromatin remodeling and activation of PHO5 following Pi starvation (4, 5, 42). However, at higher levels of Pho4 binding, sufficient amounts of chromatin modifiers and remodelers are recruited to suppress the transcriptional defects of single gcn5 and swi/snf mutants. In such cases, Gcn5 and SWI/SNF appear to be fully redundant; however, it is equally plausible that recruitment of Esa1 in NuA4 and the INO80 complex establish the functional redundancy at the induced PHO5 promoter.
Possible global roles for coactivators. We show substantial recruitment of Gcn5 and Swi2/Snf2 to PHO5, GAL1, genes involved in protein synthesis (RPL19B, RPS22B, and EFT2), and a glycolytic promoter (PYK1) (Fig. 6), supporting the view that these coactivators play widespread roles in transcription (7). Recruitment occurs despite observations that the transcript levels of each of these genes are unaffected or modestly decreased in gcn5 or swi2/snf2 mutants (14, 25, 59). Esa1 is also recruited to PHO5 and ribosomal promoters (45, 50). It was previously inferred that the abundant ribosomal promoter activators Abf1 and Rap1 could recruit SAGA to the core promoters of natural and chimeric reporter genes (12). Our finding that Gcn5 directly associates with RPL19B and RPS22B supports this conclusion and shows that SWI/SNF is directly recruited as well.
Why might chromatin modifiers and remodelers be recruited to such strongly transcribed promoters? Robust recruitment and retention of coactivators may ensure that an active chromatin configuration is established at critical promoters following nascent chromatin deposition in S phase. Alternatively, increasing evidence suggests that chromatin remodelers are continuously required because there is a rapid, dynamic equilibrium between active and repressive chromatin structures (7, 8, 58). By our working model, the position of this equilibrium is set by the "recruitment potential" of bound upstream activators and thus the level of coactivator recruitment. Furthermore, we suggest that changes in activator or coactivator concentration, activator DNA binding domain/binding site affinity, and binding cooperativity modulate the transcriptional requirements for individual chromatin modifiers and remodelers at various promoters. Additionally, weakening an activation domain renders reporters with nonnucleosomal TATA elements or those with nucleosomal TATA elements more dependent on Gcn5 and SWI/SNF function (56), presumably due to a decreased ability to recruit coactivators. We propose that each of these factors must be evaluated to fully delimit the coactivator requirements of a given promoter.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant CA095525 from the National Cancer Institute to M.P.K. and in part by a Texas Higher Education Coordinating Board ARP award to M.P.K.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos. 2000. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-ß promoter. Cell 103:667-678.[CrossRef][Medline]
3. Almer, A., and W. Hörz. 1986. Nuclease hypersensitive regions with adjacent positioned nucleosomes mark the gene boundaries of the PHO5/PHO3 locus in yeast. EMBO J. 5:2681-2687.[Medline]
4. Barbaric, S., H. Reinke, and W. Hörz. 2003. Multiple mechanistically distinct functions of SAGA at the PHO5 promoter. Mol. Cell. Biol. 23:3468-3476.
5. Barbaric, S., J. Walker, A. Schmid, J. Q. Svejstrup, and W. Hörz. 2001. Increasing the rate of chromatin remodeling and gene activation—a novel role for the histone acetyltransferase Gcn5. EMBO J. 20:4944-4951.[CrossRef][Medline]
6. Bhaumik, S. R., and M. R. Green. 2001. SAGA is an essential in vivo target of the yeast acidic activator Gal4p. Genes Dev. 15:1935-1945.
7. Biggar, S. R., and G. R. Crabtree. 1999. Continuous and widespread roles for the Swi-Snf complex in transcription. EMBO J. 18:2254-2264.[CrossRef][Medline]
8. Boeger, H., J. Griesenbeck, J. S. Strattan, and R. D. Kornberg. 2003. Nucleosomes unfold completely at a transcriptionally active promoter. Mol. Cell. 11:1587-1598.[CrossRef][Medline]
9. Brownell, J. E., J. X. Zhou, T. Ranalli, R. Kobayashi, D. G. Edmondson, S. Y. Roth, and C. D. Allis. 1996. Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 84:843-851.[CrossRef][Medline]
10. Buchman, A. R., and R. D. Kornberg. 1990. A yeast ARS-binding protein activates transcription synergistically in combination with other weak activating factors. Mol. Cell. Biol. 10:887-897.
11. Carvin, C. D., A. Dhasarathy, L. B. Friesenhahn, W. J. Jessen, and M. P. Kladde. 2003. Targeted cytosine methylation for in vivo detection of protein-DNA interactions. Proc. Natl. Acad. Sci. USA 100:7743-7748.
12. Cheng, J. X., M. Floer, P. Ononaji, G. Bryant, and M. Ptashne. 2002. Responses of four yeast genes to changes in the transcriptional machinery are determined by their promoters. Curr. Biol. 12:1828-1832.[CrossRef][Medline]
13. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97:299-311.[CrossRef][Medline]
14. Dudley, A. M., C. Rougeulle, and F. Winston. 1999. The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo. Genes Dev. 13:2940-2945.
15. Fry, C. J., and C. L. Peterson. 2001. Chromatin remodeling enzymes: who's on first? Curr. Biol. 11:R185-R197.[CrossRef][Medline]
16. Gaudreau, L., A. Schmid, D. Blaschke, M. Ptashne, and W. Hörz. 1997. RNA polymerase II holoenzyme recruitment is sufficient to remodel chromatin at the yeast PHO5 promoter. Cell 89:55-62.[CrossRef][Medline]
17. Giniger, E., S. M. Varnum, and M. Ptashne. 1985. Specific DNA binding of GAL4, a positive regulatory protein of yeast. Cell 40:767-774.[CrossRef][Medline]
18. Goncalves, P. M., K. Maurer, A. G. van Nieuw, K. Bergkamp-Steffens, W. H. Mager, and R. J. Planta. 1996. C-terminal domains of general regulatory factors Abf1p and Rap1p in Saccharomyces cerevisiae display functional similarity. Mol. Microbiol. 19:535-543.[CrossRef][Medline]
19. Grant, P. A., L. Duggan, J. Côté, S. M. Roberts, J. E. Brownell, R. Candau, R. Ohba, T. Owen-Hughes, C. D. Allis, F. Winston, S. L. Berger, and J. L. Workman. 1997. Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11:1640-1650.
20. Gregory, P. D., A. Schmid, M. Zavari, L. Lui, S. L. Berger, and W. Hörz. 1998. Absence of Gcn5 HAT activity defines a novel state in the opening of chromatin at the PHO5 promoter in yeast. Mol. Cell 1:495-505.[CrossRef][Medline]
21. Gregory, P. D., A. Schmid, M. Zavari, M. Münsterkötter, and W. Hörz. 1999. Chromatin remodelling at the PHO8 promoter requires SWI-SNF and SAGA at a step subsequent to activator binding. EMBO J. 18:6407-6414.[CrossRef][Medline]
22. Griffin-Burns, L., and C. L. Peterson. 1997. The yeast SWI-SNF complex facilitates binding of a transcriptional activator to nucleosomal sites in vivo. Mol. Cell. Biol. 17:4811-4819.[Abstract]
23. Hassan, A. H., K. E. Neely, M. Vignali, J. C. Reese, and J. L. Workman. 2001. Promoter targeting of chromatin-modifying complexes. Front. Biosci. 6:D1054-D1064.[Medline]
24. Hirschhorn, J. N., S. A. Brown, C. D. Clark, and F. Winston. 1992. Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure. Genes Dev. 6:2288-2298.
25. Holstege, F. C. P., E. G. Jennings, J. J. Wyrick, T. I. Lee, C. J. Hengartner, M. R. Green, T. Golub, E. S. Lander, and R. A. Young. 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95:717-728.[CrossRef][Medline]
26. Howe, L., C. E. Brown, T. Lechner, and J. L. Workman. 1999. Histone acetyltransferase complexes and their link to transcription. Crit. Rev. Eukaryot. Gene Expr. 9:231-243.[Medline]
27. Ikeda, K., D. J. Steger, A. Eberharter, and J. L. Workman. 1999. Activation domain-specific and general transcription stimulation by native histone acetyltransferase complexes. Mol. Cell. Biol. 19:855-863.
28. Kaffman, A., N. M. Rank, E. M. O'Neill, L. S. Huang, and E. K. O'Shea. 1998. The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus. Nature 396:482-486.[CrossRef][Medline]
29. Kaffman, A., N. M. Rank, and E. K. O'Shea. 1998. Phosphorylation regulates association of the transcription factor Pho4 with its import receptor Pse1/Kap121. Genes Dev. 12:2673-2683.
30. Kingston, R. E., and G. J. Narlikar. 1999. ATP-dependent remodeling and acetylation as regulators of chromatin fluidity. Genes Dev. 13:2339-2352.
31. Komeili, A., and E. K. O'Shea. 1999. Roles of phosphorylation sites in regulating activity of the transcription factor Pho4. Science 284:977-980.
32. Krebs, J. E., C. J. Fry, M. L. Samuels, and C. L. Peterson. 2000. Global role for chromatin remodeling enzymes in mitotic gene expression. Cell 102:587-598.[CrossRef][Medline]
33. Larschan, E., and F. Winston. 2001. The S. cerevisiae SAGA complex functions in vivo as a coactivator for transcriptional activation by Gal4. Genes Dev. 15:1946-1956.
34. Legrain, M., M. De Wilde, and F. Hilger. 1986. Isolation, physical characterization and expression analysis of the Saccharomyces cerevisiae positive regulatory gene PHO4. Nucleic Acids Res. 14:3059-3073.
35. Lenburg, M. E., and E. K. O'Shea. 1996. Signaling phosphate starvation. Trends Biochem. Sci. 21:383-387.[CrossRef][Medline]
36. Lieb, J. D., X. Liu, D. Botstein, and P. O. Brown. 2001. Promoter-specific binding of Rap1 revealed by genome-wide maps of protein-DNA association. Nat. Genet. 28:327-334.[CrossRef][Medline]
37. Lomvardas, S., and D. Thanos. 2002. Modifying gene expression programs by altering core promoter chromatin architecture. Cell 110:261-271.[CrossRef][Medline]
38. Lusser, A., and J. T. Kadonaga. 2003. Chromatin remodeling by ATP-dependent molecular machines. Bioessays 25:1192-1200.[CrossRef][Medline]
39. Marcus, G. A., N. Silverman, S. L. Berger, J. Horiuchi, and L. Guarente. 1994. Functional similarity and physical association between GCN5 and ADA2: putative transcriptional adaptors. EMBO J. 13:4807-4815.[Medline]
40. Morse, R. H. 2000. RAP, RAP, open up. New wrinkles for RAP1 in yeast. Trends Genet. 16:51-53.[CrossRef][Medline]
41. Narlikar, G. J., H. Y. Fan, and R. E. Kingston. 2002. Cooperation between complexes that regulate chromatin structure and transcription. Cell 108:475-487.[CrossRef][Medline]
42. Neef, D. W., and M. P. Kladde. 2003. Polyphosphate loss promotes SNF/SWI- and Gcn5-dependent mitotic induction of PHO5. Mol. Cell. Biol. 23:3788-3797.
43. Neely, K. E., A. H. Hassan, A. E. Wallberg, D. J. Steger, B. R. Cairns, A. P. H. Wright, and J. L. Workman. 1999. Activation domain-mediated targeting of the SWI/SNF complex to promoters stimulates transcription from nucleosome arrays. Mol. Cell 4:649-655.[CrossRef][Medline]
44. Neely, K. E., A. H. Hassan, C. E. Brown, L. Howe, and J. L. Workman. 2002. Transcription activator interactions with multiple SWI/SNF subunits. Mol. Cell. Biol. 22:1615-1625.
45. Nourani, A., R. T. Utley, S. Allard, and J. Côté. 2004. Recruitment of the NuA4 complex poises the PHO5 for chromatin remodeling and activation. EMBO J. 23:2597-2607.[CrossRef][Medline]
46. O'Neill, E. M., A. Kaffman, E. R. Jolly, and E. K. O'Shea. 1996. Regulation of PHO4 nuclear localization by the PHO80-PHO85 cyclin-CDK complex. Science 271:209-212.[Abstract]
47. Owen-Hughes, T., and J. L. Workman. 1994. Experimental analysis of chromatin function in transcription control. Crit. Rev. Eukaryot. Gene Expr. 4:403-441.[Medline]
48. Peterson, C. L., and I. Herskowitz. 1992. Characterization of the yeast SWI1, SWI2 and SWI3 genes, which encode a global activator of transcription. Cell 68:573-583.[CrossRef][Medline]
49. Pollard, K. J., and C. L. Peterson. 1998. Chromatin remodeling: a marriage between two families? Bioessays 20:771-780.[CrossRef][Medline]
50. Reid, J. L., V. R. Iyer, P. O. Brown, and K. Struhl. 2000. Coordinate regulation of yeast ribosomal protein genes is associated with targeted recruitment of Esa1 histone acetylase. Mol. Cell 6:1297-1307.[CrossRef][Medline]
51. Roberts, S. M., and F. Winston. 1997. Essential functional interactions of SAGA, a Saccharomyces cerevisiae complex of Spt, Ada, and Gcn5 proteins, with the Snf/Swi and Srb/mediator complexes. Genetics 147:451-465.[Abstract]
52. Ryan, M. P., R. Jones, and R. H. Morse. 1998. SWI-SNF complex participation in transcriptional activation at a step subsequent to activator binding. Mol. Cell. Biol. 18:1774-1782.
53. Ryan, M. P., G. A. Stafford, L. Yu, and R. H. Morse. 2000. Artificially recruited TATA-binding protein fails to remodel chromatin and does not activate three promoters that require chromatin remodeling. Mol. Cell. Biol. 20:5847-5857.
54. Smith, E. R., A. Eisen, W. Gu, M. Sattah, A. Pannuti, J. Zhou, R. G. Cook, J. C. Lucchesi, and C. D. Allis. 1998. ESA1 is a histone acetyltransferase that is essential for growth in yeast. Proc. Natl. Acad. Sci. USA 95:3561-3565.
55. Soutoglou, E., and I. Talianidis. 2002. Coordination of PIC assembly and chromatin remodeling during differentiation-induced gene activation. Science 295:1901-1904.
56. Stafford, G. A., and R. H. Morse. 2001. Gcn5 dependence of chromatin remodeling and transcriptional activation by the Gal4 and VP16 activation domains in budding yeast. Mol. Cell. Biol. 21:4568-4578.
57. Steger, D. J., E. S. Haswell, A. L. Miller, S. R. Wente, and E. K. O'Shea. 2002. Regulation of chromatin remodeling by inositol polyphosphates. Science 299:114-116.
58. Sudarsanam, P., Y. Cao, L. Wu, B. C. Laurent, and F. Winston. 1999. The nucleosome remodeling complex, Snf/Swi, is required for the maintenance of transcription in vivo and is partially redundant with the histone acetyltransferase, Gcn5. EMBO J. 18:3101-3106.[CrossRef][Medline]
59. Sudarsanam, P., V. R. Iyer, P. O. Brown, and F. Winston. 2000. Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 97:3364-3369.
60. Svaren, J., and W. Hörz. 1997. Transcription factors vs. nucleosomes: regulation of the PHO5 promoter in yeast. Trends. Biochem. Sci. 22:93-97.[CrossRef][Medline]
61. Terrell, A. R., S. Wongwisansri, J. L. Pilon, and P. J. Laybourn. 2002. Reconstitution of nucleosome positioning, remodeling, histone acetylation, and transcriptional activation on the PHO5 promoter. J. Biol. Chem. 277:31038-31047.
62. Toh-e, A., Y. Ueda, S. I. Kakimoto, and Y. Oshima. 1973. Isolation and characterization of acid phosphatase mutants in Saccharomyces cerevisiae. J. Bacteriol. 113:727-738.
63. Venter, U., J. Svaren, J. Schmitz, A. Schmid, and W. Hörz. 1994. A nucleosome precludes binding of the transcription factor Pho4 in vivo to a critical target site in the PHO5 promoter. EMBO J. 13:4848-4855.[Medline]
64. Vignali, M., A. H. Hassan, K. E. Neely, and J. L. Workman. 2000. ATP-dependent chromatin-remodeling complexes. Mol. Cell. Biol. 20:1899-1910.
65. Vogel, K., W. Hörz, and A. Hinnen. 1989. The two positively acting regulatory proteins PHO2 and PHO4 physically interact with PHO5 upstream activation regions. Mol. Cell. Biol. 9:2050-2057.
66. Wallberg, A. E., K. E. Neely, A. H. Hassan, J. A. Gustafsson, J. L. Workman, and A. P. Wright. 2000. Recruitment of the SWI-SNF chromatin remodeling complex as a mechanism of gene activation by the glucocorticoid receptor tau1 activation domain. Mol. Cell. Biol. 20:2004-2013.
67. Yudkovsky, N., C. Logie, S. Hahn, and C. L. Peterson. 1999. Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Genes Dev. 13:2369-2374.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||
