Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2005, p. 3056-3062, Vol. 25, No. 8
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.8.3056-3062.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Institute of Molecular Medicine, Department of Medicine, University of California, San Diego, La Jolla, California
Received 13 October 2004/ Returned for modification 21 November 2004/ Accepted 13 January 2005
|
|
|---|
|
|
|---|
An essential binding partner of the integrin cytoplasmic domain is the integrin-linked kinase (ILK). ILK is an ankyrin (ANK) repeat protein containing a serine/threonine kinase domain, which interacts with the cytoplasmic tail of ß1, ß2, and ß3 integrins (21). ILK couples integrins and growth factors to downstream signaling pathways, leading to the regulation of diverse processes, such as cell cycle progression, survival, division, and changes in morphology and spreading (9, 10, 49). Genetic studies of Drosophila melanogaster, Caenorhabditis elegans, and mice have provided direct evidence that ILK can function as an important mediator of the integrin-dependent signaling pathway (31, 38, 50). ILK is composed of four ANK repeats (21), a pleckstrin homology (PH)-like domain (11), and a C-terminal Ser/Thr kinase domain (21). The first ANK domain has been shown to bind to the two highly related LIM-domain-only proteins PINCH1 and -2 (4, 44, 51).
PINCH, which is composed of five tandemly arrayed LIM domains, has been suggested to play a role in integrin-ILK function (36, 48). LIM domains are double zinc finger structures that serve as protein binding interfaces (33, 39). It has been suggested that PINCH functions as a molecular scaffold that supports the assembly of a multiprotein complex at sites of integrin enrichment (48). Biochemical studies of human PINCH1 have identified ILK as a binding partner for the first LIM domain of PINCH (44) and the SH2-SH3 adaptor protein NCK2 as a partner for the fourth LIM domain (45). Both the colocalization of PINCH1 with integrins and its capacity to bind ILK and NCK2 provided the first hints that PINCH1 might play a role in recruitment of regulatory factors to integrin-rich sites and, therefore, contribute to the integrin signaling cascade (47, 49).
Genetic studies of C. elegans and Drosophila point to an essential role of PINCH as an adaptor protein in mediating integrin-ILK-dependent signaling (7, 24). The deletion of UNC-97, an orthologue of PINCH1, in C. elegans results in an embryonic-lethal phenotype called PAT (paralyzed and arrested elongation at the twofold stage) (24) resembling that of ß-integrin/PAT-3 (15) or ILK/PAT-4 (31). In Drosophila muscle, PINCH displays a completely overlapping expression pattern with ILK and ßPS integrin, prominently enriched at the muscle attachment sites (7). Flies deficient in PINCH1 (named stck in Drosophila) exhibit muscle detachment, similar to the phenotypes of ILK and PS-integrin (7, 28, 32, 50).
In this study, we report the phenotype of PINCH1 germ line-deficient mice and mice in which PINCH1 has been specifically deleted in ventricular cardiomyocytes. We show that PINCH1 is already detectable in blastocysts at approximately E3.5. PINCH1/ embryos at E5.5 exhibit a disorganized egg cylinder, with decreased cell proliferation and excessive cell death, thus pointing to an important role of PINCH1 in the formation of egg cylinders. We also show that mice in which PINCH1 is specifically deleted in cardiomyocytes exhibit no basal phenotype with regard to mouse survival, cardiac histology, or cardiac function.
|
|
|---|
![]() View larger version (17K): [in a new window] |
FIG. 1. Targeted generation of PINCH1-null mice. (A) Targeting strategy. A restriction map of the relevant genomic region of PINCH1 is shown on the top, the targeting construct is shown in the center, and the mutated locus after recombination is shown at the bottom. The targeting construct was generated by introducing one loxP site into the second intron and another loxP site and the neo cassette flanked by frt sites into the third intron of the PINCH1 gene. B, BamHI; S, SalI; X, XbaI. neo represents the neomycin resistance gene, arrowheads represent loxP sites, and the long boxes represent frt sites. (B and C) Detection of wild-type and targeted alleles by Southern blot analysis. DNAs from electroporated ES cells (B) and from the progeny of germ line-transmitted chimera mice (C) were digested with BamHI and analyzed by Southern blot analysis with the probe as shown in panel A. The 11- and 7.5-kb bands represent wild-type and mutant alleles, respectively.
|
Generation and genotyping of mice. Two independent homologous recombinant clones were microinjected into blastocysts from C57BL/6J mice at the Transgenic Core Facility of the University of California, San Diego. Male chimeras were inbred with female Black Swiss mice to generate germ line-transmitted heterozygous mice with a neo cassette (PINCH1+/flox+neo). PINCH1+/flox+neo micewere crossed with protamine-Cre (Pro-Cre) mice (35), generating mice which were doubly heterozygous (Pro-Cre/PINCH1+/flox+neo). Cre expression in Pro-Cre mice is restricted to male germ cells undergoing spermatogenesis. Therefore, Pro-Cre/PINCH1+/flox+neo males were crossed to female breeders to generate germ line-heterozygous-null mutant offspring. Heterozygous mice were interbred to generate homozygous knockouts. Progeny from these crosses were genotyped by PCR with the wild-type-specific primers (forward primer, P1, CCCAGAAGGACTCTTTTATGAG; reverse primer, P2, CTTGGAGAAGAAGTACTCAGGT) and primers for the mutant allele (neo-specific primer, Pneo, AATGGGCTGACCGCTTCCTCGT; reverse primer, P3, CTTGGAGAAGAAGTACTCAGGT). To identify the genotype of the embryos at the peri-implantation stage, uterine deciduas around E5.5 were sectioned and stained with antibody specific for PINCH1 as described as below.
PINCH1+/flox+neo mice were crossed with FLPase deleter mice (37), which delete DNA sequences flanked by two frt sites in all cell types. This resulted in the generation of mice with a floxed PINCH1 allele no longer containing the neo cassette (PINCH1+/flox). PINCH1+/flox mice were subsequently intercrossed and crossed with MLC2v-Cre mice (5, 6) to generate mice which were homozygous floxed (PINCH1flox/flox) and doubly heterozygous for PINCH1 floxed allele and MLC2v-Cre allele (PINCH1+/flox+neo Cre). Interbreeding between both PINCH1flox/flox mice and the PINCH1+/flox+neo Cre mice was used to generate mice in which PINCH1 is specifically deleted in ventricular cardiomyocytes. To genotype PINCH1 floxed and MLC2v-Cre-positive alleles, PINCH1 primers (forward primer, P4, CCCAGAAGGACTCTTTTATGAG; reverse primer, P5, CTTGGAGAAGAAGTACTCAGGT) and Cre primers (forward primer, Pcre1, GTTCGCAAGAACCTGATGGACA; reverse primer, Pcre2, CTAGAGCCTGTTTTGCACGTTC) were used.
Reverse transcription-PCR (RT-PCR) analysis. Total RNA was isolated from ES cells and embryos at E6.5 and E7.5 by using Trizol reagent (GIBCO BRL). First-strand cDNA synthesis was performed with the random primer and Superscript kit (Invitrogen). The cDNA was utilized as a PCR template to perform PCR by standard protocols. Specific primers for PINCH1 (forward, TCAAGAATGCTGGCAGACAC; reverse, ACACCAGGCCTTGTTGAGAG) were utilized.
In situ hybridization. Whole-mount in situ hybridization was carried out with digoxigenin-labeled RNA probes as previously described (46). A murine RNA probe spanning the 1,000-bp fragment of PINCH1 cDNA was utilized.
Dissection and histological analysis of embryos. Timed matings were conducted with interbreeding between PINCH1+/ mice. Females with copulation plugs were considered to be at embryonic development day 0.5 (E0.5) of gestation. Pregnant females were sacrificed at different time points of gestation, and the embryos were dissected from maternal tissue, examined, photographed, and genotyped by PCR. For histological preparations, embryos in decidua were fixed in 4% paraformaldehyde overnight at 4°C and destined for paraffin embedding. Serial sagittal sections were cut at 5 µm from paraffin blocks and stained with hematoxylin and eosin.
Immunostaining assays. Five-micrometer sections were treated for 1 h with 5% bovine serum albumin in phosphate-buffered saline and subsequently incubated overnight at 4°C in a humidified chamber with a polyclonal antibody to PINCH1 (provided by A. Rearden, University of California, San Diego). After being washed with 0.25% Triton X-100 in phosphate-buffered saline, the sections were incubated with fluorescently labeled secondary antibodies. The specimens embedded in Vectashield mounting medium (Vector Laboratories) were analyzed under the fluorescence microscope.
BrdU labeling of embryos. Pregnant females at E5.5 were injected intraperitoneally with bromodeoxyuridine (BrdU; Amersham-Pharmacia, Little Chalfont, Buckinghamshire, United Kingdom) and sacrificed 2 h later. Deciduae were removed and fixed in 4% paraformaldehyde overnight at 4°C. Five-micrometer sections were denatured with 2 N HCl, trypsinized, and incubated with a mouse monoclonal antibody to BrdU (Sigma; B 2531). Detection was performed utilizing a peroxidase ABC kit (Vector Laboratories) and 3,3-diaminobenzidine. BrdU-labeled cells were counted from sections. For quantitative analyses, representative sections from ventral, mid-, and dorsal levels of each embryo were utilized to count the total number of cells and the number that were labeled with BrdU, to give a proliferation index.
Apoptosis assays. Implantation sites (from E5.5 to E6.5) were collected for apoptosis studies. To detect apoptotic cells, the terminal deoxynucleotidyltransferase-mediated biotinylated UTP nick end labeling (TUNEL) assay was performed according to the manufacturer's instructions (fluorescein in situ cell death detection kit; Boehringer Mannheim, Mannheim, Germany). Sections were counterstained with 4',6-diamidino-2-phenylindole (DAPI) nuclear stain (Vector Laboratories). In addition to TUNEL staining, DNA fragmentation was verified under UV illumination by using the DAPI counterstain.
Echocardiographic analysis. Mice were anesthetized with isofluorane and subjected to echocardiography as previously described (43).
|
|
|---|
The targeting vector for PINCH1 was designed as shown in Fig. 1A, in which one loxP site was introduced into the second intron and a second loxP site as well as the neo cassette flanked by frt sites was introduced into the third intron of the PINCH1 gene. This targeting vector was linearized with SalI and introduced into R1 ES cells via electroporation. G418-resistant ES clones were screened for homologous recombination by Southern blot analysis. Of 394 ES cell clones analyzed (Fig. 1B), two had undergone homologous recombination. These two ES cell clones were independently injected into blastocysts and gave rise to chimera mice that were then used to breed mice which would be germ line-transmitting heterozygous mice with the neo cassette (PINCH1+/flox+neo). The PINCH1+/flox+neo mice were then bred to homozygosity for the conditional allele (PINCH1flox+neo/flox+neo). Although the PINCH1flox+neo/flox+neo mice can survive and seem normal, to avoid potential effects of the neo cassette on PINCH1 gene expression, we crossed PINCH1+/flox+neo mice with FLPase deleter mice (37), which deletes DNA sequences flanked by two frt sites in all cell types. This resulted in the generation of mice with a floxed PINCH1 allele no longer containing the neo cassette (PINCH1+/flox). PINCH1+/flox mice were subsequently intercrossed to generate mice which were homozygous floxed (PINCH1flox/flox). The PINCH1flox/flox mice were then crossed with MLC2v-Cre mice to generate mice in which PINCH1 is specifically deleted in ventricular cardiomyocytes.
PINCH1+/flox+neo mice were crossed with Pro-Cre mice (35), generating mice which were doubly heterozygous (Pro-Cre PINCH1+/flox+neo). Cre expression in Pro-Cre mice is restricted to male germ cells undergoing spermatogenesis. Therefore Pro-Cre PINCH1+/flox+neo males were crossed to female breeders to generate germ line-heterozygous-null mutant offspring.
The PINCH1 null mutation results in early embryonic lethality. Heterozygous PINCH1 mutants survive and have no apparent phenotype. Heterozygous PINCH1 mice were interbred in an attempt to generate homozygous knockouts. However, the genotypic analysis of mice generated from interbred heterozygous PINCH1 mice failed to detect any homozygous null offspring in over 200 mice that were analyzed. Of the progeny from heterozygote intercrosses, 30% (n = 60) were wild type and 70% (n = 140) were heterozygous for the PINCH1 gene (Table 1). Approximately 50 homozygous knockout offspring would have been expected, if homozygous mice were to be viable. These results indicated that loss of PINCH1 function is associated with embryonic lethality.
|
View this table: [in a new window] |
TABLE 1. Phenotypes and genotypes of offspring from PINCH+/ intercrosses
|
![]() View larger version (65K): [in a new window] |
FIG. 2. Phenotype of PINCH1/ embryos at the gross morphological level. (A) At the gross morphological level, a PINCH1/ embryo of E6.5 appears smaller than its wild-type littermate and degenerated. Bar, 50 µm. (B) The genotypes of embryos were identified by PCR.
|
![]() View larger version (135K): [in a new window] |
FIG. 3. Histological analysis of embryos generated from PINCH1 heterozygous intercrosses by hematoxylin and eosin staining. (A and B) Sagittal sections of E5.5 control (A) and mutant (B) embryos. (C and D) Sagittal sections of E6.5 control (C) and mutant (D) embryos. de, decidua; epc, ectoplacental cone; ee, extraembryonic ectoderm; e, ectoderm; ve, visceral endoderm. Bar, 50 µm.
|
![]() View larger version (62K): [in a new window] |
FIG. 4. PINCH1 expression in mouse embryos at early stages. (A) RT-PCR shows that PINCH1 expression is already detectable in blastocysts at E3.5. Total RNA was isolated from blastocysts of E3.5 and embryos at E6.5 and E7.5 and analyzed by RT-PCR with specific primers for PINCH1. Lane 1, negative control; lane 2, E3.5; lane 3, E6.5; lane 4, E7.5. (B) Whole-mount in situ hybridization with PINCH1 probe demonstrates that PINCH1 is highly expressed in the neuroectoderm at E6.5 and E7.5, with more diffuse staining in the remainder of the embryo. (C) Western blot analysis shows that PINCH1 is detectable in E3.5 blastocysts. Protein was isolated from E3.5 blastocysts and E7.5 embryos and analyzed with a specific antibody to PINCH1.
|
![]() View larger version (120K): [in a new window] |
FIG. 5. BrdU labeling and TUNEL analysis of PINCH1 mutants and control littermates at E5.5. (A and B) Immunostaining with PINCH1 antibody identified control (A) and PINCH1 mutant (B) embryos. (C and D) BrdU labeling showed proliferation indices in control littermates (C) and PINCH1 mutants (D), showing lower proliferative activity in PINCH1 mutants than in control littermates. (E to H) TUNEL analysis performed on sections from control littermates (E) and PINCH1 mutants (F); DAPI staining was used to visualize nuclei of control littermates (G) and mutants (H). Bar, 50 µm.
|
Mice in which PINCH1 is specifically deleted in ventricular cardiomyocytes exhibit no basal phenotype with regard to mouse survival, cardiac histology, or cardiac function. It has been shown that mice which have ß1 integrin specifically deleted in ventricular cardiomyocytes display myocardial fibrosis and depressed left ventricular contractility and relaxation (40). In addition, a recent study demonstrated that PINCH1 forms a functional complex with ß4 thymosin and ILK. This complex was suggested to play an essential role in promoting cardiomyocyte migration and survival (2). To determine the functional role of PINCH1 in cardiomyocytes, we generated mice in which PINCH1 has been specifically deleted in ventricular cardiomyocytes by utilizing MLC2v-Cre mice. These mice have been shown to mediate DNA recombination specifically in ventricular cardiomyocytes starting from embryonic day 8.5 (5). Pups in which PINCH1 has been specifically deleted in ventricular cardiomyocytes (PINCH1flox/flox Cre+/) were born normally, were externally indistinguishable from littermates of other genotypes, were recovered at Mendelian frequency (for MLC2v wild-type mice, 19 offspring were PINCHflox/flox and 18 were PINCHflox/+; for MLC2v-Cre/+ mice, 18 offspring were PINCHflox/flox and 23 were PINCHflox/+), and grew to adulthood without signs of cardiac malfunction.
DNA analysis of adult animals (1 to 2 months old) confirmed PINCH1 gene excision only in ventricular tissue derived from PINCH1flox/flox Cre+/ mice, with an efficiency of Cre-mediated recombination of approximately 85% (data not shown), which is in agreement with other studies with MLC2v-Cre-mediated excision (5, 12, 20, 22, 40).
To determine whether the PINCH1flox/flox Cre+/ mice display any histological changes, we performed histological studies. Paraffin sections (10 µm) of heart from PINCH1flox/flox Cre+/ and PINCH1flox/flox littermate controls (6 months old) were stained with hematoxylin and eosin. All specimens appeared normal, exhibiting no sign of hypertrophy, myocardial disarray, infarction, necrosis, fibrosis, calcification, or fat infiltration (data not shown). Cardiac function was evaluated noninvasively by echocardiography at 4 to 6 months of age. There were no significant differences in all of the echocardiographic parameters assessed between wild-type and mutant groups (Table 2).
|
View this table: [in a new window] |
TABLE 2. Echocardiographic measurements under basal conditionsa
|
|
|
|---|
Morphogenesis of peri-implantation mouse embryos involves extensive cell-cell and cell matrix interactions. During the peri-implantation period, the inner cell mass (ICM) of the blastocyst develops into the primitive endoderm and the epiblast, which form the embryo proper (42). The primitive endoderm forms the surface of the ICM of blastocyst and deposits a basement membrane. The basement membrane is required for adjacent ICM cells to polarize and establish the columnar epiblast (8). The importance of integrin-ILK-mediated cell-cell and cell-matrix interactions during early embryonic development is highlighted by genetic studies in mouse models (1, 13, 29, 38, 41). In ß1-integrin-deficient embryos, the primitive endoderm fails to produce laminin
1 and therefore no basement membrane is formed (1, 29). In mouse embryos lacking ILK, the primitive endoderm differentiates and produces a basement membrane but the epiblast fails to polarize or cavitate, and mutants die at the peri-implantation stage (38).
Biochemical studies have demonstrated that PINCH1 functions as an important mediator of integrin- and ILK-dependent signaling pathways (14, 19). Here, we show that PINCH1-null mutant mice, like ß1-integrin- and ILK-null mutant mice, die at the peri-implantation stage, providing in vivo evidence that PINCH1 is a critical component of the integrin-ILK pathway in vertebrates.
Our data on PINCH1 germ line-knockout mice are consistent with genetic studies in C. elegans and Drosophila (7, 24). Deletion of PINCH in C. elegans results in an embryonic-lethal phenotype called PAT (24), resembling that of ß-integrin/PAT-3 (15) or ILK/PAT-4 (31). PINCH-deficient flies exhibit muscle detachment, similar to the phenotypes of ILK and PS-integrin (7, 28, 32, 50). All these data suggest that the ß1-integrin-ILK-PINCH complex is a functional complex that is highly conserved from invertebrates to mammals.
To our surprise, mice in which PINCH1 has been specifically deleted in ventricular cardiomyocytes exhibit no basal phenotype with regard to mouse survival, cardiac histology, or cardiac function as measured by echocardiography. Although this is a negative result, we think it is a very significant one, for reasons discussed below.
So far all data from Drosophila, C. elegans, mammalian cells, and our studies with mouse embryos have indicated that PINCH1 is indispensable for ß1-integrin function (see discussion above). Mice which have ß1-integrin specifically deleted in ventricular cardiomyocytes, with the use of the same MLC2v-Cre mouse that we used in our studies, display myocardial fibrosis, depressed left ventricular contractility and relaxation, and development of heart failure by 6 months of age (40). Our data demonstrate that PINCH1 is dispensable for ß1-integrin function in ventricular cardiomyocytes.
Additionally, a recent study demonstrated that PINCH1 forms a functional complex with ß4 thymosin and ILK. This complex was suggested to play an essential role in promoting cardiomyocyte migration and survival (2). Our data suggest that, if this complex does play an essential role in cardiomyocyte migration and survival, PINCH1 is certainly dispensable for the complex.
Two highly homologous proteins, PINCH1 and PINCH2, are encoded by two distinct genes (48) and have both been shown to interact with the ANK domain of ILK (48). Both proteins are widely expressed, which raised the possibility that they could be functionally redundant (48). Our data demonstrate that PINCH1 is essential for early murine embryonic development and that PINCH2 cannot compensate for the loss of PINCH1 during early embryonic development. However, it is possible that the lack of phenotype in mice in which PINCH1 is specifically deleted in ventricular cardiomyocytes is due to a redundant role of PINCH2 in cardiomyocytes.
This work was supported by a grant from NIH (J. Chen).
|
|
|---|
gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development 125:1943-1949.[Abstract]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»