Novel Functions of the Phospholipase D2-Phox Homology Domain in Protein Kinase C{zeta} Activation

It has been established that protein kinase C ${zeta}$ (PKC ${zeta}$ ) participatesin diverse signaling pathways and cellular functions in a widevariety of cells, exhibiting properties relevant to cellularsurvival and proliferation. Currently, however, the regulationmechanism of PKC ${zeta}$ remains elusive. Here, for the first time,we determine that phospholipase D2 (PLD2) enhances PKC ${zeta}$ activitythrough direct interaction in a lipase activity-independentmanner. This interaction of the PLD2-Phox homology (PX) domainwith the PKC ${zeta}$ -kinase domain also induces the activation loopphosphorylation of PKC ${zeta}$ and downstream signal stimulation, asmeasured by p70 S6 kinase phosphorylation. Furthermore, onlythe PLD2-PX domain directly stimulates PKC ${zeta}$ activity in vitro,and it is necessary for the formation of the ternary complexwith phosphoinositide-dependent kinase 1 and PKC ${zeta}$ . The mutantthat substitutes the triple lysine residues (Lys¹⁰¹, Lys¹⁰²,and Lys¹⁰³) within the PLD2-PX domain with alanine abolishesinteraction with the PKC ${zeta}$ -kinase domain and activation of PKC ${zeta}$ .Moreover, breast cancer cell viability is significantly affectedby PLD2 silencing. Taken together, these results suggest thatthe PLD2-mediated PKC ${zeta}$ activation is induced by its PX domainperforming both direct activation of PKC ${zeta}$ and assistance of activationloop phosphorylation. Furthermore, we find it is an importantfactor in the survival of breast cancer cells.

INTRODUCTION

Top

Introduction

Protein kinase C (PKC) has been implicated in many cellularkey functions, such as cell proliferation, survival, and migration(2, 40, 44). The PKC family is subclassified into three groups—classical,novel, and atypical PKC—according to differences in thelipid activation profile (42). It has been established thatthe phosphorylation and activation of atypical PKC ${zeta}$ , especially,is an important factor in the survival of cancer cells (21,41). The phosphorylation of PKC ${zeta}$ is one of the main mechanismsfor regulating its activity. Recently, it has been reportedthat moderate activation of PKC ${zeta}$ is mediated through activationloop phosphorylation by phosphoinositide-dependent kinase 1(PDK-1), followed by a subsequent autophosphorylation (8, 38,59). PKC ${zeta}$ is also stimulated by the interaction of acidic lipids,including phosphatidic acid (PA) and phosphoinositides. Dueto its structural uniqueness, PKC ${zeta}$ is insensitive to second messengers,such as Ca²⁺ or diacylglycerol (DAG), known to be potent activatorsof the other families (46). Therefore, the activation of PKC ${zeta}$ may be expected to rely on a peculiar mechanism, which is perhapsregulated by many cellular proteins. However, the exact protein-proteininteractions intrinsic to the regulation mechanism of PKC ${zeta}$ remainlargely unclear.

Phospholipase D (PLD) exists as a membrane-bound protein andis widely distributed in a variety of cells. It hydrolyzes phosphatidylcholineto generate choline and PA as a response to diverse stimuli.In many cancer cells, the abnormal overexpression of PLD isassociated with the promotion of mitogenesis, oncogenic transformation,and cell proliferation and the suppression of apoptosis (7,10, 15). PLD activity is most commonly controlled by severalregulators, such as PKC or small G protein (ARF, Rho, and RalA),in the presence of phosphatidylinositol 4,5-bisphosphate (PIP2)(5, 57, 58, 60). To date, two phosphatidylcholine-specific mammalianisoforms of PLD, PLD1 and PLD2, have been isolated and characterized(9, 22, 23). PLD1 is localized mainly in the Golgi apparatusand perinuclear vesicle regions in multiple cell types (13,18, 58), whereas PLD2 is primarily located in the plasma membrane(12, 19). The differences in the localization of these PLDscan provide important clues suggesting their specific rolesin various situations and cell types (12). PLD also has specificdomains, such as the Phox (PX) and the pleckstrin homology (PH)domains. Although it is known that the PX and PH domains aremediated by protein-protein and protein-lipid interactions,the exact roles of these domains remain unclear and debatable.Recently, our group had reported that both the activation andphosphorylation of PLD1 are regulated by PKC ${alpha}$ in phorbol myristateacetate-treated COS-7 cells (32) and that PLD2 activity is alsostimulated by PKC ${delta}$ in the neuronal cell (24). Other researchhad also reported the interrelationships between PLD and PKCisoforms in a variety of cell types (1, 3, 17, 25, 37, 45, 49,51). So, the regulation mechanisms of PLD by PKC are relativelywell known, but the details of PKC regulation mechanisms, regardingthe PLD, are still an enigma.

In this study, we determined that PLD2 directly interacts withPKC ${zeta}$ , regardless of lipase activity, and suggested that the PLD2-PXdomain can play an important role as an activator of PKC ${zeta}$ boththrough direct stimulation and modulating the activation loopphosphorylation of PKC ${zeta}$ .

MATERIALS AND METHODS

Top

Materials and Methods

Materials. An enhanced chemiluminescence kit (ECL system) and glutathioneSepharose 4B were purchased from Amersham Pharmacia Biotech(Buckinghamshire, U.K.). Myelin basic protein and protease inhibitorcocktail were from Sigma. Rabbit polyclonal anti-phospho Thr410PKC ${zeta}$ was kindly provided by Alex Toker (Harvard Medical School,Boston, Mass.) and purchased from Cell Signaling (Beverly, Mass.).Anti-actin antibody was from ICN Pharmaceuticals (Costa Mesa,Calif.). Polyclonal anti-phospho Thr421 and Ser424 p70 S6 kinasewere purchased from Cell Signaling. Rabbit polyclonal PKC ${zeta}$ wasfrom Santa Cruz. Anti-PKC ${alpha}$ and anti-PKC ${delta}$ monoclonal antibodieswere purchased from Transduction Laboratories (Lexington, Ky.).Human recombinant PKC ${zeta}$ , myristoylated PKC ${zeta}$ pseudosubstrate inhibitor,and ß-octylglucopyranoside were from Calbiochem (SanDiego, Calif.). Human recombinant PKC ${zeta}$ is phosphorylated at thethreonine 410 residue and has a biologically active ability.Horseradish peroxidase-conjugated goat anti-rabbit immunoglobulinG (IgG) and goat anti-mouse IgA, IgM, and IgG were from Kirkegaard& Perry Laboratories (Gaithersburg, Md.). [ ${gamma}$ -³²P]ATP and[³H]myristic acid were from Perkin-Elmer Life Sciences (Boston,Mass.). Immobilized protein A was from Pierce and Dulbecco'smodified Eagle's medium (DMEM) was from Life Technologies, Inc.(Gaithersburg, Md.). Polyclonal antibody for the recognitionof PLD1 and PLD2 was generated as described previously (50).

Purification of recombinant PLD from Sf9 cells. Hexahistidine (His₆)-tagged PLD was expressed in Sf9 cells andpurified by chelating Sepharose affinity column chromatography,as described previously (31).

Cell culture. COS-7 cells were maintained in DMEM supplemented with 10% (vol/vol)bovine calf serum, at 37°C, in a humidified, CO₂-controlled(5%) incubator. HEK (human embryonic kidney 293, MDA-MB 468,and Hs 578T cells were cultured under the same conditions, butwith DMEM containing 10% (vol/vol) fetal bovine serum. As describedpreviously, these cells were transfected using Lipofectamine(Life Technologies, Inc.) for the transient expression of theindicated plasmids and small interfering RNA (siRNA).

siRNA sequences. The siRNA of three independent 21-nucleotide sequences correspondingto human PLD2 sequences (nucleotides 703 to 723, AAGAGGUGGCUGGUGGUGAAG;nucleotides 1234 to 1254, AACAGUGGCUAUAGCAAGAGG; and nucleotides1966 to 1986, AAGGUGGGCGAUGAGAUUGUG) and a human PLD1 sequence(nucleotides 1454 to 1474, AAGGUGGGACGACAAUGAGCA) were purchasedfrom Dharmacon Research Inc. (Lafayette, Colo.). The PLD2 siRNAwas used in the mixtures of three independent sequences forefficient silencing. Results of a BLAST search of all siRNAsequences revealed no significant homology to any other sequencesin the database program.

Construction and preparation of GST fusion proteins. Glutathione S-transferase (GST) fusion proteins of PLD2 andPKC ${zeta}$ were generated as previously described (30). To furtherconstruct the PX and PH domains and F1-1, -2, -3, -4, -5, -6,and -6M, the N-terminal region (amino acids 1 to 314) of humanPLD2 was used as a template. These mutants of PLD2 were amplifiedby PCR using specific primers, digested with restriction enzymesEcoRI and XhoI, and ligated into pGEX-4T1 vector (Amersham PharmaciaBiotech). PKC ${zeta}$ deletion mutants such as ${zeta}$ F1, ${zeta}$ F2, ${zeta}$ F3, and ${zeta}$ F4, and ${zeta}$ F3-C1, -C2, -C3, -N1, -N2, -N3, -C2-1, and -C2-2 were also subclonedby the same methods as previously described. Eschericha coliBL21 cells were transformed with individual expression vectorsencoding the GST fusion proteins and induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside(IPTG) at 25°C for 4 h. After harvesting the cells, GSTfusion proteins of PLD2 and PKC ${zeta}$ were purified, as previouslydescribed. These GST fusion proteins were purified by standardmethods, by using glutathione Sepharose 4B (30). PLD2-K3A wasPCR amplified using forward primer 5'-GG GGT ACC ATG ACG GCGACC CCT GAG AGC-3', reverse primer 5'-TGG ACA ACC GCG GCG GCATAC CGT CAT-3', forward primer 5'-ATG ACG GTA TGC CGC CGC GGTTGT CCA-3', and reverse primer 5'-GC TCT AGA CTA TGT CCA CACTTC TAG GGG-3', digested with restriction enzymes KpnI and XbaI,and subcloned into mammalian expression vector pcDNA3.1 (Invitrogen,Carlsbad, Calif.).

Generation of PLD2-WT and PLD2-K3A addback plasmids. One of three independent 21-nucleotide sequences (siRNA) correspondingto human PLD2 sequences is nucleotides 703 to 723: AAGAGGTGGCTGGTGGTGAAG.Three residues of human PLD2 cDNA are substituted to AAGAGATGGCTAGTAGTGAAGfor addback mutants of PLD2-WT and -K3A. These mutations aresilencing mutations. This gene is subcloned into mammalian expressionvector pcDNA3.1 (Invitrogen) and digested with restriction enzymesKpnI and XbaI. These mutations are confirmed through nucleotidesequence analysis.

In vitro binding analysis. In vitro binding between all of the GST fusion proteins andPLD2 was performed in PLD assay buffer (50 mM HEPES-NaOH, pH7.4, 3 mM EGTA, 3 mM CaCl₂, 3 mM MgCl₂, 80 mM KCl), containing1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and proteaseinhibitor cocktail, at 4°C for 1.5 h. After a brief centrifugation,the precipitated complexes were washed three times in the samebuffer before being loaded onto a polyacrylamide gel (30).

Coimmunoprecipitation. COS-7 cells were transfected in combination with the indicatedplasmids. These cultured cells were harvested and lysed withPLD assay buffer containing 1% Triton X-100, 1% cholic acid,1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail.After a brief sonication, the lysates were centrifuged at 100,000x g for 30 min, and the supernatants (2 mg) were incubated withanti-PLD or anti-HA antibody-conjugated protein A-Sepharosefor 4 h. After a brief centrifugation, the coimmunoprecipitatedcomplexes were washed three times with the same buffer beforebeing loaded onto a polyacrylamide gel.

Immunoblot analysis. Immunoblot analysis was performed as previously described (29).In brief, proteins were denatured by boiling at 95°C for5 min in a Laemmli sample buffer. The denatured proteins werethen separated by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) and transferred to nitrocellulosemembranes. After blocking in TTBS buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 0.05% Tween 20) containing 5% skimmed milkpowder, the membranes were incubated with individual monoclonalor polyclonal antibodies and subsequently reincubated with eitheranti-mouse or anti-rabbit IgG, as required, coupled with horseradishperoxidase. Detection was performed using an enhanced chemiluminescencekit, according to the manufacturer's instructions. Immunoblotintensity was determined using a Fuji BAS-2000 image analyzer(Fuji, Tokyo, Japan).

Measurement of PLD activity in cells. PLD activity was assayed by measuring the formation of phosphatidylbutanol,the product of PLD-mediated transphosphatidylation, in the presenceof 1-butanol, as previously described (36). In brief, the cellswere labeled with [³H]myristic acid (10 µCi/ml) for 4h and then washed twice with DMEM. The labeled cells were incubatedwith 0.4% 1-butanol for 5 min, harvested in 0.8 ml of methanoland 1 M NaCl (1:1), and mixed with 0.4 ml of chloroform. Aftervortexing, the tubes were centrifuged at 15,000 xg for 1 min,the organic phase was dried, and the lipids were separated bya Silica Gel 60 TLC plate, which was then developed with ethylacetate-trimethylpentane-acetic acid (9/5/2, vol/vol/vol). Theamount of [³H]phosphatidylbutanol formed was expressed as apercentage of the total ³H-lipid, to account for differencesin cell labeling efficiency.

PKC ${zeta}$ kinase assay. PKC ${zeta}$ activity was measured by the aforementioned protocol, withminor modifications (6). In brief, PKC ${zeta}$ was incubated with myelinbasic protein (2 µg) at 37°C for 30 min in kinasebuffer (50 mM Tris-HCl, pH 7.5, 100 µM Na₃VO₄, 100 µMNa₄P₂O₇, 1 mM NaF, 100 µM phenylmethylsulfonyl fluoride,4 µg of phosphatidylserine, 5 mM MgCl₂, 10 µCi of[ ${gamma}$ -³²P]ATP [3,000 Ci/mmol]), and an in vitro phosphorylationassay was performed. This reaction was terminated by the additionof 15 µl of 2x SDS sample buffer and boiling of the samplesfor 5 min. The sample was analyzed by SDS-PAGE and exposed tophotographic film for autoradiography.

MTT assay in the breast cancer cells. The MTT assay was used as a crude measurement of cell viability(16). MTT is a yellow tetrazolium [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide] which is converted by metabolically active cells intoa colored water-insoluble formazan salt. The cells were seededat 5 x 10⁴/ml (100 µl/well) in 96-well plates, grown for36 h, and depleted with serum for indicated times. MTT reagent(5 mg/ml in phosphate-buffered saline) was then added to thecells (10 µl/well), and the cultures were incubated at37°C for 2 h. The reaction was stopped by the addition of70 µl of isopropanol (including 0.2% HCl), and the tetrazoliumcrystals were dissolved at room temperature. The samples weremeasured by a Biotrak II Reader at a test wavelength of 450nm.

RESULTS

Top

Results

PKC ${zeta}$ interacts with PLD2. Our group had previously published results suggesting that theactivation and phosphorylation of PLD1 are regulated by PKC ${alpha}$ in phorbol myristate acetate-treated COS-7 cells (32) and thatPLD2 activity is also controlled by PKC ${delta}$ in PC12 cells (24).To delineate the specificity of interactions between PLD2 andPKC isozymes, we attempted to examine the physical associationsbetween PLD2 and PKC isozymes in COS-7 cells. As shown in Fig.1A, we observed that three PKC isozymes, PKC ${alpha}$ , - ${delta}$ , and - ${zeta}$ , interactwith PLD2 in a fashion similar to their respective interactionpotencies. Furthermore, PLD2 activity is upregulated by PKC ${alpha}$ -or PKC ${delta}$ -overexpressed cells, but its activity is unaffected byPKC ${zeta}$ in the same cells (Fig. 1B). We also obtained similar resultsin HEK 293 cells (data not shown). These results demonstratedthat PLD2 associates with PKC ${zeta}$ , resulting in the formation ofa physical complex.

View larger version (21K):
[in this window]
[in a new window]
FIG. 1. The effects of representative PKC isoforms, including ${alpha}$ , ${delta}$ , and ${zeta}$ , on PLD2 interaction and activity. COS-7 cells transiently transfected with indicated constructs were cultured for 36 h. A. The cells were lysed with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts were immunoprecipitated (I.P.) with anti-PLD antibody. After a brief centrifugation and washing, the precipitates were subjected to SDS-PAGE and immunoblotted with anti-PLD2 and anti-PKC ${alpha}$ , - ${delta}$ , and - ${zeta}$ antibodies. B. The cells were labeled with [³H]myristic acid for 4 h. The measurement of [³H]phosphatidylbutanol formation was quantified as described in Materials and Methods. The data represent one of two independent experiments.

PLD2 specifically interacts with PKC ${zeta}$ in a lipase activity-independent manner. In the next phase of the experiment, we further confirmed thespecificity of PLD isozymes on PKC ${zeta}$ binding. As shown in Fig.2A, PLD2, rather than PLD1, strongly interacts with PKC ${zeta}$ . Toinvestigate the involvement of PLD lipase activity in the interactionsbetween proteins, we transfected the indicated cDNA encodingplasmids in COS-7 cells. As shown in Fig. 2B, the PLD2 lipaseinactive mutant (PLD2-K758R) as well as the PLD2 wild type (PLD2-WT)interact with PKC ${zeta}$ , regardless of lipase activity. Furthermore,as shown in Fig. 2C, we also determined that endogenous PLD2as a major isoform in COS-7 cells is coimmunoprecipitated withendogenous PKC ${zeta}$ . These results demonstrated that the specificinteraction between PLD2 and PKC ${zeta}$ occurs in a lipase activity-independentmanner.

View larger version (47K):
[in this window]
[in a new window]
FIG. 2. The effects of PLD isozymes and lipase activity on PKC ${zeta}$ interaction. A. COS-7 cells transiently transfected with indicated constructs were grown for 36 h. The cell lysates were solubilized with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts were immunoprecipitated (I.P.) with anti-PLD antibody or antihemagglutinin (HA) antibody. The complexes were briefly washed with the same buffer, subjected to SDS-PAGE, and immunoblot analyzed with anti-PLD antibody and anti-HA antibody. B. COS-7 cells were transfected with indicated plasmids, cultured, and harvested with lysis buffer. The extracts were immunoprecipitated with anti-PLD antibody, and the precipitates were subjected to immunoblot analysis with the indicated antibodies. C. COS-7 cells (2 mg) growing in media supplemented with 10% bovine calf serum were lysed with buffer containing 1% Triton X-100 and 1% cholic acid. Immunoprecipitation with the indicated antibodies was performed as described in Material and Methods and 40 µg of cell lysate was loaded for the total lysate blot.

The triple lysine residues within the PLD2-PX domain are required for interaction with PKC ${zeta}$ . We also confirmed that the purified PLD2 directly interactswith PKC ${zeta}$ in vitro (data not shown). To determine the PKC ${zeta}$ -bindingregion in PLD2, we generated GST fusion fragments of PLD2. Theschematic diagram and the individual GST fusion fragments ofPLD2 used in this study are depicted in Fig. 3A. We performedin vitro binding analysis with GST fusion fragments of PLD2.The N-terminal region (amino acids 1 to 314) of PLD2 is requiredfor binding to PKC ${zeta}$ (Fig. 3B). In the N-terminal region, thePX domain is necessary for interaction with PKC ${zeta}$ (Fig. 3C). Wegenerated serial deletion mutants of the PX domain to do finemapping of the binding site. It is critical for the amino acid68 to 113 region derived from serial deletion mutants of thePLD2-PX domain and, especially, for the amino acid 88 to 112region to interact with PKC ${zeta}$ . This was verified through detailedbinding analysis (Fig. 3D and E). It has been reported thatthe positive- or negative-charge residues of PKC ${zeta}$ interactingproteins are important for the associations between both proteins(43, 53). On the basis of previous reports, we generated a mutantin the triple lysine residues (Lys¹⁰¹, Lys¹⁰², and Lys¹⁰³) withinthe PLD2-PX domain and also confirmed that these residues arecritical in the interaction with PKC ${zeta}$ (Fig. 3E). Furthermore,we generated a PLD2 mutant, in which the triple lysine residueswere substituted with alanine (PLD2-K101/102/103A; PLD2-K3A).Coimmunoprecipitation binding analysis showed that the PLD2-K3Amutant abolishes interaction with endogenous PKC ${zeta}$ in COS-7 cells(see Fig. S1 in the supplemental material). Taken together,these results led us to the conclusion that the triple lysineresidues within the PLD2-PX domain are responsible for associationwith PKC ${zeta}$ .

View larger version (71K):
[in this window]
[in a new window]
FIG. 3. The requirement of the triple lysine residues within the PLD2-PX domain for PKC ${zeta}$ interaction. A. Primary structure and individual domains of PLD2 used in this study. GST fusion proteins containing individual different domains of PLD2 were expressed in bacteria and purified by glutathione Sepharose beads. The individual fragments of PLD2 were followed by F1 (amino acids [a.a.] 1 to 314), F2 (a.a. 315 to 475), F3 (a.a. 476 to 612), F4 (a.a. 613 to 723), F5 (a.a. 724 to 825), F6 (a.a. 826 to 934), PX domain (a.a. 65 to 192), and PH domain (a.a. 201 to 310). F1-1 (a.a. 1 to 67), F1-2 (a.a. 1 to 113), F1-3 (a.a. 1 to 166), F1-4 (a.a. 66 to 112), F1-5 (a.a. 66 to 88), F1-6 (a.a. 88 to 112), and F1-6M (a.a. 88 to 112; K101/102/103A). B, C, D, and E. GST fusion proteins containing individual fragments of PLD2 were incubated with COS-7 cell lysates as a source of PKC ${zeta}$ for 1.5 h. After brief centrifugation and washing, the precipitates were subjected to SDS-PAGE and analyzed with anti-PKC ${zeta}$ antibody. The details of the experiment are described in Materials and Methods. The total amount of GST fusion proteins used in this experiment was shown by Ponceau S staining. I.B., immunoblot.

The PKC ${zeta}$ -kinase domain is responsible for direct interaction with PLD2. PKC ${zeta}$ is comprised of three distinctive domains, including Phoxand Bem1p (PB1), C1, and the serine/threonine kinase domains.The GST fusion fragments of PKC ${zeta}$ used in this study are shownin Fig. 4A. We prepared GST fusion fragments of PKC ${zeta}$ and performedGST pull-down assays. As shown in Fig. 4B, the PKC ${zeta}$ -kinase domaininteracts exclusively with PLD2 purified from Sf9 cells andnot with the PB1 and C1 domains. To specifically verify thepotential interaction region, we generated serial deletion mutantsof the PKC ${zeta}$ -kinase domain and carried out GST pull-down assays.As shown in Fig. 4C and D, the amino acid 348 to 370 regionwithin the PKC ${zeta}$ -kinase domain is responsible for interactionwith PLD2. Taken together, these results suggest that the aminoacid 348 to 370 region within the PKC ${zeta}$ -kinase domain is requiredfor binding to PLD2.

View larger version (35K):
[in this window]
[in a new window]
FIG. 4. The interaction of PLD2 with the amino acid 348 to 370 region within the PKC ${zeta}$ -kinase domain. A. Primary structure and individual domains of PKC ${zeta}$ used in this study. GST fusion proteins containing distinctive domains of PKC ${zeta}$ were expressed in E. coli and purified by glutathione Sepharose beads. The individual fragments of PKC ${zeta}$ were followed by ${zeta}$ F1 (amino acids [a.a.] 1 to 98), ${zeta}$ F2 (a.a. 99 to 251), ${zeta}$ F3 (a.a. 252 to 519), ${zeta}$ F4 (a.a. 520 to 592), ${zeta}$ F3-C1 (a.a. 252 to 460), ${zeta}$ F3-C2 (a.a. 252 to 390), ${zeta}$ F3-C3 (a.a. 252 to 320), ${zeta}$ F3-N1 (a.a. 320 to 519), ${zeta}$ F3-N2 (a.a. 390 to 519), ${zeta}$ F3-N3 (a.a. 460 to 519), ${zeta}$ F3-C2-1 (a.a. 252 to 370), and ${zeta}$ F3-C2-2 (a.a 252 to 347). B, C, and D. GST fusion proteins containing PKC ${zeta}$ fragments were incubated with recombinant PLD2 purified from Sf9 cells. After brief centrifugation and washing, glutathione bead complexes were subjected to SDS-PAGE and analyzed by immunoblotting (I.B.) with anti-PLD2 antibody. The total amount of GST fusion proteins used in this experiment was shown by Ponceau S staining.

The F1-6 fragment directly stimulates PKC ${zeta}$ activity in vitro. Considering the findings that the triple lysine residues withinthe PLD2-PX domain directly interact with the PKC ${zeta}$ -kinase domain(Fig. 3 and 4), we examined the kinase activity of PKC ${zeta}$ to substantiallycharacterize the meaning of the interactions between the twoproteins. We performed in vitro phosphorylation assays withmaltose binding protein (MBP) and phosphorylated PKC ${zeta}$ . As shownin Fig. 5, the F1-4 fragment corresponding to the amino acid66 to 112 region within the PLD2-PX domain exhibits an approximate10-fold increase in autophosphorylation and displays an approximateeightfold increase in MBP phosphorylation and, interestingly,the F1-6 fragment corresponding to the amino acid 88 to 112region induces about a sixfold increase in PKC ${zeta}$ activity. However,the F1-5 and F1-6M fragments, which are deficient in bindingability, result in a little less than a twofold increase inPKC ${zeta}$ activity. The obvious conclusion is that PKC ${zeta}$ activity ismore efficiently stimulated by F1-6 than by F1-6M. These resultssuggest that the amino acid 88 to 112 region within the PLD2-PXdomain has the ability to directly stimulate PKC ${zeta}$ activity.

View larger version (51K):
[in this window]
[in a new window]
FIG. 5. The effects of the specific binding motif within the PLD2-PX domain on PKC ${zeta}$ activity. The activation loop-phosphorylated PKC ${zeta}$ was incubated with specific fragments within the PLD2-PX domain, such as F1-4, F1-5, F1-6, and F1-6M in kinase buffer (50 mM Tris-HCl, pH 7.5, 100 µM Na₃VO₄, 100 µM Na₄P₂O₇, 1 mM NaF, 100 µM phenylmethylsulfonyl fluoride, 4 µg of phosphatidylserine, 5 mM MgCl₂, 10 µCi of [ ${gamma}$ -³²P]ATP [3,000 Ci/mmol]) for 30 min, and an in vitro phosphorylation assay was performed. This reaction was terminated by the addition of SDS sample buffer, and the precipitates were subjected to SDS-PAGE and exposed to photographic film for autoradiography. The data represent one of three independent experiments. The detailed procedures are described in Materials and Methods.

PLD2 protein significantly stimulates PKC ${zeta}$ activity in cells. Because the PLD2-PX domain can directly stimulate PKC ${zeta}$ activityin vitro (Fig. 5), we attempted to verify whether the PLD2-mediatedPKC ${zeta}$ activation induces the propagation of downstream signalingflow in cells. It has been reported that PKC ${zeta}$ induces p70 S6kinase activation in murine prostate cancer cells such as TRAMP(21). Actually we observed that activation of p70 S6 kinaseis potentiated in PKC ${zeta}$ -WT adenovirus-infected COS-7 cells anddecreased in PKC ${zeta}$ -DN-expressing cells under similar conditionswithout changing the PLD2 expression (see Fig. S2 in the supplementalmaterial). As shown in Fig. 6A, the activation of p70 S6 kinaseis enhanced in PLD2-WT- and PLD2-K758R-overexpressed COS-7 cells,but PLD2-K3A had no effect on p70 S6 kinase activation in comparisonwith vector-transfected cells. Furthermore, when endogenousPLD2 is depleted by siRNA, the activation of p70 S6 kinase islessened in comparison with that of control siRNA for luciferase(Fig. 6B). Interestingly, as shown in Fig. 6A, we observed thatthe activation loop phosphorylation (pT410) of endogenous PKC ${zeta}$ was significantly enhanced in PLD2-WT and -K758R cells but notPLD2-K3A-transfected cells. When endogenous PLD2 expressionwas silenced with PLD2 siRNA, the activation loop phosphorylationof PKC ${zeta}$ decreased dramatically (Fig. 6B). Taken together, theseresults suggest that the activation and phosphorylation of PKC ${zeta}$ might be regulated by PLD2 protein, in a correlative fashionwith p70 S6 kinase activation.

View larger version (31K):
[in this window]
[in a new window]
FIG. 6. The effects of PLD protein on activation of PKC ${zeta}$ and p70S6K. A and B. COS-7 cells were transfected with the indicated plasmids encoding various PLD2 constructs or siRNA for control (luciferase) and PLD2, cultured for 36 h, starved in serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100 for 30 min on ice. The cell lysates, removed from the crude nuclear fraction using centrifugation, were analyzed by immunoblotting with indicated antibodies. The n-fold increase is expressed as the percentage of the indicated antibodies' intensity above the basal level. Results are expressed as average values ± standard errors of three independent experiments. *, P of <0.05 compared with vector (Vec) or control (Con) siRNA-transfected cells.

The ternary complex including PDK-1, PLD2, and PKC ${zeta}$ is formed in COS-7 cells. Because the activity of PDK-1 phosphorylating Akt has been unaffectedby the extent of PLD2 expression, indicating that PLD2 may notdirectly affect PDK-1 activity (see Fig. S3 in the supplementalmaterial), we examined whether PLD2 exists in the physical complexof PDK-1 and PKC ${zeta}$ , hence increasing the activation loop phosphorylationof PKC ${zeta}$ . As shown in Fig. 7A, PLD2-K758R as well as PLD2-WT existedin the ternary complex with PDK-1 and PKC ${zeta}$ . However, PLD2-K3Adid not exist in this complex. PLD2-K3A bound with PDK-1 butnot PKC ${zeta}$ , and PLD2-K3A had no effect on the complex arising fromthe interaction of PKC ${zeta}$ with PDK-1. Since the PLD2-PX domainwas involved in direct interaction with PKC ${zeta}$ (Fig. 3C), we examinedwhether it was sufficient for ternary complex formation andenhanced activation loop phosphorylation of PKC ${zeta}$ . As shown inthe Fig. 7B, surprisingly, the PLD2-PX domain was found to existin a physical complex with PKC ${zeta}$ and PDK-1 and to enhance activationloop phosphorylation of PKC ${zeta}$ . But the PLD2-PX-K3A domain didnot form the physical ternary complex with PKC ${zeta}$ and PDK-1 andhad no effect on binding of PKC ${zeta}$ to PDK-1. Taken together, theseresults suggested that the PLD2-PX domain also plays the roleof a critical cofactor, helping the activation loop phosphorylationof PKC ${zeta}$ in a ternary complex with PKC ${zeta}$ and PDK-1.

View larger version (49K):
[in this window]
[in a new window]
FIG. 7. The formation of ternary complex including PDK-1, PLD2, and PKC ${zeta}$ . A. COS-7 cells were transiently transfected with various PLD2 constructs, grown for 48 h, depleted with serum for 12 h, and then lysed with buffer containing 1% Triton X-100 and 1% cholic acid. The extracts, immunoprecipitated (I.P.) with anti-PLD antibody or antihemagglutinin (HA) antibody, were analyzed by immunoblotting with indicated antibodies. Anti-actin antibody was used with normalized control. B. COS-7 cells were transfected with the indicated plasmids encoding vector (Vec), Flag-tagged PLD2-PX-WT, and Flag-tagged PLD2-PX-K3A, cultured for 36 h, depleted with serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100 for 30 min on ice. The cell lysates, removed from the crude nuclear fraction using centrifugation, were immunoprecipitated with anti-Flag antibody. The precipitated complex was analyzed with the indicated antibodies. The total lysates were also analyzed by immunoblotting with the indicated antibodies. The n-fold increase is expressed as a percentage of the indicated antibodies' intensity above the basal level. The experiment represents one of three independent experiments. *, P of <0.05 compared with vector-transfected cells.

Cell viability is affected by PLD2 silencing in breast cancer cells. Recent reports have demonstrated that the regulation of PKC ${zeta}$ activity is relevant to cell survival and apoptosis in breastcancer cells (41) and also that PLD2 is highly overexpressedin a wide variety of human cancer cells (48, 60, 61, 63). Therefore,we examined whether the activation of PKC ${zeta}$ is controlled by PLD2expression. In Fig. 8A and B, we demonstrated that activationloop phosphorylation and activity of PKC ${zeta}$ decreased dramaticallyunder PLD2 silencing conditions in breast cancer cells containingHs 578T and MDA-MB 468 cells. The activation of p70 S6 kinasealso significantly decreased under the same circumstances witha concomitant correlation with the attenuation of PKC ${zeta}$ activationloop phosphorylation. The PDK-1 activity was unaffected by PLDsilencing in breast cancer cells (see Fig. S4 in the supplementalmaterial). As shown in Fig. 8C and D, cell viability is attenuatedin PLD2-silenced breast cancer cells with a correlation to cellstreated with PKC ${zeta}$ inhibitors in a time-dependent manner. Controland PLD1-silenced cells exhibited significantly less effectson cell viability than did PLD2-silenced cells. Furthermore,as shown in Fig. 8E and F, it was also determined that the cellviability was recovered by PLD2-WT (addback plasmids) and PLD2-WT-PXbut not by PLD2-K3A (addback plasmids) and PLD2-K3A-PX. Theseresults suggest that PLD2-mediated PKC ${zeta}$ activation is importantfor the survival of breast cancer cells.

View larger version (94K):
[in this window]
[in a new window]
FIG. 8. The effects of PLD silencing on cell viability in breast cancer cells. A and B. Hs 578T cells and MDA-MB 468 cells were transfected with siRNA for control (Con), PLD1, and PLD2. The details of the procedures are described in Materials and Methods. In brief, the cells were cultured for 48 h, depleted with serum for 12 h, and then lysed with buffer containing 0.1% Triton X-100, for 30 min on ice. The cell lysates, removed from the crude nuclear fraction by using centrifugation, were analyzed by immunoblotting with the indicated antibodies. The n-fold increase is expressed as the percentage of the indicated antibodies' intensity above the basal level. The data represent one of three independent experiments. *, P of <0.05 compared with control siRNA-transfected cells. C and D. Hs 578T cells and MDA-MB 468 cells were transfected with siRNA for control, PLD2, and PLD1 and treated with the myristoylated PKC ${zeta}$ pseudosubstrate inhibitor (50 µM). After serum depletion for the indicated time points, the cells were washed, lysed with isopropanol including 0.2% HCl, and measured at a wavelength of 450 nm. *, P of <0.05 compared with control siRNA-transfected cells; ${dagger}$ or ${ddagger}$ , P of <0.05 versus PLD2 or PLD1 siRNA-transfected cells; ¦, P of <0.05 versus PKC ${zeta}$ inhibitor-treated cells. E and F. Hs 578T (panel E) and MDA-MB 468 (panel F) cells were transfected with the indicated siRNA and plasmids. The siRNA used in the experiments was nucleotides 703 to 723, AAGAGGTGGCTGGTGGTGAAG, for addback of PLD2-WT or -K3A (addback plasmids). After serum depletion for 48 h, the cells were washed, lysed with isopropanol including 0.2% HCl, and measured at a wavelength of 450 nm. *, P of <0.05 compared with control siRNA-transfected cells; ${dagger}$ , P of <0.05 versus PLD2 siRNA-transfected cells; ${ddagger}$ , P of <0.05 versus PLD2 siRNA + PLD2-WT addback; ¦, P of <0.05 versus PLD2 siRNA + PLD2-K3A addback; ¶, P of <0.05 versus PLD2 siRNA + PLD2-WT-PX; $§$ , P of <0.05 versus PLD2 siRNA + PLD2-K3A-PX.

DISCUSSION

Top

Discussion

PLD has a large role in the activity of lipid hydrolysis, anduntil now there have been many reports that its activity iselaborately controlled by many cellular regulators in diversecell systems (20, 22, 26, 31, 33, 34, 35, 37, 50). In contrast,little is known about the details of mechanisms in the regulationof other proteins by PLD through direct binding. In this study,we suggest that the PLD2-PX domain directly binds to PKC ${zeta}$ , simultaneouslyperforming dual roles—one as a direct activator for PKC ${zeta}$ ,and the other as a cofactor increasing the activation loop phosphorylationof PKC ${zeta}$ (Fig. 9). Furthermore, PLD2-mediated PKC ${zeta}$ activation isalso implicated in cancer cell viability.

View larger version (26K):
[in this window]
[in a new window]
FIG. 9. Proposed model of PKC ${zeta}$ activation by PLD2. The PLD2-PX domain directly interacts with the PKC ${zeta}$ -kinase domain. Ultimately, PLD2 is a ternary complex of PKC ${zeta}$ with PDK-1 and its PX domain assists the activation loop phosphorylation of PKC ${zeta}$ by PDK-1. The activation loop-phosphorylated PKC ${zeta}$ is fully stimulated through direct interaction of PLD2-PX domain. The completely activated PKC ${zeta}$ (black) upregulates downstream signals, such as p70 S6 kinase.

The conventional PKC activation mechanisms are well understood.Mechanisms have been established for sequential phosphorylation,the recruiting of proper localization, and the exchanging ofbinding proteins (47). It is generally understood that synthesizedPKC is translocated into the membrane and phosphorylated byPDK-1 and that phosphorylated PKC is regulated by Ca²⁺ or DAGgenerated by stimuli, culminating in the release of specificdomains from the substrate binding cavity (61). In contrast,since PKC ${zeta}$ is insensitive to second messengers such as Ca²⁺ andDAG in its PB1 and C1 domains, it has been theorized that itsactivity is primarily regulated by protein-protein interaction.However, the activation mechanisms and cellular regulators ofPKC ${zeta}$ remain unclear. Here, our data demonstrated that, regardlessof lipase activity, PLD2 enhances the activation of PKC ${zeta}$ by increasingthe activation loop phosphorylation of PKC ${zeta}$ under basal conditions.Also, the activation loop-phosphorylated PKC ${zeta}$ is stimulated bydirect binding of PLD2 (Fig. 5). Moreover, PLD2-mediated PKC ${zeta}$ activation induces the phosphorylation of p70 S6 kinase, resultingin downstream signal flow (Fig. 6). The regulation of PKC ${zeta}$ activityby PLD2 results from the signaling complex composed of PDK-1and PKC ${zeta}$ , not from the upregulation of PDK-1 activity as upstreamkinase (Fig. 7A; also see Fig. S3 in the supplemental material).Furthermore, PLD2-WT, like PLD2-K3A, has no effect on bindingwith PDK-1 or on the binding of PKC ${zeta}$ with PDK-1. According toprevious reports, when PKC ${zeta}$ is translocated into the membrane,bound to PDK-1, and then phosphorylated, PLD2 as a membrane-boundprotein can assist the activation loop phosphorylation of PKC ${zeta}$ (Fig. 6). In this study, we suggest PLD2 as a novel proteincofactor for full and complete activation of PKC ${zeta}$ .

PKC ${zeta}$ phosphorylates p70 S6 kinase. Furthermore, it is known thatp70 S6 kinase is activated through multiple-site phosphorylation.Another kinase for p70 S6 kinase is known to be mTOR, whichis rapamycin sensitive and a target of PA (4, 14). mTOR phosphorylatesp70 S6 kinase at the Thr³⁸⁹ residue in a PA-dependent manner,but PKC ${zeta}$ phosphorylates p70 S6 kinase at the Thr⁴²¹ and Ser⁴²⁴residues regardless of PA because, as shown in Fig. 6A, thePLD2-K758R lipase-inactive mutant abolishes generation of PAand also PLD2-WT increases phosphorylation of p70 S6 kinase.So, PLD2 interaction-dependent PKC ${zeta}$ activation could stimulatep70 S6 kinase. Accordingly, p70 S6 kinase activation is differentlyregulated by two kinases such as PKC ${zeta}$ and mTOR. Moreover, PLD2-mediatedPKC ${zeta}$ , rather than mTOR activated by PA, phosphorylates p70 S6kinase at the Thr⁴²¹ and Ser⁴²⁴ residues.

PKC ${zeta}$ activity is regulated by dual mechanisms—the directactivation of PLD2 in vitro and assistance of the activationloop phosphorylation of PKC ${zeta}$ (Fig. 5 and 6). PLD2 stimulatesPKC ${zeta}$ activity through direct interaction with the PKC ${zeta}$ -kinasedomain (Fig. 4). The distinctive domains of PKC ${zeta}$ , including PB1,C1, and the kinase domain, are known to mediate protein-proteinor protein-lipid interactions. It is known that the specificdomains of PKC ${zeta}$ are important for interacting with several bindingproteins such as Par6, Par3/ASIP, Cdc42, and mammalian Lgl,involved in cell polarity (28, 39, 52), and p62/ZIP, MEK5, andp70 S6 kinase, implicated in the signal transduction pathway(11, 52, 54, 56). Among the interacting proteins, Par3 exhibitsthe greatest affinity for the kinase domain, but whether itsinteraction regulates kinase activity remains unclear (39).In this study, we determine that PLD2 interacts with the aminoacid 348 to 370 region within the PKC ${zeta}$ -kinase domain, subsequentlyregulating PKC ${zeta}$ activity. A recent report has predicted thisregion, by multiple sequence alignment under secondary structuremodeling, to be located in the ${alpha}$ -E helix within the C-lobe sideof the kinase domain (64). In the case of cyclin-dependent kinase(CDK), the activation loop has been found to be structurallycoupled with the ${alpha}$ -C helix, stabilizing its inactive conformation.The direct interaction of cyclin with the ${alpha}$ -C helix of CDK inducesan alteration in the orientation of the ${alpha}$ -C helix and eventuallyresults in activation loop phosphorylation by CDK-activatingkinase (27, 55). We suggested that PLD2, interacting with theamino acid 348 to 370 region corresponding to the ${alpha}$ -E helix,can facilitate activation loop phosphorylation, due to a conformationalchange of PKC ${zeta}$ by interactions with the neighboring phosphorylationsite. This region can also hold the possible potential motifproviding the direct binding site for the PLD2-PX domain, necessaryfor the full activation of PKC ${zeta}$ . Surprisingly, the PLD2-PX domainis only sufficient for the signaling complex with PKC ${zeta}$ and PDK-1and enhances the activation loop phosphorylation of PKC ${zeta}$ (Fig.7B). The PLD2-PX domain also contains an activation motif ofPKC ${zeta}$ , indicating the stimulation of activation loop-phosphorylatedPKC ${zeta}$ activity through direct interaction. The autophosphorylationof PKC ${zeta}$ was also enhanced by the PLD2-PX domain and then activatedPKC ${zeta}$ increased the phosphorylation of MBP (Fig. 5). Therefore,we suggest that PKC ${zeta}$ activation by PLD2 binding may be a newmechanism for kinase activation. Furthermore, as shown in Fig.S6 in the supplemental material, it is suggested that PKC ${zeta}$ phosphorylationis attenuated under the basal condition in PLD2-silenced cells,and the signal-dependent PKC ${zeta}$ phosphorylation also is decreasedin PLD2-silenced cells. In addition, the signal-dependent PKC ${zeta}$ phosphorylation occurs as the basal PKC ${zeta}$ phosphorylation is reducedby PLD2 silencing. Therefore, it was found that PLD2 is essentialfor basal PKC ${zeta}$ activation. The issue of PLD2-PKC ${zeta}$ signaling mayrequire further characterization.

PLD2 has two distinctive domains including the PX and PH domains.Their exact roles have not yet been well defined. Recently,our group suggested that one of the roles of the PLD2-PX domainis the exertion of an anchoring function, supporting the thesisthat PLD2 functions as an adaptor in the redistribution of PLC- ${gamma}$ 1to the membrane region in epidermal growth factor signaling(26). We also theorized that it may play a secondary role, inthe provision of the docking sites regulating PLD2 activitywith its interacting protein, such as Munc18-1 (33). Here, wesuggest that another of its functions is to serve as a noveldirect activator for PKC ${zeta}$ , since the PLD2-PX domain can enhancestimulation and activation loop phosphorylation of PKC ${zeta}$ (Fig.5 and 7B). The triple lysine residues within the PLD2-PX domainare especially responsible for PKC ${zeta}$ activation and interaction.However, the PLD2-K3A mutant abolishes interactions with PKC ${zeta}$ and inhibits its mediated PKC ${zeta}$ activation (Fig. 3 and 5). Althoughit cannot be affirmed that these mutations have no effects onthe conformation of the PLD2-PX domain, it does not change theexpression level, subcellular localization, or catalytic propertiesof PLD2 in vitro (data not shown). These results suggest thatthe effect of these mutations on PLD2 structure, if any, isneither dramatic nor significant in PLD2 function, except forits interaction with PKC ${zeta}$ . Taken together, we suggest that thePLD2-PX domain, as one of a collection of multiple binding modules,executes a myriad of functional roles in various cellular contexts.

PLD2 is known to be highly overexpressed in a wide variety ofhuman cancer cells (48, 62, 63, 65), but it is unclear whatthe role of PLD might be in cancer cells. Furthermore, thereare several reports in which the regulation of PKC ${zeta}$ , and p70S6 kinase activity, is implicated in cell survival and apoptosisin prostate and breast cancer cells (21, 41). As shown in Fig.8, we determined that the PLD2-mediated PKC ${zeta}$ activation is importantfor cell viability after the induction of cell death as a serum-depletedcondition. Furthermore, we demonstrated that the effects ofPLD2 silencing on the viability of breast cancer cells are nonadditivein PKC ${zeta}$ inhibitor-treated cells for supporting functional significance(see Fig. S5A and B in the supplemental material). We performedPKC ${zeta}$ rescue experiments to reveal the linking between PLD2 andPKC ${zeta}$ after silencing with PLD2 siRNA (see Fig. S5C and D in thesupplemental material). As the amounts of PKC ${zeta}$ were increased,the cell viability was not significantly rescued under the PLD2silencing condition. The reason that cell survival was not completelyrecovered is possibly the result of the silencing of PLD2, whichacts as either a cofactor or activator for PKC ${zeta}$ . Therefore, PKC ${zeta}$ activation is dependent on PLD2 signaling. Therefore, we suggestedthat PLD2-mediated PKC ${zeta}$ activation is essential for the survivalof breast cancer cells. Considering whether these tumor cells,if any, exist in either serum-exhausted or nutrient-deficientconditions in the angiogenesis process, we suggested that thePLD2-mediated PKC ${zeta}$ activation may be important in the survivalof breast cancer cells. Accordingly, the issue of physical interactionmay be applied to unravel some problems in cancer cells andnecessary to further characterize the uncertain details of thesignal mechanisms.

ACKNOWLEDGMENTS

We gratefully acknowledge Alex Toker for kindly providing anti-pPKC ${zeta}$ antibody (pT410) to our laboratory.

This work was supported by the programs of 21st Frontier Proteomicsand the National Research Laboratory of the Ministry of Scienceand Technology, Republic of Korea.

FOOTNOTES

* Corresponding author. Mailing address: Division of Molecular and Life Sciences, Pohang University of Science and Technology, San 31, Hyojadong, Pohang 790-784, Republic of Korea. Phone: 82-54-279-2292. Fax: 82-54-279-0645. E-mail: sungho{at}postech.ac.kr.

Supplemental material for this article may be found at http://mcb.asm.org/.

REFERENCES

Top