This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J. H.
Right arrow Articles by Ryu, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J. H.
Right arrow Articles by Ryu, S. H.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, April 2005, p. 3194-3208, Vol. 25, No. 8
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.8.3194-3208.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Novel Functions of the Phospholipase D2-Phox Homology Domain in Protein Kinase C{zeta} Activation{dagger}

Jong Hyun Kim,1 Jung Hwan Kim,1 Motoi Ohba,2 Pann-Ghill Suh,1 and Sung Ho Ryu1*

Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, Republic of Korea,1 Institute of Molecular Oncology, Showa University, Shinagawa-ku, Tokyo, Japan2

Received 1 June 2004/ Returned for modification 2 August 2004/ Accepted 7 January 2005


arrow
ABSTRACT
 
It has been established that protein kinase C{zeta} (PKC{zeta}) participates in diverse signaling pathways and cellular functions in a wide variety of cells, exhibiting properties relevant to cellular survival and proliferation. Currently, however, the regulation mechanism of PKC{zeta} remains elusive. Here, for the first time, we determine that phospholipase D2 (PLD2) enhances PKC{zeta} activity through direct interaction in a lipase activity-independent manner. This interaction of the PLD2-Phox homology (PX) domain with the PKC{zeta}-kinase domain also induces the activation loop phosphorylation of PKC{zeta} and downstream signal stimulation, as measured by p70 S6 kinase phosphorylation. Furthermore, only the PLD2-PX domain directly stimulates PKC{zeta} activity in vitro, and it is necessary for the formation of the ternary complex with phosphoinositide-dependent kinase 1 and PKC{zeta}. The mutant that substitutes the triple lysine residues (Lys101, Lys102, and Lys103) within the PLD2-PX domain with alanine abolishes interaction with the PKC{zeta}-kinase domain and activation of PKC{zeta}. Moreover, breast cancer cell viability is significantly affected by PLD2 silencing. Taken together, these results suggest that the PLD2-mediated PKC{zeta} activation is induced by its PX domain performing both direct activation of PKC{zeta} and assistance of activation loop phosphorylation. Furthermore, we find it is an important factor in the survival of breast cancer cells.


arrow
INTRODUCTION
 
Protein kinase C (PKC) has been implicated in many cellular key functions, such as cell proliferation, survival, and migration (2, 40, 44). The PKC family is subclassified into three groups—classical, novel, and atypical PKC—according to differences in the lipid activation profile (42). It has been established that the phosphorylation and activation of atypical PKC{zeta}, especially, is an important factor in the survival of cancer cells (21, 41). The phosphorylation of PKC{zeta} is one of the main mechanisms for regulating its activity. Recently, it has been reported that moderate activation of PKC{zeta} is mediated through activation loop phosphorylation by phosphoinositide-dependent kinase 1 (PDK-1), followed by a subsequent autophosphorylation (8, 38, 59). PKC{zeta} is also stimulated by the interaction of acidic lipids, including phosphatidic acid (PA) and phosphoinositides. Due to its structural uniqueness, PKC{zeta} is insensitive to second messengers, such as Ca2+ or diacylglycerol (DAG), known to be potent activators of the other families (46). Therefore, the activation of PKC{zeta} may be expected to rely on a peculiar mechanism, which is perhaps regulated by many cellular proteins. However, the exact protein-protein interactions intrinsic to the regulation mechanism of PKC{zeta} remain largely unclear.

Phospholipase D (PLD) exists as a membrane-bound protein and is widely distributed in a variety of cells. It hydrolyzes phosphatidylcholine to generate choline and PA as a response to diverse stimuli. In many cancer cells, the abnormal overexpression of PLD is associated with the promotion of mitogenesis, oncogenic transformation, and cell proliferation and the suppression of apoptosis (7, 10, 15). PLD activity is most commonly controlled by several regulators, such as PKC or small G protein (ARF, Rho, and RalA), in the presence of phosphatidylinositol 4,5-bisphosphate (PIP2) (5, 57, 58, 60). To date, two phosphatidylcholine-specific mammalian isoforms of PLD, PLD1 and PLD2, have been isolated and characterized (9, 22, 23). PLD1 is localized mainly in the Golgi apparatus and perinuclear vesicle regions in multiple cell types (13, 18, 58), whereas PLD2 is primarily located in the plasma membrane (12, 19). The differences in the localization of these PLDs can provide important clues suggesting their specific roles in various situations and cell types (12). PLD also has specific domains, such as the Phox (PX) and the pleckstrin homology (PH) domains. Although it is known that the PX and PH domains are mediated by protein-protein and protein-lipid interactions, the exact roles of these domains remain unclear and debatable. Recently, our group had reported that both the activation and phosphorylation of PLD1 are regulated by PKC{alpha} in phorbol myristate acetate-treated COS-7 cells (32) and that PLD2 activity is also stimulated by PKC{delta} in the neuronal cell (24). Other research had also reported the interrelationships between PLD and PKC isoforms in a variety of cell types (1, 3, 17, 25, 37, 45, 49, 51). So, the regulation mechanisms of PLD by PKC are relatively well known, but the details of PKC regulation mechanisms, regarding the PLD, are still an enigma.

In this study, we determined that PLD2 directly interacts with PKC{zeta}, regardless of lipase activity, and suggested that the PLD2-PX domain can play an important role as an activator of PKC{zeta} both through direct stimulation and modulating the activation loop phosphorylation of PKC{zeta}.


arrow
MATERIALS AND METHODS
 
Materials. An enhanced chemiluminescence kit (ECL system) and glutathione Sepharose 4B were purchased from Amersham Pharmacia Biotech (Buckinghamshire, U.K.). Myelin basic protein and protease inhibitor cocktail were from Sigma. Rabbit polyclonal anti-phospho Thr410 PKC{zeta} was kindly provided by Alex Toker (Harvard Medical School, Boston, Mass.) and purchased from Cell Signaling (Beverly, Mass.). Anti-actin antibody was from ICN Pharmaceuticals (Costa Mesa, Calif.). Polyclonal anti-phospho Thr421 and Ser424 p70 S6 kinase were purchased from Cell Signaling. Rabbit polyclonal PKC{zeta} was from Santa Cruz. Anti-PKC{alpha} and anti-PKC{delta} monoclonal antibodies were purchased from Transduction Laboratories (Lexington, Ky.). Human recombinant PKC{zeta}, myristoylated PKC{zeta} pseudosubstrate inhibitor, and ß-octylglucopyranoside were from Calbiochem (San Diego, Calif.). Human recombinant PKC{zeta} is phosphorylated at the threonine 410 residue and has a biologically active ability. Horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (IgG) and goat anti-mouse IgA, IgM, and IgG were from Kirkegaard & Perry Laboratories (Gaithersburg, Md.). [{gamma}-32P]ATP and [3H]myristic acid were from Perkin-Elmer Life Sciences (Boston, Mass.). Immobilized protein A was from Pierce and Dulbecco's modified Eagle's medium (DMEM) was from Life Technologies, Inc. (Gaithersburg, Md.). Polyclonal antibody for the recognition of PLD1 and PLD2 was generated as described previously (50).

Purification of recombinant PLD from Sf9 cells. Hexahistidine (His6)-tagged PLD was expressed in Sf9 cells and purified by chelating Sepharose affinity column chromatography, as described previously (31).

Cell culture. COS-7 cells were maintained in DMEM supplemented with 10% (vol/vol) bovine calf serum, at 37°C, in a humidified, CO2-controlled (5%) incubator. HEK (human embryonic kidney 293, MDA-MB 468, and Hs 578T cells were cultured under the same conditions, but with DMEM containing 10% (vol/vol) fetal bovine serum. As described previously, these cells were transfected using Lipofectamine (Life Technologies, Inc.) for the transient expression of the indicated plasmids and small interfering RNA (siRNA).

siRNA sequences. The siRNA of three independent 21-nucleotide sequences corresponding to human PLD2 sequences (nucleotides 703 to 723, AAGAGGUGGCUGGUGGUGAAG; nucleotides 1234 to 1254, AACAGUGGCUAUAGCAAGAGG; and nucleotides 1966 to 1986, AAGGUGGGCGAUGAGAUUGUG) and a human PLD1 sequence (nucleotides 1454 to 1474, AAGGUGGGACGACAAUGAGCA) were purchased from Dharmacon Research Inc. (Lafayette, Colo.). The PLD2 siRNA was used in the mixtures of three independent sequences for efficient silencing. Results of a BLAST search of all siRNA sequences revealed no significant homology to any other sequences in the database program.

Construction and preparation of GST fusion proteins. Glutathione S-transferase (GST) fusion proteins of PLD2 and PKC{zeta} were generated as previously described (30). To further construct the PX and PH domains and F1-1, -2, -3, -4, -5, -6, and -6M, the N-terminal region (amino acids 1 to 314) of human PLD2 was used as a template. These mutants of PLD2 were amplified by PCR using specific primers, digested with restriction enzymes EcoRI and XhoI, and ligated into pGEX-4T1 vector (Amersham Pharmacia Biotech). PKC{zeta} deletion mutants such as {zeta}F1, {zeta}F2, {zeta}F3, and {zeta}F4, and {zeta}F3-C1, -C2, -C3, -N1, -N2, -N3, -C2-1, and -C2-2 were also subcloned by the same methods as previously described. Eschericha coli BL21 cells were transformed with individual expression vectors encoding the GST fusion proteins and induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) at 25°C for 4 h. After harvesting the cells, GST fusion proteins of PLD2 and PKC{zeta} were purified, as previously described. These GST fusion proteins were purified by standard methods, by using glutathione Sepharose 4B (30). PLD2-K3A was PCR amplified using forward primer 5'-GG GGT ACC ATG ACG GCG ACC CCT GAG AGC-3', reverse primer 5'-TGG ACA ACC GCG GCG GCA TAC CGT CAT-3', forward primer 5'-ATG ACG GTA TGC CGC CGC GGT TGT CCA-3', and reverse primer 5'-GC TCT AGA CTA TGT CCA CAC TTC TAG GGG-3', digested with restriction enzymes KpnI and XbaI, and subcloned into mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, Calif.).

Generation of PLD2-WT and PLD2-K3A addback plasmids. One of three independent 21-nucleotide sequences (siRNA) corresponding to human PLD2 sequences is nucleotides 703 to 723: AAGAGGTGGCTGGTGGTGAAG. Three residues of human PLD2 cDNA are substituted to AAGAGATGGCTAGTAGTGAAG for addback mutants of PLD2-WT and -K3A. These mutations are silencing mutations. This gene is subcloned into mammalian expression vector pcDNA3.1 (Invitrogen) and digested with restriction enzymes KpnI and XbaI. These mutations are confirmed through nucleotide sequence analysis.

In vitro binding analysis. In vitro binding between all of the GST fusion proteins and PLD2 was performed in PLD assay buffer (50 mM HEPES-NaOH, pH 7.4, 3 mM EGTA, 3 mM CaCl2, 3 mM MgCl2, 80 mM KCl), containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail, at 4°C for 1.5 h. After a brief centrifugation, the precipitated complexes were washed three times in the same buffer before being loaded onto a polyacrylamide gel (30).

Coimmunoprecipitation. COS-7 cells were transfected in combination with the indicated plasmids. These cultured cells were harvested and lysed with PLD assay buffer containing 1% Triton X-100, 1% cholic acid, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail. After a brief sonication, the lysates were centrifuged at 100,000 x g for 30 min, and the supernatants (2 mg) were incubated with anti-PLD or anti-HA antibody-conjugated protein A-Sepharose for 4 h. After a brief centrifugation, the coimmunoprecipitated complexes were washed three times with the same buffer before being loaded onto a polyacrylamide gel.

Immunoblot analysis. Immunoblot analysis was performed as previously described (29). In brief, proteins were denatured by boiling at 95°C for 5 min in a Laemmli sample buffer. The denatured proteins were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. After blocking in TTBS buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20) containing 5% skimmed milk powder, the membranes were incubated with individual monoclonal or polyclonal antibodies and subsequently reincubated with either anti-mouse or anti-rabbit IgG, as required, coupled with horseradish peroxidase. Detection was performed using an enhanced chemiluminescence kit, according to the manufacturer's instructions. Immunoblot intensity was determined using a Fuji BAS-2000 image analyzer (Fuji, Tokyo, Japan).

Measurement of PLD activity in cells. PLD activity was assayed by measuring the formation of phosphatidylbutanol, the product of PLD-mediated transphosphatidylation, in the presence of 1-butanol, as previously described (36). In brief, the cells were labeled with [3H]myristic acid (10 µCi/ml) for 4 h and then washed twice with DMEM. The labeled cells were incubated with 0.4% 1-butanol for 5 min, harvested in 0.8 ml of methanol and 1 M NaCl (1:1), and mixed with 0.4 ml of chloroform. After vortexing, the tubes were centrifuged at 15,000 xg for 1 min, the organic phase was dried, and the lipids were separated by a Silica Gel 60 TLC plate, which was then developed with ethyl acetate-trimethylpentane-acetic acid (9/5/2, vol/vol/vol). The amount of [3H]phosphatidylbutanol formed was expressed as a percentage of the total 3H-lipid, to account for differences in cell labeling efficiency.

PKC{zeta} kinase assay. PKC{zeta} activity was measured by the aforementioned protocol, with minor modifications (6). In brief, PKC{zeta} was incubated with myelin basic protein (2 µg) at 37°C for 30 min in kinase buffer (50 mM Tris-HCl, pH 7.5, 100 µM Na3VO4, 100 µM Na4P2O7, 1 mM NaF, 100 µM phenylmethylsulfonyl fluoride, 4 µg of phosphatidylserine, 5 mM MgCl2, 10 µCi of [{gamma}-32P]ATP [3,000 Ci/mmol]), and an in vitro phosphorylation assay was performed. This reaction was terminated by the addition of 15 µl of 2x SDS sample buffer and boiling of the samples for 5 min. The sample was analyzed by SDS-PAGE and exposed to photographic film for autoradiography.

MTT assay in the breast cancer cells. The MTT assay was used as a crude measurement of cell viability (16). MTT is a yellow tetrazolium [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] which is converted by metabolically active cells into a colored water-insoluble formazan salt. The cells were seeded at 5 x 104/ml (100 µl/well) in 96-well plates, grown for 36 h, and depleted with serum for indicated times. MTT reagent (5 mg/ml in phosphate-buffered saline) was then added to the cells (10 µl/well), and the cultures were incubated at 37°C for 2 h. The reaction was stopped by the addition of 70 µl of isopropanol (including 0.2% HCl), and the tetrazolium crystals were dissolved at room temperature. The samples were measured by a Biotrak II Reader at a test wavelength of 450 nm.


arrow
RESULTS
 
PKC{zeta} interacts with PLD2. Our group had previously published results suggesting that the activation and phosphorylation of PLD1 are regulated by PKC{alpha} in phorbol myristate acetate-treated COS-7 cells (32) and that PLD2 activity is also controlled by PKC{delta} in PC12 cells (24). To delineate the specificity of interactions between PLD2 and PKC isozymes, we attempted to examine the physical associations between PLD2 and PKC isozymes in COS-7 cells. As shown in Fig. 1A, we observed that three PKC isozymes, PKC{alpha}, -{delta}, and -{zeta}, interact with PLD2 in a fashion similar to their respective interaction potencies. Furthermore, PLD2 activity is upregulated by PKC{alpha}- or PKC{delta}-overexpressed cells, but its activity is unaffected by PKC{zeta} in the same cells (Fig. 1B). We also obtained similar results in HEK 293 cells (data not shown). These results demonstrated that PLD2 associates with PKC{zeta}, resulting in the formation of a physical complex.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. The effects of representative PKC isoforms, including {alpha}, {delta}, and {zeta}, on PLD2 interaction and activity. COS-7 cells transiently transfected with indicated constructs were cultured for 36 h. A. The cells were lysed with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts were immunoprecipitated (I.P.) with anti-PLD antibody. After a brief centrifugation and washing, the precipitates were subjected to SDS-PAGE and immunoblotted with anti-PLD2 and anti-PKC{alpha}, -{delta}, and -{zeta} antibodies. B. The cells were labeled with [3H]myristic acid for 4 h. The measurement of [3H]phosphatidylbutanol formation was quantified as described in Materials and Methods. The data represent one of two independent experiments.

PLD2 specifically interacts with PKC{zeta} in a lipase activity-independent manner. In the next phase of the experiment, we further confirmed the specificity of PLD isozymes on PKC{zeta} binding. As shown in Fig. 2A, PLD2, rather than PLD1, strongly interacts with PKC{zeta}. To investigate the involvement of PLD lipase activity in the interactions between proteins, we transfected the indicated cDNA encoding plasmids in COS-7 cells. As shown in Fig. 2B, the PLD2 lipase inactive mutant (PLD2-K758R) as well as the PLD2 wild type (PLD2-WT) interact with PKC{zeta}, regardless of lipase activity. Furthermore, as shown in Fig. 2C, we also determined that endogenous PLD2 as a major isoform in COS-7 cells is coimmunoprecipitated with endogenous PKC{zeta}. These results demonstrated that the specific interaction between PLD2 and PKC{zeta} occurs in a lipase activity-independent manner.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2. The effects of PLD isozymes and lipase activity on PKC{zeta} interaction. A. COS-7 cells transiently transfected with indicated constructs were grown for 36 h. The cell lysates were solubilized with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts were immunoprecipitated (I.P.) with anti-PLD antibody or antihemagglutinin (HA) antibody. The complexes were briefly washed with the same buffer, subjected to SDS-PAGE, and immunoblot analyzed with anti-PLD antibody and anti-HA antibody. B. COS-7 cells were transfected with indicated plasmids, cultured, and harvested with lysis buffer. The extracts were immunoprecipitated with anti-PLD antibody, and the precipitates were subjected to immunoblot analysis with the indicated antibodies. C. COS-7 cells (2 mg) growing in media supplemented with 10% bovine calf serum were lysed with buffer containing 1% Triton X-100 and 1% cholic acid. Immunoprecipitation with the indicated antibodies was performed as described in Material and Methods and 40 µg of cell lysate was loaded for the total lysate blot.

The triple lysine residues within the PLD2-PX domain are required for interaction with PKC{zeta}. We also confirmed that the purified PLD2 directly interacts with PKC{zeta} in vitro (data not shown). To determine the PKC{zeta}-binding region in PLD2, we generated GST fusion fragments of PLD2. The schematic diagram and the individual GST fusion fragments of PLD2 used in this study are depicted in Fig. 3A. We performed in vitro binding analysis with GST fusion fragments of PLD2. The N-terminal region (amino acids 1 to 314) of PLD2 is required for binding to PKC{zeta} (Fig. 3B). In the N-terminal region, the PX domain is necessary for interaction with PKC{zeta} (Fig. 3C). We generated serial deletion mutants of the PX domain to do fine mapping of the binding site. It is critical for the amino acid 68 to 113 region derived from serial deletion mutants of the PLD2-PX domain and, especially, for the amino acid 88 to 112 region to interact with PKC{zeta}. This was verified through detailed binding analysis (Fig. 3D and E). It has been reported that the positive- or negative-charge residues of PKC{zeta} interacting proteins are important for the associations between both proteins (43, 53). On the basis of previous reports, we generated a mutant in the triple lysine residues (Lys101, Lys102, and Lys103) within the PLD2-PX domain and also confirmed that these residues are critical in the interaction with PKC{zeta} (Fig. 3E). Furthermore, we generated a PLD2 mutant, in which the triple lysine residues were substituted with alanine (PLD2-K101/102/103A; PLD2-K3A). Coimmunoprecipitation binding analysis showed that the PLD2-K3A mutant abolishes interaction with endogenous PKC{zeta} in COS-7 cells (see Fig. S1 in the supplemental material). Taken together, these results led us to the conclusion that the triple lysine residues within the PLD2-PX domain are responsible for association with PKC{zeta}.




View larger version (71K):
[in this window]
[in a new window]
 
FIG. 3. The requirement of the triple lysine residues within the PLD2-PX domain for PKC{zeta} interaction. A. Primary structure and individual domains of PLD2 used in this study. GST fusion proteins containing individual different domains of PLD2 were expressed in bacteria and purified by glutathione Sepharose beads. The individual fragments of PLD2 were followed by F1 (amino acids [a.a.] 1 to 314), F2 (a.a. 315 to 475), F3 (a.a. 476 to 612), F4 (a.a. 613 to 723), F5 (a.a. 724 to 825), F6 (a.a. 826 to 934), PX domain (a.a. 65 to 192), and PH domain (a.a. 201 to 310). F1-1 (a.a. 1 to 67), F1-2 (a.a. 1 to 113), F1-3 (a.a. 1 to 166), F1-4 (a.a. 66 to 112), F1-5 (a.a. 66 to 88), F1-6 (a.a. 88 to 112), and F1-6M (a.a. 88 to 112; K101/102/103A). B, C, D, and E. GST fusion proteins containing individual fragments of PLD2 were incubated with COS-7 cell lysates as a source of PKC{zeta} for 1.5 h. After brief centrifugation and washing, the precipitates were subjected to SDS-PAGE and analyzed with anti-PKC{zeta} antibody. The details of the experiment are described in Materials and Methods. The total amount of GST fusion proteins used in this experiment was shown by Ponceau S staining. I.B., immunoblot.

The PKC{zeta}-kinase domain is responsible for direct interaction with PLD2. PKC{zeta} is comprised of three distinctive domains, including Phox and Bem1p (PB1), C1, and the serine/threonine kinase domains. The GST fusion fragments of PKC{zeta} used in this study are shown in Fig. 4A. We prepared GST fusion fragments of PKC{zeta} and performed GST pull-down assays. As shown in Fig. 4B, the PKC{zeta}-kinase domain interacts exclusively with PLD2 purified from Sf9 cells and not with the PB1 and C1 domains. To specifically verify the potential interaction region, we generated serial deletion mutants of the PKC{zeta}-kinase domain and carried out GST pull-down assays. As shown in Fig. 4C and D, the amino acid 348 to 370 region within the PKC{zeta}-kinase domain is responsible for interaction with PLD2. Taken together, these results suggest that the amino acid 348 to 370 region within the PKC{zeta}-kinase domain is required for binding to PLD2.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 4. The interaction of PLD2 with the amino acid 348 to 370 region within the PKC{zeta}-kinase domain. A. Primary structure and individual domains of PKC{zeta} used in this study. GST fusion proteins containing distinctive domains of PKC{zeta} were expressed in E. coli and purified by glutathione Sepharose beads. The individual fragments of PKC{zeta} were followed by {zeta}F1 (amino acids [a.a.] 1 to 98), {zeta}F2 (a.a. 99 to 251), {zeta}F3 (a.a. 252 to 519), {zeta}F4 (a.a. 520 to 592), {zeta}F3-C1 (a.a. 252 to 460), {zeta}F3-C2 (a.a. 252 to 390), {zeta}F3-C3 (a.a. 252 to 320), {zeta}F3-N1 (a.a. 320 to 519), {zeta}F3-N2 (a.a. 390 to 519), {zeta}F3-N3 (a.a. 460 to 519), {zeta}F3-C2-1 (a.a. 252 to 370), and {zeta}F3-C2-2 (a.a 252 to 347). B, C, and D. GST fusion proteins containing PKC{zeta} fragments were incubated with recombinant PLD2 purified from Sf9 cells. After brief centrifugation and washing, glutathione bead complexes were subjected to SDS-PAGE and analyzed by immunoblotting (I.B.) with anti-PLD2 antibody. The total amount of GST fusion proteins used in this experiment was shown by Ponceau S staining.

The F1-6 fragment directly stimulates PKC{zeta} activity in vitro. Considering the findings that the triple lysine residues within the PLD2-PX domain directly interact with the PKC{zeta}-kinase domain (Fig. 3 and 4), we examined the kinase activity of PKC{zeta} to substantially characterize the meaning of the interactions between the two proteins. We performed in vitro phosphorylation assays with maltose binding protein (MBP) and phosphorylated PKC{zeta}. As shown in Fig. 5, the F1-4 fragment corresponding to the amino acid 66 to 112 region within the PLD2-PX domain exhibits an approximate 10-fold increase in autophosphorylation and displays an approximate eightfold increase in MBP phosphorylation and, interestingly, the F1-6 fragment corresponding to the amino acid 88 to 112 region induces about a sixfold increase in PKC{zeta} activity. However, the F1-5 and F1-6M fragments, which are deficient in binding ability, result in a little less than a twofold increase in PKC{zeta} activity. The obvious conclusion is that PKC{zeta} activity is more efficiently stimulated by F1-6 than by F1-6M. These results suggest that the amino acid 88 to 112 region within the PLD2-PX domain has the ability to directly stimulate PKC{zeta} activity.



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 5. The effects of the specific binding motif within the PLD2-PX domain on PKC{zeta} activity. The activation loop-phosphorylated PKC{zeta} was incubated with specific fragments within the PLD2-PX domain, such as F1-4, F1-5, F1-6, and F1-6M in kinase buffer (50 mM Tris-HCl, pH 7.5, 100 µM Na3VO4, 100 µM Na4P2O7, 1 mM NaF, 100 µM phenylmethylsulfonyl fluoride, 4 µg of phosphatidylserine, 5 mM MgCl2, 10 µCi of [{gamma}-32P]ATP [3,000 Ci/mmol]) for 30 min, and an in vitro phosphorylation assay was performed. This reaction was terminated by the addition of SDS sample buffer, and the precipitates were subjected to SDS-PAGE and exposed to photographic film for autoradiography. The data represent one of three independent experiments. The detailed procedures are described in Materials and Methods.

PLD2 protein significantly stimulates PKC{zeta} activity in cells. Because the PLD2-PX domain can directly stimulate PKC{zeta} activity in vitro (Fig. 5), we attempted to verify whether the PLD2-mediated PKC{zeta} activation induces the propagation of downstream signaling flow in cells. It has been reported that PKC{zeta} induces p70 S6 kinase activation in murine prostate cancer cells such as TRAMP (21). Actually we observed that activation of p70 S6 kinase is potentiated in PKC{zeta}-WT adenovirus-infected COS-7 cells and decreased in PKC{zeta}-DN-expressing cells under similar conditions without changing the PLD2 expression (see Fig. S2 in the supplemental material). As shown in Fig. 6A, the activation of p70 S6 kinase is enhanced in PLD2-WT- and PLD2-K758R-overexpressed COS-7 cells, but PLD2-K3A had no effect on p70 S6 kinase activation in comparison with vector-transfected cells. Furthermore, when endogenous PLD2 is depleted by siRNA, the activation of p70 S6 kinase is lessened in comparison with that of control siRNA for luciferase (Fig. 6B). Interestingly, as shown in Fig. 6A, we observed that the activation loop phosphorylation (pT410) of endogenous PKC{zeta} was significantly enhanced in PLD2-WT and -K758R cells but not PLD2-K3A-transfected cells. When endogenous PLD2 expression was silenced with PLD2 siRNA, the activation loop phosphorylation of PKC{zeta} decreased dramatically (Fig. 6B). Taken together, these results suggest that the activation and phosphorylation of PKC{zeta} might be regulated by PLD2 protein, in a correlative fashion with p70 S6 kinase activation.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 6. The effects of PLD protein on activation of PKC{zeta} and p70S6K. A and B. COS-7 cells were transfected with the indicated plasmids encoding various PLD2 constructs or siRNA for control (luciferase) and PLD2, cultured for 36 h, starved in serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100 for 30 min on ice. The cell lysates, removed from the crude nuclear fraction using centrifugation, were analyzed by immunoblotting with indicated antibodies. The n-fold increase is expressed as the percentage of the indicated antibodies' intensity above the basal level. Results are expressed as average values ± standard errors of three independent experiments. *, P of <0.05 compared with vector (Vec) or control (Con) siRNA-transfected cells.

The ternary complex including PDK-1, PLD2, and PKC{zeta} is formed in COS-7 cells. Because the activity of PDK-1 phosphorylating Akt has been unaffected by the extent of PLD2 expression, indicating that PLD2 may not directly affect PDK-1 activity (see Fig. S3 in the supplemental material), we examined whether PLD2 exists in the physical complex of PDK-1 and PKC{zeta}, hence increasing the activation loop phosphorylation of PKC{zeta}. As shown in Fig. 7A, PLD2-K758R as well as PLD2-WT existed in the ternary complex with PDK-1 and PKC{zeta}. However, PLD2-K3A did not exist in this complex. PLD2-K3A bound with PDK-1 but not PKC{zeta}, and PLD2-K3A had no effect on the complex arising from the interaction of PKC{zeta} with PDK-1. Since the PLD2-PX domain was involved in direct interaction with PKC{zeta} (Fig. 3C), we examined whether it was sufficient for ternary complex formation and enhanced activation loop phosphorylation of PKC{zeta}. As shown in the Fig. 7B, surprisingly, the PLD2-PX domain was found to exist in a physical complex with PKC{zeta} and PDK-1 and to enhance activation loop phosphorylation of PKC{zeta}. But the PLD2-PX-K3A domain did not form the physical ternary complex with PKC{zeta} and PDK-1 and had no effect on binding of PKC{zeta} to PDK-1. Taken together, these results suggested that the PLD2-PX domain also plays the role of a critical cofactor, helping the activation loop phosphorylation of PKC{zeta} in a ternary complex with PKC{zeta} and PDK-1.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 7. The formation of ternary complex including PDK-1, PLD2, and PKC{zeta}. A. COS-7 cells were transiently transfected with various PLD2 constructs, grown for 48 h, depleted with serum for 12 h, and then lysed with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts, immunoprecipitated (I.P.) with anti-PLD antibody or antihemagglutinin (HA) antibody, were analyzed by immunoblotting with indicated antibodies. Anti-actin antibody was used with normalized control. B. COS-7 cells were transfected with the indicated plasmids encoding vector (Vec), Flag-tagged PLD2-PX-WT, and Flag-tagged PLD2-PX-K3A, cultured for 36 h, depleted with serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100 for 30 min on ice. The cell lysates, removed from the crude nuclear fraction using centrifugation, were immunoprecipitated with anti-Flag antibody. The precipitated complex was analyzed with the indicated antibodies. The total lysates were also analyzed by immunoblotting with the indicated antibodies. The n-fold increase is expressed as a percentage of the indicated antibodies' intensity above the basal level. The experiment represents one of three independent experiments. *, P of <0.05 compared with vector-transfected cells.

Cell viability is affected by PLD2 silencing in breast cancer cells. Recent reports have demonstrated that the regulation of PKC{zeta} activity is relevant to cell survival and apoptosis in breast cancer cells (41) and also that PLD2 is highly overexpressed in a wide variety of human cancer cells (48, 60, 61, 63). Therefore, we examined whether the activation of PKC{zeta} is controlled by PLD2 expression. In Fig. 8A and B, we demonstrated that activation loop phosphorylation and activity of PKC{zeta} decreased dramatically under PLD2 silencing conditions in breast cancer cells containing Hs 578T and MDA-MB 468 cells. The activation of p70 S6 kinase also significantly decreased under the same circumstances with a concomitant correlation with the attenuation of PKC{zeta} activation loop phosphorylation. The PDK-1 activity was unaffected by PLD silencing in breast cancer cells (see Fig. S4 in the supplemental material). As shown in Fig. 8C and D, cell viability is attenuated in PLD2-silenced breast cancer cells with a correlation to cells treated with PKC{zeta} inhibitors in a time-dependent manner. Control and PLD1-silenced cells exhibited significantly less effects on cell viability than did PLD2-silenced cells. Furthermore, as shown in Fig. 8E and F, it was also determined that the cell viability was recovered by PLD2-WT (addback plasmids) and PLD2-WT-PX but not by PLD2-K3A (addback plasmids) and PLD2-K3A-PX. These results suggest that PLD2-mediated PKC{zeta} activation is important for the survival of breast cancer cells.




View larger version (94K):
[in this window]
[in a new window]
 
FIG. 8. The effects of PLD silencing on cell viability in breast cancer cells. A and B. Hs 578T cells and MDA-MB 468 cells were transfected with siRNA for control (Con), PLD1, and PLD2. The details of the procedures are described in Materials and Methods. In brief, the cells were cultured for 48 h, depleted with serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100, for 30 min on ice. The cell lysates, removed from the crude nuclear fraction by using centrifugation, were analyzed by immunoblotting with the indicated antibodies. The n-fold increase is expressed as the percentage of the indicated antibodies' intensity above the basal level. The data represent one of three independent experiments. *, P of <0.05 compared with control siRNA-transfected cells. C and D. Hs 578T cells and MDA-MB 468 cells were transfected with siRNA for control, PLD2, and PLD1 and treated with the myristoylated PKC{zeta} pseudosubstrate inhibitor (50 µM). After serum depletion for the indicated time points, the cells were washed, lysed with isopropanol including 0.2% HCl, and measured at a wavelength of 450 nm. *, P of <0.05 compared with control siRNA-transfected cells; {dagger} or {ddagger}, P of <0.05 versus PLD2 or PLD1 siRNA-transfected cells; ¦, P of <0.05 versus PKC{zeta} inhibitor-treated cells. E and F. Hs 578T (panel E) and MDA-MB 468 (panel F) cells were transfected with the indicated siRNA and plasmids. The siRNA used in the experiments was nucleotides 703 to 723, AAGAGGTGGCTGGTGGTGAAG, for addback of PLD2-WT or -K3A (addback plasmids). After serum depletion for 48 h, the cells were washed, lysed with isopropanol including 0.2% HCl, and measured at a wavelength of 450 nm. *, P of <0.05 compared with control siRNA-transfected cells; {dagger}, P of <0.05 versus PLD2 siRNA-transfected cells; {ddagger}, P of <0.05 versus PLD2 siRNA + PLD2-WT addback; ¦, P of <0.05 versus PLD2 siRNA + PLD2-K3A addback; ¶, P of <0.05 versus PLD2 siRNA + PLD2-WT-PX; §, P of <0.05 versus PLD2 siRNA + PLD2-K3A-PX.


arrow
DISCUSSION
 
PLD has a large role in the activity of lipid hydrolysis, and until now there have been many reports that its activity is elaborately controlled by many cellular regulators in diverse cell systems (20, 22, 26, 31, 33, 34, 35, 37, 50). In contrast, little is known about the details of mechanisms in the regulation of other proteins by PLD through direct binding. In this study, we suggest that the PLD2-PX domain directly binds to PKC{zeta}, simultaneously performing dual roles—one as a direct activator for PKC{zeta}, and the other as a cofactor increasing the activation loop phosphorylation of PKC{zeta} (Fig. 9). Furthermore, PLD2-mediated PKC{zeta} activation is also implicated in cancer cell viability.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 9. Proposed model of PKC{zeta} activation by PLD2. The PLD2-PX domain directly interacts with the PKC{zeta}-kinase domain. Ultimately, PLD2 is a ternary complex of PKC{zeta} with PDK-1 and its PX domain assists the activation loop phosphorylation of PKC{zeta} by PDK-1. The activation loop-phosphorylated PKC{zeta} is fully stimulated through direct interaction of PLD2-PX domain. The completely activated PKC{zeta} (black) upregulates downstream signals, such as p70 S6 kinase.

The conventional PKC activation mechanisms are well understood. Mechanisms have been established for sequential phosphorylation, the recruiting of proper localization, and the exchanging of binding proteins (47). It is generally understood that synthesized PKC is translocated into the membrane and phosphorylated by PDK-1 and that phosphorylated PKC is regulated by Ca2+ or DAG generated by stimuli, culminating in the release of specific domains from the substrate binding cavity (61). In contrast, since PKC{zeta} is insensitive to second messengers such as Ca2+ and DAG in its PB1 and C1 domains, it has been theorized that its activity is primarily regulated by protein-protein interaction. However, the activation mechanisms and cellular regulators of PKC{zeta} remain unclear. Here, our data demonstrated that, regardless of lipase activity, PLD2 enhances the activation of PKC{zeta} by increasing the activation loop phosphorylation of PKC{zeta} under basal conditions. Also, the activation loop-phosphorylated PKC{zeta} is stimulated by direct binding of PLD2 (Fig. 5). Moreover, PLD2-mediated PKC{zeta} activation induces the phosphorylation of p70 S6 kinase, resulting in downstream signal flow (Fig. 6). The regulation of PKC{zeta} activity by PLD2 results from the signaling complex composed of PDK-1 and PKC{zeta}, not from the upregulation of PDK-1 activity as upstream kinase (Fig. 7A; also see Fig. S3 in the supplemental material). Furthermore, PLD2-WT, like PLD2-K3A, has no effect on binding with PDK-1 or on the binding of PKC{zeta} with PDK-1. According to previous reports, when PKC{zeta} is translocated into the membrane, bound to PDK-1, and then phosphorylated, PLD2 as a membrane-bound protein can assist the activation loop phosphorylation of PKC{zeta} (Fig. 6). In this study, we suggest PLD2 as a novel protein cofactor for full and complete activation of PKC{zeta}.

PKC{zeta} phosphorylates p70 S6 kinase. Furthermore, it is known that p70 S6 kinase is activated through multiple-site phosphorylation. Another kinase for p70 S6 kinase is known to be mTOR, which is rapamycin sensitive and a target of PA (4, 14). mTOR phosphorylates p70 S6 kinase at the Thr389 residue in a PA-dependent manner, but PKC{zeta} phosphorylates p70 S6 kinase at the Thr421 and Ser424 residues regardless of PA because, as shown in Fig. 6A, the PLD2-K758R lipase-inactive mutant abolishes generation of PA and also PLD2-WT increases phosphorylation of p70 S6 kinase. So, PLD2 interaction-dependent PKC{zeta} activation could stimulate p70 S6 kinase. Accordingly, p70 S6 kinase activation is differently regulated by two kinases such as PKC{zeta} and mTOR. Moreover, PLD2-mediated PKC{zeta}, rather than mTOR activated by PA, phosphorylates p70 S6 kinase at the Thr421 and Ser424 residues.

PKC{zeta} activity is regulated by dual mechanisms—the direct activation of PLD2 in vitro and assistance of the activation loop phosphorylation of PKC{zeta} (Fig. 5 and 6). PLD2 stimulates PKC{zeta} activity through direct interaction with the PKC{zeta}-kinase domain (Fig. 4). The distinctive domains of PKC{zeta}, including PB1, C1, and the kinase domain, are known to mediate protein-protein or protein-lipid interactions. It is known that the specific domains of PKC{zeta} are important for interacting with several binding proteins such as Par6, Par3/ASIP, Cdc42, and mammalian Lgl, involved in cell polarity (28, 39, 52), and p62/ZIP, MEK5, and p70 S6 kinase, implicated in the signal transduction pathway (11, 52, 54, 56). Among the interacting proteins, Par3 exhibits the greatest affinity for the kinase domain, but whether its interaction regulates kinase activity remains unclear (39). In this study, we determine that PLD2 interacts with the amino acid 348 to 370 region within the PKC{zeta}-kinase domain, subsequently regulating PKC{zeta} activity. A recent report has predicted this region, by multiple sequence alignment under secondary structure modeling, to be located in the {alpha}-E helix within the C-lobe side of the kinase domain (64). In the case of cyclin-dependent kinase (CDK), the activation loop has been found to be structurally coupled with the {alpha}-C helix, stabilizing its inactive conformation. The direct interaction of cyclin with the {alpha}-C helix of CDK induces an alteration in the orientation of the {alpha}-C helix and eventually results in activation loop phosphorylation by CDK-activating kinase (27, 55). We suggested that PLD2, interacting with the amino acid 348 to 370 region corresponding to the {alpha}-E helix, can facilitate activation loop phosphorylation, due to a conformational change of PKC{zeta} by interactions with the neighboring phosphorylation site. This region can also hold the possible potential motif providing the direct binding site for the PLD2-PX domain, necessary for the full activation of PKC{zeta}. Surprisingly, the PLD2-PX domain is only sufficient for the signaling complex with PKC{zeta} and PDK-1 and enhances the activation loop phosphorylation of PKC{zeta} (Fig. 7B). The PLD2-PX domain also contains an activation motif of PKC{zeta}, indicating the stimulation of activation loop-phosphorylated PKC{zeta} activity through direct interaction. The autophosphorylation of PKC{zeta} was also enhanced by the PLD2-PX domain and then activated PKC{zeta} increased the phosphorylation of MBP (Fig. 5). Therefore, we suggest that PKC{zeta} activation by PLD2 binding may be a new mechanism for kinase activation. Furthermore, as shown in Fig. S6 in the supplemental material, it is suggested that PKC{zeta} phosphorylation is attenuated under the basal condition in PLD2-silenced cells, and the signal-dependent PKC{zeta} phosphorylation also is decreased in PLD2-silenced cells. In addition, the signal-dependent PKC{zeta} phosphorylation occurs as the basal PKC{zeta} phosphorylation is reduced by PLD2 silencing. Therefore, it was found that PLD2 is essential for basal PKC{zeta} activation. The issue of PLD2-PKC{zeta} signaling may require further characterization.

PLD2 has two distinctive domains including the PX and PH domains. Their exact roles have not yet been well defined. Recently, our group suggested that one of the roles of the PLD2-PX domain is the exertion of an anchoring function, supporting the thesis that PLD2 functions as an adaptor in the redistribution of PLC-{gamma}1 to the membrane region in epidermal growth factor signaling (26). We also theorized that it may play a secondary role, in the provision of the docking sites regulating PLD2 activity with its interacting protein, such as Munc18-1 (33). Here, we suggest that another of its functions is to serve as a novel direct activator for PKC{zeta}, since the PLD2-PX domain can enhance stimulation and activation loop phosphorylation of PKC{zeta} (Fig. 5 and 7B). The triple lysine residues within the PLD2-PX domain are especially responsible for PKC{zeta} activation and interaction. However, the PLD2-K3A mutant abolishes interactions with PKC{zeta} and inhibits its mediated PKC{zeta} activation (Fig. 3 and 5). Although it cannot be affirmed that these mutations have no effects on the conformation of the PLD2-PX domain, it does not change the expression level, subcellular localization, or catalytic properties of PLD2 in vitro (data not shown). These results suggest that the effect of these mutations on PLD2 structure, if any, is neither dramatic nor significant in PLD2 function, except for its interaction with PKC{zeta}. Taken together, we suggest that the PLD2-PX domain, as one of a collection of multiple binding modules, executes a myriad of functional roles in various cellular contexts.

PLD2 is known to be highly overexpressed in a wide variety of human cancer cells (48, 62, 63, 65), but it is unclear what the role of PLD might be in cancer cells. Furthermore, there are several reports in which the regulation of PKC{zeta}, and p70 S6 kinase activity, is implicated in cell survival and apoptosis in prostate and breast cancer cells (21, 41). As shown in Fig. 8, we determined that the PLD2-mediated PKC{zeta} activation is important for cell viability after the induction of cell death as a serum-depleted condition. Furthermore, we demonstrated that the effects of PLD2 silencing on the viability of breast cancer cells are nonadditive in PKC{zeta} inhibitor-treated cells for supporting functional significance (see Fig. S5A and B in the supplemental material). We performed PKC{zeta} rescue experiments to reveal the linking between PLD2 and PKC{zeta} after silencing with PLD2 siRNA (see Fig. S5C and D in the supplemental material). As the amounts of PKC{zeta} were increased, the cell viability was not significantly rescued under the PLD2 silencing condition. The reason that cell survival was not completely recovered is possibly the result of the silencing of PLD2, which acts as either a cofactor or activator for PKC{zeta}. Therefore, PKC{zeta} activation is dependent on PLD2 signaling. Therefore, we suggested that PLD2-mediated PKC{zeta} activation is essential for the survival of breast cancer cells. Considering whether these tumor cells, if any, exist in either serum-exhausted or nutrient-deficient conditions in the angiogenesis process, we suggested that the PLD2-mediated PKC{zeta} activation may be important in the survival of breast cancer cells. Accordingly, the issue of physical interaction may be applied to unravel some problems in cancer cells and necessary to further characterize the uncertain details of the signal mechanisms.


arrow
ACKNOWLEDGMENTS
 
We gratefully acknowledge Alex Toker for kindly providing anti-pPKC{zeta} antibody (pT410) to our laboratory.

This work was supported by the programs of 21st Frontier Proteomics and the National Research Laboratory of the Ministry of Science and Technology, Republic of Korea.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Molecular and Life Sciences, Pohang University of Science and Technology, San 31, Hyojadong, Pohang 790-784, Republic of Korea. Phone: 82-54-279-2292. Fax: 82-54-279-0645. E-mail: sungho{at}postech.ac.kr. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Banno, Y., and Y. Nozawa. 2003. Hydrogen peroxide-induced phospholipase D activation and its PKC dependence are modulated by pH changes in PC12 cells. Biochem. Biophys. Res. Commun. 312:1087-1093.[CrossRef][Medline]
  2. 2
  3. Berra, E., M. T. Diaz-Meco, I. Dominguez, M. M. Municio, L. Sanz, J. Lozano, R. S. Hapkin, and J. Moscat. 1993. Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell 74:555-563.[CrossRef][Medline]
  4. 3
  5. Billah, M. M., J. K. Pai, T. J. Mullmann, R. W. Egan, and M. I. Siegel. 1989. Regulation of phospholipase D in HL-60 granulocytes. J. Biol. Chem. 264:9069-9076.[Abstract/Free Full Text]
  6. 4
  7. Burnett, P. E., R. K. Barrow, N. A. Cohen, S. H. Snyder, and D. M. Sabatini. 1998. RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc. Natl. Acad. Sci. USA 95:1432-1437.[Abstract/Free Full Text]
  8. 5
  9. Brown, H. A., S. Gutowski, R. A. Kahn, and P. C. Sternweis. 1995. Partial purification and characterization of Arf-sensitive phospholipase D from porcine brain. J. Biol. Chem. 270:14935-14943.[Abstract/Free Full Text]
  10. 6
  11. Chen, H. C., G. Bandyopadhyay, M. P. Sajan, Y. Kanoh, M. Standaert, R. V. Farese, Jr., and R. V. Farese. 2002. Activation of the ERK pathway and atypical protein kinase C isoforms in exercise- and aminoimidazole-4-carboxamide-1-beta-D-riboside (AICAR)-stimulated glucose transport. J. Biol. Chem. 277:23554-23562.[Abstract/Free Full Text]
  12. 7
  13. Chen, Y., Y. Zheng, and D. A. Foster. 2003. Phospholipase D confers rapamycin resistance in human breast cancer cells. Oncogene 22:3937-3942.[CrossRef][Medline]
  14. 8
  15. Chou, M. M., W. Hou, J. Johnson, L. K. Graham, M. H. Lee, C. S. Chen, A. C. Newton, B. S. Schaffhausen, and A. Toker. 1998. Regulation of protein kinase C zeta by PI 3-kinase and PDK-1. Curr. Biol. 8:1069-1077.[CrossRef][Medline]
  16. 9
  17. Colley, W. C., T. C. Sung, R. Roll, J. Jenco, S. M. Hammond, Y. Altshuller, D. Bar-Sagi, A. J. Morris, and M. A. Frohman. 1997. Phospholipase D2, a distinct phospholipase D isoform with novel regulatory properties that provokes cytoskeletal reorganization. Curr. Biol. 7:191-201.[CrossRef][Medline]
  18. 10
  19. Daniel, L. W., V. A. Sciorra, and S. Ghosh. 1999. Phospholipase D, tumor promoters, proliferation and prostaglandins. Biochim. Biophys. Acta 1439:265-276.[Medline]
  20. 11
  21. Diaz-Meco, M. T., and J. Moscat. 2001. MEK5, a new target of the atypical protein kinase C isoforms in mitogenic signaling. Mol. Cell. Biol. 21:1218-1227.[Abstract/Free Full Text]
  22. 12
  23. Du, G., P. Huang, B. T. Liang, and M. A. Frohman. 2004. Phospholipase D2 localizes to the plasma membrane and regulates angiotensin II receptor endocytosis. Mol. Biol. Cell 15:1024-1030.[Abstract/Free Full Text]
  24. 13
  25. Du, G., Y. M. Altshuller, N. Vitale, P. Huang, S. Chasserot-Golaz, A. J. Morris, M. F. Bader, and M. A. Frohman. 2003. Regulation of phospholipase D1 subcellular cycling through coordination of multiple membrane association motifs. J. Cell Biol. 162:305-315.[Abstract/Free Full Text]
  26. 14
  27. Fang, Y., M. Vilella-Bach, R. Bachmann, A. Flanigan, and J. Chen. 2001. Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science 294:1942-1945.[Abstract/Free Full Text]
  28. 15
  29. Foster, D. A., and L. Xu. 2003. Phospholipase d in cell proliferation and cancer. Mol. Cancer Res. 1:789-800.[Abstract/Free Full Text]
  30. 16
  31. Fowler, C. A., C. M. Perks, P. V. Newcomb, P. B. Savage, J. R. Farndon, and J. M. Holly. 2000. Insulin-like growth factor binding protein-3 (IGFBP-3) potentiates paclitaxel-induced apoptosis in human breast cancer cells. Int. J. Cancer 88:448-453.[CrossRef][Medline]
  32. 17
  33. Freeman, E. J., G. M. Chisolm, and E. A. Tallant. 1995. Role of calcium and protein kinase C in the activation of phospholipase D by angiotensin II in vascular smooth muscle cells. Arch. Biochem. Biophys. 319:84-92.[CrossRef][Medline]
  34. 18
  35. Freyberg, Z., D. Sweeney, A. Siddhanta, S. Bourgoin, M. A. Frohman, and D. Shields. 2001. Intracellular localization of phospholipase D1 in mammalian cells. Mol. Biol. Cell 12:943-955.[Abstract/Free Full Text]
  36. 19
  37. Freyberg, Z., S. Bourgoin, and D. Shields. 2002. Phospholipase D2 is localized to the rims of the Golgi apparatus in mammalian cells. Mol. Biol. Cell 13:3930-3942.[Abstract/Free Full Text]
  38. 20
  39. Frohman, M. A., T. C. Sung, and A. J. Morris. 1999. Mammalian phospholipase D structure and regulation. Biochim. Biophys. Acta 1439:175-186.[Medline]
  40. 21
  41. Ghosh, P. M., R. Bedolla, M. Mikhailova, and J. I. Kreisberg. 2002. RhoA-dependent murine prostate cancer cell proliferation and apoptosis: role of protein kinase Czeta. Cancer Res. 62:2630-2636.[Abstract/Free Full Text]
  42. 22
  43. Hammond, S. M., J. M. Jenco, S. Nakashima, K. Cadwallader, Q. Gu, S. Cook, Y. Nozawa, G. D. Prestwich, M. A. Frohman, and A. J. Morris. 1997. Characterization of two alternately spliced forms of phospholipase D1. J. Biol. Chem. 272:3860-3868.[Abstract/Free Full Text]
  44. 23
  45. Hammond, S. M., Y. M. Altshuller, T. C. Sung, S. A. Rudge, K. Rose, J. Engebrecht, A. J. Morris, and M. A. Frohman. 1995. Human ADP-ribosylation factor-activated phosphatidylcholine-specific phospholipase D defines a new and highly conserved gene family. J. Biol. Chem. 270:29640-29643.[Abstract/Free Full Text]
  46. 24
  47. Han, J. M., J. H. Kim, B. D. Lee, S. D. Lee, Y. Kim, Y. W. Jung, S. Lee, W. Cho, M. Ohba, T. Kuroki, P. G. Suh, and S. H. Ryu. 2002. Phosphorylation-dependent regulation of phospholipase D2 by protein kinase C delta in rat Pheochromocytoma PC12 cells. J. Biol. Chem. 277:8290-8297.[Abstract/Free Full Text]
  48. 25
  49. Hodgkin, M. N., J. M. Clark, S. Rose, K. Saqib, and M. J. Wakelam. 1999. Characterization of the regulation of phospholipase D activity in the detergent-insoluble fraction of HL60 cells by protein kinase C and small G-proteins. Biochem. J. 339:87-93.
  50. 26
  51. Jang, I. H., S. Lee, J. B. Park, J. H. Kim, C. S. Lee, E. M. Hur, I. S. Kim, K. T. Kim, H. Yagisawa, P. G. Suh, and S. H. Ryu. 2003. The direct interaction of phospholipase C-gamma 1 with phospholipase D2 is important for epidermal growth factor signaling. J. Biol. Chem. 278:18184-18190.[Abstract/Free Full Text]
  52. 27
  53. Jeffrey, P. D., A. A. Russo, K. Polyak, E. Gibbs, J. Hurwitz, J. Massague, and N. P. Pavletich. 1995. Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex. Nature 376:313-320.[CrossRef][Medline]
  54. 28
  55. Joberty, G., C. Petersen, L. Gao, and I. G. Macara. 2000. The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2:531-539.[CrossRef][Medline]
  56. 29
  57. Kim, J. H., S. D. Lee, J. M. Han, T. G. Lee, Y. Kim, J. B. Park, J. D. Lambeth, P. G. Suh, and S. H. Ryu. 1998. Activation of phospholipase D1 by direct interaction with ADP-ribosylation factor 1 and RalA. FEBS Lett. 430:231-235.[CrossRef][Medline]
  58. 30
  59. Kim, J. H., S. Lee, J. H. Kim, T. G. Lee, M. Hirata, P. G. Suh, and S. H. Ryu. 2002. Phospholipase D2 directly interacts with aldolase via its PH domain. Biochemistry 41:3414-3421.[CrossRef][Medline]
  60. 31
  61. Kim, J. H., Y. Kim, S. D. Lee, I. Lopez, R. S. Arnold, J. D. Lambeth, P. S. Suh, and S. H. Ryu. 1999. Selective activation of phospholipase D2 by unsaturated fatty acid. FEBS Lett. 454:42-46.[CrossRef][Medline]
  62. 32
  63. Kim, Y., J. M. Han, B. R. Han, K. A. Lee, J. H. Kim, B. D. Lee, I. H. Jang, P. G. Suh, and S. H. Ryu. 2000. Phospholipase D1 is phosphorylated and activated by protein kinase C in caveolin-enriched microdomains within the plasma membrane. J. Biol. Chem. 275:13621-13627.[Abstract/Free Full Text]
  64. 33
  65. Lee, H. Y., J. B. Park, I. H. Jang, Y. C. Chae, J. H. Kim, I. S. Kim, P. G. Suh, and S. H. Ryu. 2004. Munc-18-1 inhibits phospholipase D activity by direct interaction in an epidermal growth factor-reversible manner. J. Biol. Chem. 279:16339-16348.[Abstract/Free Full Text]
  66. 34
  67. Lee, S., J. B. Park, J. H. Kim, Y. Kim, J. H. Kim, K. J. Shin, J. S. Lee, S. H. Ha, P. G. Suh, and S. H. Ryu. 2001. Actin directly interacts with phospholipase D, inhibiting its activity. J. Biol. Chem. 276:28252-28260.[Abstract/Free Full Text]
  68. 35
  69. Lee, S., J. H. Kim, C. S. Lee, J. H. Kim, Y. Kim, K. Heo, Y. Ihara, Y. Goshima, P. G. Suh, and S. H. Ryu. 2002. Collapsin response mediator protein-2 inhibits neuronal phospholipase D(2) activity by direct interaction. J. Biol. Chem. 277:6542-6549.[Abstract/Free Full Text]
  70. 36
  71. Lee, S. D., B. D. Lee, J. M. Han, J. H. Kim, Y. Kim, P. G. Suh, and S. H. Ryu. 2000. Phospholipase D2 activity suppresses hydrogen peroxide-induced apoptosis in PC12 cells. J. Neurochem. 75:1053-1059.[CrossRef][Medline]
  72. 37
  73. Lee, S. D., B. D. Lee, Y. Kim, P. G. Suh, and S. H. Ryu. 2000. Bradykinin activates phospholipase D2 via protein kinase cdelta in PC12 cells. Neurosci. Lett. 294:130-132.[CrossRef][Medline]
  74. 38
  75. Le Good, J. A., W. H. Ziegler, D. B. Parekh, D. R. Alessi, P. Cohen, and P. J. Parker. 1998. Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281:2042-2045.[Abstract/Free Full Text]
  76. 39
  77. Lin, D., A. S. Edwards, J. P. Fawcett, G. Mbamalu, J. D. Scott, and T. Pawson. 2000. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signaling and cell polarity. Nat. Cell Biol. 2:540-547.[CrossRef][Medline]
  78. 40
  79. Lu, Y., L. Jamieson, A. R. Brasier, and A. P. Fields. 2001. NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival. Oncogene 20:4777-4792.[CrossRef][Medline]
  80. 41
  81. Mao, M., X. Fang, Y. Lu, R. Lapushin, R. C. Bast, Jr., and G. B. Mills. 2000. Inhibition of growth-factor-induced phosphorylation and activation of protein kinase B/Akt by atypical protein kinase C in breast cancer cells. Biochem. J. 352:475-482.
  82. 42
  83. Mellor, H., and P. J. Parker. 1998. The extended protein kinase C superfamily. Biochem. J. 332:281-292.
  84. 43
  85. Michael, I., Wilson, D. J. Gill, O. Perisic, M. T. Quinn, and R. L. Williams. 2003. PB1 domain-mediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Mol. Cell 12:39-50.[CrossRef][Medline]
  86. 44
  87. Murray, N. R., and A. P. Fields. 1997. Atypical protein kinase C iota protects human leukemia cells against drug-induced apoptosis. J. Biol. Chem. 272:27521-27524.[Abstract/Free Full Text]
  88. 45
  89. Mwanjewe, J., M. Spitaler, M. Ebner, M. Windegger, M. Geiger, S. Kampfer, J. Hofmann, F. Uberall, and H. H. Grunicke. 2001. Regulation of phospholipase D isoenzymes by transforming Ras and atypical protein kinase C-iota. Biochem. J. 359:211-217.[CrossRef][Medline]
  90. 46
  91. Newton, A. C. 2001. Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem. Rev. 101:2353-2364.[CrossRef][Medline]
  92. 47
  93. Newton, A. C. 2003. Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm. Biochem. J. 370:361-371.[CrossRef][Medline]
  94. 48
  95. Noh, D. Y., S. J. Ahn, R. A. Lee, I. A. Park, J. H. Kim, P. G. Suh, S. H. Ryu, K. H. Lee, and J. S. Han. 2000. Overexpression of phospholipase D1 in human breast cancer tissues. Cancer Lett. 161:207-214.[CrossRef][Medline]
  96. 49
  97. Ohguchi, K., Y. Banno, S. Nakashima, and Y. Nozawa. 1996. Regulation of membrane-bound phospholipase D by protein kinase C in HL60 cells. Synergistic action of small GTP-binding protein RhoA. J. Biol. Chem. 271:4366-4372.[Abstract/Free Full Text]
  98. 50
  99. Park, J. B., J. H. Kim, Y. Kim, S. H. Ha, J. S. Yoo, G. Du, M. A. Frohman, P. S. Suh, and S. H. Ryu. 2000. Cardiac phospholipase D2 localizes to sarcolemmal membranes and is inhibited by alpha-actinin in an ADP-ribosylation factor-reversible manner. J. Biol. Chem. 275:21295-21301.[Abstract/Free Full Text]
  100. 51
  101. Parmentier, J. H., P. Smelcer, Z. Pavicevic, E. Basic, A. Idrizovic, A. Estes, and K. U. Malik. 2003. PKC-zeta mediates norepinephrine-induced phospholipase D activation and cell proliferation in VSMC. Hypertension 41:794-800.[Abstract/Free Full Text]
  102. 52
  103. Plant, P. J., J. P. Fawcett, D. C. Lin, A. D. Holdorf, K. Binns, S. Kulkarni, and T. Pawson. 2003. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat. Cell Biol. 5:301-308.[CrossRef][Medline]
  104. 53
  105. Puls, A., S. Schmidt, F. Grawe, and S. Stabel. 1997. Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proc. Natl. Acad. Sci. USA 94:6191-6196.[Abstract/Free Full Text]
  106. 54
  107. Romanelli, A., K. A. Martin, A. Toker, and J. Blenis. 1999. p70 S6 kinase is regulated by protein kinase C{zeta} and participates in a phosphoinositide 3-kinase-regulated signalling complex. Mol. Cell. Biol. 19:2921-2928.[Abstract/Free Full Text]
  108. 55
  109. Russo, A. A., P. D. Jeffrey, and N. P. Pavletich. 1996. Structural basis of cyclin-dependent kinase activation by phosphorylation. Nat. Struct. Biol. 3:696-700.[CrossRef][Medline]
  110. 56
  111. Sanchez, P., G. De Carcer, I. V. Sandoval, J. Moscat, and M. T. Diaz-Meco. 1998. Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Mol. Cell. Biol. 18:3069-3080.[Abstract/Free Full Text]
  112. 57
  113. Shome, K., Y. Nie, and G. Romero. 1998. ADP-ribosylation factor proteins mediate agonist-induced activation of phospholipase D. J. Biol. Chem. 273:30836-30841.[Abstract/Free Full Text]
  114. 58
  115. Singer, W. D., H. A. Brown, X. Jiang, and P. C. Sternweis. 1996. Regulation of phospholipase D by protein kinase C is synergistic with ADP-ribosylation factor and independent of protein kinase activity. J. Biol. Chem. 271:4504-4510.[Abstract/Free Full Text]
  116. 59
  117. Standaert, M. L., G. Bandyopadhyay, Y. Kanoh, M. P. Sajan, and R. V. Farese. 2001. Insulin and PIP3 activate PKC-zeta by mechanisms that are both dependent and independent of phosphorylation of activation-loop (T410) and autophosphorylation (T560) sites. Biochemistry 40:249-255.[CrossRef][Medline]
  118. 60
  119. Sung, T. C., Y. M. Altshuller, A. J. Morris, and M. A. Frohman. 1999. Molecular analysis of mammalian phospholipase D2. J. Biol. Chem. 274:494-502.[Abstract/Free Full Text]
  120. 61
  121. Toker, A., and A. C. Newton. 2000. Cellular signaling: pivoting around PDK-1. Cell 103:185-188.[CrossRef][Medline]
  122. 62
  123. Uchida, N., S. Okamura, and H. Kuwano. 1999. Phospholipase D activity in human gastric carcinoma. Anticancer Res. 19:671-675.[Medline]
  124. 63
  125. Uchida, N., S. Okamura, Y. Nagamachi, and S. Yamashitam. 1997. Increased phospholipase D activity in human breast cancer. J. Cancer Res. Clin. Oncol. 123:280-285.[Medline]
  126. 64
  127. Yang, J., P. Cron, V. Thompson, V. M. Good, D. Hess, B. A. Hemmings, and D. Barford. 2002. Molecular mechanism for the regulation of protein kinase B/Akt by hydrophobic motif phosphorylation. Mol. Cell 9:1227-1240.[CrossRef][Medline]
  128. 65
  129. Zhao, Y., H. Ehara, Y. Akao, M. Shamoto, Y. Nakagawa, Y. Banno, T. Deguchi, N. Ohishi, K. Yagi, and Y. Nozawa. 2000. Increased activity and intranuclear expression of phospholipase D2 in human renal cancer. Biochem. Biophys. Res. Commun. 278:140-143.[CrossRef][Medline]


Molecular and Cellular Biology, April 2005, p. 3194-3208, Vol. 25, No. 8
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.8.3194-3208.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Choi, H., Leto, T. L., Hunyady, L., Catt, K. J., Bae, Y. S., Rhee, S. G. (2008). Mechanism of Angiotensin II-induced Superoxide Production in Cells Reconstituted with Angiotensin Type 1 Receptor and the Components of NADPH Oxidase. J. Biol. Chem. 283: 255-267 [Abstract] [Full Text]  
  • Xin, M., Gao, F., May, W. S., Flagg, T., Deng, X. (2007). Protein Kinase C{zeta} Abrogates the Proapoptotic Function of Bax through Phosphorylation. J. Biol. Chem. 282: 21268-21277 [Abstract] [Full Text]  
  • Yoon, M.-S., Koo, J. B., Jeong, Y. G., Kim, Y. S., Lee, J. H., Yun, H. J., Lee, K. S., Han, J.-S. (2007). Phospholipase D1 as a Key Enzyme for Decidualization in Human Endometrial Stromal Cells. Biol. Reprod. 76: 250-258 [Abstract] [Full Text]  
  • Lee, J. H., Kim, Y. M., Kim, N. W., Kim, J. W., Her, E., Kim, B. K., Kim, J. H., Ryu, S. H., Park, J. W., Seo, D. W., Han, J. W., Beaven, M. A., Choi, W. S. (2006). Phospholipase D2 acts as an essential adaptor protein in the activation of Syk in antigen-stimulated mast cells. Blood 108: 956-964 [Abstract] [Full Text]  
  • Parmentier, J.-H., Pavicevic, Z., Malik, K. U. (2006). ANG II stimulates phospholipase D through PKC{zeta} activation in VSMC: implications in adhesion, spreading, and hypertrophy. Am. J. Physiol. Heart Circ. Physiol. 290: H46-H54 [Abstract] [Full Text]  
  • Lee, J. S., Kim, J. H., Jang, I. H., Kim, H. S., Han, J. M., Kazlauskas, A., Yagisawa, H., Suh, P.-G., Ryu, S. H. (2005). Phosphatidylinositol (3,4,5)-trisphosphate specifically interacts with the phox homology domain of phospholipase D1 and stimulates its activity. J. Cell Sci. 118: 4405-4413 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J. H.
Right arrow Articles by Ryu, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J. H.
Right arrow Articles by Ryu, S. H.