![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, May 2005, p. 3774-3783, Vol. 25, No. 9
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.9.3774-3783.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Paul W. Denny,1,
Sue Vaughan,2
David Goulding,1
Tim R. Jeffries,1,¶
Deborah F. Smith,1,||
Keith Gull,2 and
Mark C. Field1*
Department of Biological Sciences, Imperial College, London,1 Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom2
Received 1 July 2004/ Returned for modification 10 August 2004/ Accepted 18 January 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The protozoan Trypanosoma brucei is an ideal system in which to study microtubule-mediated events, because, in addition to the flagellum, the cell is highly polarized as a consequence of an ordered array of subpellicular microtubules (8, 11). The trypanosome has a single flagellum that emerges from the flagellar pocket, an invagination of the plasma membrane at the posterior end of the cell (9, 21). The axoneme of kinetoplastid protozoa is attached to a lattice-like structure of a similar diameter, the PFR, extending along most of the axoneme (9). The flagellum is attached to the cell body throughout most of its length by the FAZ, which is composed of an electron-dense filament plus four cytoplasmic microtubules that originate from the basal body region (9).
During cell division the trypanosome must replicate and separate several single-copy organelles present in G1 cells, i.e., nucleus, kinetoplast, mitochondrion, basal body, and flagellum (36, 44). Ultrastructural studies have described a number of markers of cell cycle position and elucidated a number of discrete cell cycle phases (36). The first morphological event of the T. brucei cell cycle is the maturation and duplication of the basal body, which is followed by kinetoplast S phase and then nuclear S phase (36, 44). During flagellum morphogenesis, the new axoneme is assembled from the recently matured basal body. New probasal bodies are formed, and the elongation and emergence of the flagellum from the flagellar pocket is followed by construction of a new FAZ and PFR (14, 36, 44). The duplicated kinetoplasts are segregated by means of their attachment to the flagellar basal bodies (24, 32), and this segregation is followed by the onset of mitosis (9). Kinetoplast/basal body segregation is accompanied by increased cell length and may contribute an important element in the control of later cell cycle events such as nuclear division and cytokinesis (9, 27). A cleavage furrow originates at the anterior tip of the replicating cell and follows a helical path to the posterior end of the cell that separates the two daughter cells (36). The four FAZ-associated microtubules have been postulated to provide a structural correlate between the length and position of the new flagellum, the main growth of the cell body, and to mark the position/direction of the cleavage furrow at cytokinesis (15, 33). This well-characterized mitotic cycle provides an excellent model system by which to characterize the functions of factors involved in basal body duplication, flagellar biogenesis, and cytokinesis.
Here we describe the identification and characterization of TbLRTP, which exhibits significant similarity to a leucine-rich repeat protein most abundantly expressed in late pachytene and diplotene cells of the testes of mice and humans (46). TbLRTP also has homologues in a wide variety of eukaryotes, including zebra fish, where the respective gene, seahorse, is implicated in polycystic kidney disease (38). We demonstrate that TbLRTP is an important factor in control of basal body duplication and hence flagellar biogenesis and cytokinesis. These data uncover the function of the LRTP family of proteins and also indicate the manner in which seahorse mutants likely cause cystic disease.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture. All growth medium reagents were supplied by GIBCO-BRL Life Technologies (Paisley, United Kingdom). PCF and BSF trypanosomes, strain Lister 427, were maintained in SDM79 and HMI9 medium, respectively. TbLRTP overexpression was achieved from the pXS219 plasmid (26), and RNAi was performed using the p2T7Ti vector (16) in the T. brucei 29-13 procyclic cell line (42). Leishmania mexicana (MNYC/BZ/62/M379) promastigotes were maintained in Schneider's Drosophila medium, pH 7.5, supplemented with 10% fetal calf serum at 26°C. Metacyclogenesis was induced by passage into medium at pH 5.0; metacyclic parasites were subsequently transformed into axenic amastigotes by increasing the culture temperature to 32°C (3).
DNA manipulation.
The TbLRTP ORF was present in a 
-phage isolated during a genomic screen (22). PCR was performed with Pfu polymerase (Stratagene, La Jolla, Calif.), and products were subcloned using the PCR-Script Amp cloning kit (Stratagene) and sequenced with BigDye terminator chemistry, version 3.0 (Applied Biosystems, Foster City, Calif.) on a semiautomated sequencer (ABI 377; Perkin-Elmer Corp., Norwalk, Conn.). TbLRTP was PCR amplified from genomic DNA using primers CCCAAGCTTATGGGCCGCATCACTACCGACC and GGATCCCGCCCTTACCTAGTCACAGCAGTATGG and was subcloned into the trypanosomal expression vector pXS219 (26) and the RNAi vector p2T7i (16) using HindIII and BamHI sites (underlined). By the RNAit algorithm the TbLRTP ORF is not expected to cosuppress other transcripts from the trypanosome genome (30).
Antibody production. Antiserum against TbLRTP was generated against the entire ORF expressed from the pGEX-2TK vector (Amersham Biosciences, Little Chalfont, Buckinghamshire, United Kingdom). A purified TbLRTP-glutathione S-transferase fusion protein was used to raise polyclonal antibodies in rabbits. Antibodies were affinity purified by using an Escherichia coli-expressed recombinant antigen (affinity purified on glutathione-Sepharose) immobilized on CNBr-activated Sepharose.
Cytoskeletal extraction. Trypanosomes were harvested by centrifugation and washed in PEM buffer (100 mM PIPES [pH 6.9], 2 mM EGTA, 1 mM MgSO4) (31). Cells were resuspended in PEM buffer containing 1% Nonidet P-40. After 2 min, the mixture was centrifuged and pellets containing the cytoskeleton were processed for either biochemical or microscopic analysis. Flagellum isolation was performed using the Ca2+-resistant method (31).
Immunofluorescence.
Cells were washed in PBS, spread on poly-L-lysine-coated slides, and fixed in methanol at –20°C or in 3% PFA in PBS, pH 7.5, for 10 min (BSF) or 1 h (PCF) on ice before processing for immunofluorescence (36). For the preparation of cytoskeletons, cells were extracted prior to fixation for 2 min with cold PEM buffer (31). The following antibodies were used: TAT1 (anti-
-tubulin) (43), BBA4 (marker of the basal body) (43), L6B3 (marker of the FAZ) (14), L13D6 (marker of PFR proteins 1 and 2) (14). Primary antibodies were detected with a Texas Red-conjugated goat anti-rabbit or Alexa-conjugated goat anti-mouse secondary antibody (Molecular Probes). Cells were examined using a Nikon Eclipse E600 epifluorescence microscope equipped with a Nikon digital DMX 1200 camera (Nikon Europe B.V., AE Badhoev, The Netherlands). Digital images were captured using Nikon ACT-1 software and assembled using Adobe Photoshop (Adobe Systems, Inc., San Jose, Calif.).
Western blotting. Protein samples were electrophoresed on 12% SDS-polyacrylamide gels and blotted onto a Hybond ECL nitrocellulose membrane (Amersham Life Science Ltd., United Kingdom) by wet transfer. For analysis of whole-cell extracts, 107 cells per lane were used. For quantitation, X-ray films after exposure with ECL reagent were scanned and analyzed by densitometry using ImageJ software (http://rsb.info.nih.gov/ij/).
Electron microscopy. For transmission electron microscopy, cells were fixed in suspension by addition of chilled 2.5% glutaraldehyde and 4% PFA in PBS on ice for 1 h, rinsed in 0.1 M sodium cacodylate, and postfixed in 1% osmium tetroxide for 1 h. After rinsing, cells were dehydrated in an ethanol series, with 1% uranyl acetate added at the 30% stage, followed by propylene oxide, and were then embedded in Epon/Araldite. Sections were cut on a Leica Ultracut-T ultramicrotome and were contrasted with uranyl acetate and lead citrate.
Bioinformatics. BLAST searches (2) were conducted at the National Center for Biotechnology Information site (http://www.ncbi.nlm.nih.gov/BLAST), the Department of Energy Joint Genome site (http://genome.jgi-psf.org/index.html), and the T. brucei databases at The Institute for Genomic Research (http://www.tigr.org/tdb/mdb/tbdb/index.shtml) and the Wellcome Trust Sanger Institute (http://www.sanger.ac.uk/Projects/T_brucei/). Sequence alignments were performed using Clustal X (39). Prediction of coiled-coil domains was performed using PEPCOIL (18). Retrieval of data concerning the chromosomal environment of the TbLRTP locus was from GeneDB (http://www.genedb.org/genedb/tryp/index.jsp).
Nucleotide sequence accession numbers. The nucleotide sequence data reported in this paper have been deposited at GenBank with the accession number AF152174.1. The corresponding ORFs are annotated at GeneDB as Tb03.48K5.370 and Tb03.48K5.300 on chromosome III of the T. brucei strain 927 genome.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
phage was isolated containing a second ORF which displayed significant similarity to LRTP (35% identity, 52% similarity), a testis-specific protein of Mus musculus and Homo sapiens; the ORF was designated TbLRTP (46). Homologues are present in Trypanosoma cruzi, Leishmania major, Giardia lamblia, Chlamydomonas reinhardtii, Drosophila melanogaster, Anopheles gambiae, Xenopus tropicalis, and Danio rerio but not Caenorhabditis elegans. The trypanosome genome carries two TbLRTP ORFs on chromosome III in a region of local tandem duplication, and no additional sequences were detected by Southern blot analysis (data not shown). It is not known if expression of both ORFs is the same, but given their identical sequences, the functions of the two proteins are likewise expected to be identical. The domain structure of TbLRTP and an alignment against the D. melanogaster and H. sapiens homologues are shown in Fig. 1A and B, respectively. TbLRTP is a protein of 383 amino acids with a predicted molecular mass of 43.3 kDa and a pI of 5.8; it is composed of four N-terminal LRRs (residues 20 to 41, 43 to 64, 65 to 86, and 87 to 108), followed by an incomplete LRR (residues 109 to 130) and an LRR cap domain (residues 131 to 146). LRR motifs are involved in the formation of protein-protein interactions (13); the TbLRTP LRRs are homologous to the SDS22+ subclass (Fig. 1C), although the second and fourth repeats start with Cys, a nonconsensus alteration. SDS22+ is an inhibitory subunit of protein phosphatase 1 required in mitotic metaphase/anaphase transition (6, 25). LRTP proteins also contain several Glu-rich acidic regions near the C terminus (Fig. 1B), and PEPCOIL (18) predicts that TbLRTP will form a coiled-coil (residues 200 to 250) (Fig. 1D). Outside of the N-terminal LRRs, TbLRTP and its homologues contain no similarity to other sequences currently in the databases.
|
-tubulin was retained within the cytoskeleton as expected (Fig. 2A). Approximately 40% of TbLRTP was associated with the particulate fraction, suggesting that a proportion is cytoskeletally associated. Immunofluorescence of NP-40-extracted trypanosomes using antibody to BBA4 antigen, which locates to the proximal end of both the mature basal body and the probasal body (45) (Fig. 2B), confirmed the close localization of TbLRTP to both the mature basal body and the probasal body, which is maintained throughout the cell cycle. In 1K1N cells, TbLRTP is juxtaposed distally to BBA4 (Fig. 2B, top). Upon basal body duplication, the TbLRTP signal was observed as a doublet with each unit in juxtaposition to a BBA4 signal (Fig. 2B and C). As the kinetoplast divides, the TbLRTP signal maintains its position relative to the BBA4 antigen (Fig. 2B and C). Further, detergent extraction removed the TbLRTP fraction that extends from the kinetoplast toward the nucleus. Therefore, TbLRTP is present both at the basal body region, where it is firmly anchored to the cytoskeleton, and in more nucleus-proximal regions, where it is less strongly cytoskeletally associated (see Fig. S1 in the supplemental material).
|
TbLRTP is required for the regulation of cell division.
To investigate TbLRTP function, overexpression and RNAi were used. Overexpression and RNAi of TbLRTP were confirmed by Western blotting (Fig. 3A) and achieved threefold overexpression and 
80% suppression by RNAi. A small increase in cell growth was observed in TbLRTP overexpressers (data not shown), while suppression correlated with decreased growth (Fig. 3B), suggesting that TbLRTP is an important factor in cell proliferation. Growth restoration at 5 days following RNAi induction was accompanied by increased expression of TbLRTP, indicating escape from RNAi (1, 41).
|
Cells overexpressing TbLRTP were increased in size and exhibited numerous nuclear and kinetoplastid abnormalities. By contrast, RNAi of TbLRTP resulted in reduced cell length (Fig. 3C). To determine whether these size alterations were due to modulation of a specific cellular structure, as observed for some gene products (10, 15), or an overall effect on cell volume, morphometric analysis was performed on cells in interphase, which were selected based on possessing a single nucleus and kinetoplast (see Fig. S2A for a schematic of trypanosome cellular parameters). The overall length of wild-type trypanosomes was 20.4 ± 3.7 µm, and the distance between the kinetoplast or the nucleus and the posterior end of the cell was 6.1 ± 1.4 or 9.2 ± 1.5 µm, respectively. TbLRTP overexpresser cells were longer, at 31.4 ± 8.1 µm, while the kinetoplast-posterior and nucleus-posterior distances also increased to 7.9 ± 3.6 and 12.0 ± 4.9 µm, respectively. By contrast, TbLRTP RNAi cells were shorter, at 14.1 ± 5.1 µm, and the kinetoplast-posterior and nucleus-posterior distances also decreased to 4.4 ± 2.5 and 7.4 ± 3.0 µm, respectively. We also measured flagellum and FAZ lengths in TbLRTP RNAi cells and overexpressers; these parameters correlate with the alterations in the distance between the kinetoplast and the cell posterior (data not shown). There is a direct correlation between flagellum length and cell size (15, 33, 40), and taken together, these data demonstrate that the sizes of the trypanosomes were altered globally by manipulation of TbLRTP expression without a specific change to any one region. Therefore, the mechanism by which TbLRTP affects cell size is distinct from that indicated by other reports of alterations to specific regions (10, 15, 33).
Trypanosome growth is not achieved simply by doubling of length during the cell cycle, as the positions of the nucleus and kinetoplast exhibit a high degree of coordinate movement and a relationship with overall cell extension. The inter-basal body distance (33) reflects the timing and extent of cell length, and the distances from the cell posterior to the old basal body and from the new basal body to the anterior remain constant during the cell cycle. To test if alterations in cell length in TbLRTP mutants were a result of defects arising during cytokinesis, TbLRTP mutant cell lines were analyzed by morphometry during cell division (Fig. 3D; see Fig. S2B in the supplemental material for a schematic of the cell cycle). In 2K1N cells, the distance from the cell posterior to the posterior kinetoplast was increased by overexpression of TbLRTP and was decreased by RNAi. As the cell cycle progressed, the effects of TbLRTP protein levels on cell length became more pronounced. In 2K2N cells, all of the parameters measured, with the exception of the distance between the posterior nucleus and posterior kinetoplast, were decreased in cells subjected to RNAi. By contrast, all of these parameters increased in the overexpressing mutants. The most pronounced effects are in the distance from the anterior of the cell to the anterior nucleus and the distance from the posterior kinetoplast to the posterior of the cell (Fig. 3D). This indicates that the distance from the posterior of the cell to the kinetoplast is related to TbLRTP expression levels.
TbLRTP is required for correct basal body replication and new flagellum biogenesis. The influence of TbLRTP on components of the cytoskeleton, i.e., microtubules, the basal body, and the PFR, was also examined. In overexpressers and RNAi cells, global microtubule structure was normal by immunofluorescence (Fig. 4) and electron microscopy (Fig. 5). However, immunostaining for the basal body showed that duplication and separation of the basal body were disrupted in TbLRTP-overexpressing and RNAi cells (Fig. 4). In some of the overexpressing cells, mitosis occurred in the absence of apparent kinetoplast division and basal body duplication, whereas RNAi resulted in additional basal bodies free in the cytoplasm.
|
|
29% of overexpressers and 14% of RNAi mutant cells analyzed exhibited abnormalities in the number of nuclei (Table 1, >2N, 0N, >2K, 0K, 2N1K). Similar aberrant nuclear numbers have been demonstrated to arise as a consequence of microtubule disruption, resulting in failure to accurately complete cytokinesis (10, 27, 33).
|
|
Analysis of TbLRTP RNAi mutant ultrastructure shows aberrant flagellar biogenesis. To determine the structure of the flagellar structures that accumulated in the TbLRTP mutant cells, transmission electron microscopy was performed. The subpellicular microtubule array, mature basal body, and flagellar axoneme appear normal in both the TbLRTP-overexpressing and RNAi cells. However, in the cytoplasm of the RNAi cells, intracellular axonemes and PFR-like structures have assembled (shown in transverse section in Fig. 5C and D and in longitudinal section in Fig. 5E and F). The axonemes of these structures are highly similar to those of wild-type trypanosomes, with the correct 9 + 2 flagellum axoneme and a paracrystalline PFR, but lack a delineating membrane. Hence, promiscuous flagellar initiation appears to take place in these cells, but the resulting structures are normal. A zone of exclusion of the normal ribosome-rich cytoplasm (Fig. 5C and F) surrounds the intracellular flagella, and remarkably, the flagella are also sometimes seen associated with four microtubules typical of the FAZ (Fig. 5D). Their assembly appears to occur from an apparently structurally normal basal body located within the cytoplasm (Fig. 5E).
An LRTP homologue is also present in Leishmania. Experimentally accessible stages of T. brucei are replicative forms, but in the related organism Leishmania, it is possible to study nondividing cell populations. L. major encodes an LRTP homologue (LmjF29.2210) that is 61% identical and 77% similar to the trypanosome protein. Anti-TbLRTP sera recognized a single band in L. mexicana promastigotes (designated LmLRTP), consistent with the predicted molecular mass derived from the gene sequence (53.8 kDa). Western blot analysis demonstrated that LmLRTP was not detectable in nonproliferative metacyclic promastigotes or slowly replicating axenic amastigotes (Fig. 6). These data suggest that LRTP is expressed mainly in rapidly proliferating cells.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mutations affecting basal body number have a corresponding effect on cell length and shape in Tetrahymena (23), Paramecium (35), and Chlamydomonas (37) spp. TbLRTP RNAi generates pleiotropic effects very similar to those observed in Chlamydomonas VFL1 mutants, although the two proteins are not orthologues (37). A recent analysis of the Chlamydomonas flagellum proteome did not identify an LRTP homologue (17), but a clear orthologue is present in the Chlamydomonas genome. In both T. brucei and Chlamydomonas, there are specialized microtubules that originate near the basal bodies and extend into the cell beneath the plasma membrane: four FAZ-associated microtubules in T. brucei and four rootlet microtubules in Chlamydomonas. These microtubules are involved in the spatial positioning of cellular organelles and the cytokinesis cleavage furrow, as well as in regulation of cell volume (7, 15, 33, 37). Analysis of TbLRTP mutants supports previous data demonstrating that the correct assembly of the new flagellum/FAZ is required for the completion of cytokinesis and the maintenance of cell size/polarity (15, 20, 33, 40).
The assembly of additional axonemes, PFRs, and FAZ microtubules in TbLRTP RNAi mutants supports a model of concomitant biosynthesis and suggests that assembly occurs from a common nucleation/docking site, most likely located at the basal body region (14). IFT52 from Chlamydomonas is involved in the formation of such docking sites and has a location similar to that of TbLRTP, suggesting that these two factors, while distinct at the sequence level, may function in the same or a related pathway (5). In trypanosomes the old flagellum acts as a template for assembly and growth of the new flagellum (20), and where there is more than one new flagellum, presumably the excess copies cannot be accommodated and are assembled in a nontemplated manner. The consequence of additional basal bodies likely affects positioning of the cytokinesis cleavage furrow, resulting in nonsymmetrical cell division and production of small cells.
The TbLRTP family is highly conserved throughout evolution, and homologues are present in protozoan and metazoan systems. Significantly, homologues are absent from the genomes of fungi, nematodes, and plants; given the earlier time of divergence of the trypanosome and metazoan lineages compared to the plant/metazoan separation, this distribution suggests secondary loss of LRTP from selected lineages and hence differences in the mechanisms of basal body duplication between those lineages retaining LRTP and those where it is absent, for example, between C. elegans, trypanosomes, and humans. Most significantly, the zebra fish homologue of TbLRTP, seahorse, has been reported to be involved in ciliar function (38) and, further, was recently implicated as having a role in the development of polycystic kidney disease, although detailed functional data were not available from that analysis (38). The data reported here provide a function for the LRTP family of proteins in the modulation of basal body functions and by inference implicate that process in human disease.
|
ACKNOWLEDGMENTS |
|---|
This work was funded by program grants from the Wellcome Trust (to M.C.F., D.F.S., and K.G.), and this support is gratefully acknowledged.
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/.
Present address: Department of Virology, The Wright-Fleming Institute, Faculty of Medicine, Imperial College, London, United Kingdom.
Present address: School for Health (Medicine), University of Durham, Stockton-on-Tees, United Kingdom.
¶ Present address: Department of Cell Biology, Ludwig Institute for Cancer Research, Yale University, New Haven CT 00520-8002.
|| Present address: Department of Biology, University of York, York, United Kingdom.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
3. Bates, P. A. 1994. Complete developmental cycle of Leishmania mexicana in axenic culture. Parasitology 108:1-9.
4. Beisson, J., and M. Wright. 2003. Basal body/centriole assembly and continuity. Curr. Opin. Cell Biol. 15:96-104.[CrossRef][Medline]
5. Deane, J. A., D. G. Cole, E. S. Seeley, D. R. Diener, and J. L. Rosenbaum. 2001. Localization of intraflagellar transport protein IFT52 identifies basal body transitional fibers as the docking site for IFT particles. Curr. Biol. 11:1586-1590.[CrossRef][Medline]
6. Dinischiotu, A., M. Beullens, W. Stalmans, and M. Bollen. 1997. Identification of sds22 as an inhibitory subunit of protein phosphatase 1 in rat liver nuclei. FEBS Lett. 402:141-144.[CrossRef][Medline]
7. Ehler, L. L., J. A. Holmes, and S. K. Dutcher. 1995. Loss of spatial control of the mitotic spindle apparatus in a Chlamydomonas reinhardtii mutant strain lacking basal bodies. Genetics 141:945-960.[Abstract]
8. Gull, K. 1999. The cytoskeleton of trypanosomatid parasites. Annu. Rev. Microbiol. 53:629-655.[CrossRef][Medline]
9. Gull, K. 2003. Host-parasite interactions and trypanosome morphogenesis: a flagellar pocketful of goodies. Curr. Opin. Microbiol. 4:365-370.
10. Hendriks, E. F., D. R. Robinson, M. Hinkins, and K. R. Matthews. 2001. A novel CCCH protein which modulates differentiation of Trypanosoma brucei to its procyclic form. EMBO J. 20:6700-6711.[CrossRef][Medline]
11. Hill, K. L. 2003. Biology and mechanism of trypanosome cell motility. Eukaryot. Cell 2:200-208.
12. Hutchings, N. R., J. E. Donelson, and K. L. Hill. 2002. Trypanin is a cytoskeletal linker protein and is required for cell motility in African trypanosomes. J. Cell Biol. 156:867-877.
13. Kobe, B., and A. V. Kajava. 2001. The leucine-rich repeat as a protein recognition motif. Curr. Opin. Struct. Biol. 11:725-732.[CrossRef][Medline]
14. Kohl, L., T. Sherwin, and K. Gull. 1999. Assembly of the paraflagellar rod and the flagellum attachment zone complex during the Trypanosoma brucei cell cycle. J. Eukaryot. Microbiol. 46:105-109.[Medline]
15. Kohl, L., D. Robinson, and P. Bastin. 2003. Novel roles for the flagellum in cell morphogenesis and cytokinesis of trypanosomes. EMBO J. 22:5336-5346.[CrossRef][Medline]
16. LaCount, D. J., S. Bruse, K. L. Hill, and J. E. Donelson. 2000. Double-stranded RNA interference in Trypanosoma brucei using head-to-head promoters. Mol. Biochem. Parasitol. 111:67-76.[CrossRef][Medline]
17. Li, J. B., J. M. Gerdes, C. J. Haycraft, Y. Fan, T. M. Teslovich, H. May-Simera, H. Li, O. E. Blacque, L. Li, C. C. Leitch, R. A. Lewis, J. S. Green, P. S. Parfrey, M. R. Leroux, W. S. Davidson, P. L. Beales, L. M. Guay-Woodford, B. K. Yoder, G. D. Stormo, N. Katsanis, and S. K. Dutcher. 2004. Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene. Cell 117:541-552.[CrossRef][Medline]
18. Lupas, A., M. Van Dyke, and J. Stock. 1991. Predicting coiled coils from protein sequences. Science 252:1162-1164.[CrossRef][Medline]
19. Marshall, W. F., Y. Vucica, and J. L. Rosenbaum. 2001. Kinetics and regulation of de novo centriole assembly. Implications for the mechanism of centriole duplication. Curr. Biol. 11:308-317.[CrossRef][Medline]
20. Moreira-Leite, F. F., T. Sherwin, L. Kohl, and K. Gull. 2001. A trypanosome structure involved in transmitting cytoplasmic information during cell division. Science 294:610-612.
21. Morgan, G. W., B. S. Hall, P. W. Denny, M. Carrington, and M. C. Field. 2002. The endocytic apparatus of the kinetoplastida. Part I. A dynamic system for nutrition and evasion of host defences. Trends Parasitol. 18:491-496.[CrossRef][Medline]
22. Morgan, G. W., D. Goulding, and M. C. Field. 2004. The single dynamin-like protein of Trypanosoma brucei regulates mitochondrial division and is not required for endocytosis. J. Biol. Chem. 279:10692-10701.
23. Nanney, D. L., and M. C. Chow. 1974. Basal body homeostasis in Tetrahymena. Am. Nat. 108:125-129.[CrossRef]
24. Ogbadoyi, E. O., D. R. Robinson, and K. Gull. 2003. A high-order trans-membrane structural linkage is responsible for mitochondrial genome positioning and segregation by flagellar basal bodies in trypanosomes. Mol. Biol. Cell 14:1769-1779.
25. Ohkura, H., and M. Yanagida. 1991. S. pombe gene sds22+ essential for a mid-mitotic transition encodes a leucine-rich repeat protein that positively modulates protein phosphatase-1. Cell 64:149-157.[CrossRef][Medline]
26. Pal, A., B. S. Hall, D. N. Nesbeth, H. I. Field, and M. C. Field. 2002. Differential endocytic functions of Trypanosoma brucei Rab5 isoforms reveal a glycosylphosphatidylinositol-specific endosomal pathway. J. Biol. Chem. 277:9529-9539.
27. Ploubidou, A., D. R. Robinson, R. C. Docherty, E. O. Ogbadoyi, and K. Gull. 1999. Evidence for novel cell cycle checkpoints in trypanosomes: kinetoplast segregation and cytokinesis in the absence of mitosis. J. Cell Sci. 112:4641-4650.[Abstract]
28. Porter, M. E., and W. S. Sale. 2000. The 9 + 2 axoneme anchors multiple inner arm dyneins and a network of kinases and phosphatases that control motility. J. Cell Biol. 151:37-42.
29. Price, H. P., M. R. Menon, C. Panethymitaki, D. Goulding, P. G. McKean, and D. F. Smith. 2003. Myristoyl-CoA:protein N-myristoyltransferase, an essential enzyme and potential drug target in kinetoplastid parasites. J. Biol. Chem. 278:7206-7214.
30. Redmond, S., J. Vadivelu, and M. C. Field. 2003. RNAit: an automated web-based tool for the selection of RNAi targets in Trypanosoma brucei. Mol. Biochem. Parasitol. 128:115-118.[CrossRef][Medline]
31. Robinson, D., P. Beattie, T. Sherwin, and K. Gull. 1991. Microtubules, tubulin, and microtubule-associated proteins of trypanosomes. Methods Enzymol. 196:285-299.[Medline]
32. Robinson, D. R., and K. Gull. 1991. Basal body movements as a mechanism for mitochondrial genome segregation in the trypanosome cell cycle. Nature 352:731-733.[CrossRef][Medline]
33. Robinson, D. R., T. Sherwin, A. Ploubidou, E. H. Byard, and K. Gull. 1995. Microtubule polarity and dynamics in the control of organelle positioning, segregation, and cytokinesis in the trypanosome cell cycle. J. Cell Biol. 128:1163-1172.
34. Rosenbaum, J. L., and G. B. Witman. 2002. Intraflagellar transport. Nat. Rev. Mol. Cell Biol. 3:813-825.[CrossRef][Medline]
35. Ruiz, F., N. Garreau de Loubresse, and J. Beisson. 1987. A mutation affecting basal body duplication and cell shape in Paramecium. J. Cell Biol. 104:417-430.
36. Sherwin, T., and K. Gull. 1989. The cell division cycle of Trypanosoma brucei brucei: timing of event markers and cytoskeletal modulations. Philos. Trans. R. Soc. Lond. B 323:573-588.[Medline]
37. Silflow, C. D., M. LaVoie, L. W. Tam, S. Tousey, M. Sanders, W. Wu, M. Borodovsky, and P. A. Lefebvre. 2001. Vfl1 protein in Chlamydomonas localizes in a rotationally asymmetric pattern at the distal ends of the basal bodies. J. Cell Biol. 153:63-74.
38. Sun, Z., A. Amsterdam, G. J. Pazour, D. Cole, M. S. Miller, and N. Hopkins. 2004. A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney. Development 131:4085-4093.
39. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.
40. Tyler, K. M., K. R. Matthews, and K. Gull. 2001. Anisomorphic cell division by African trypanosomes. Protist 152:367-378.[Medline]
41. Wang, Z., J. C. Morris, M. E. Drew, and P. T. Englund. 2000. Inhibition of Trypanosoma brucei gene expression by RNA interference using an integratable vector with opposing T7 promoters. J. Biol. Chem. 275:40174-40179.
42. Wirtz, E., S. Leal, C. Ochatt, and G. A. Cross. 1999. A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol. Biochem. Parasitol. 99:89-101.[CrossRef][Medline]
43. Woods, A., T. Sherwin, R. Sasse, T. H. MacRae, A. J. Baines, and K. Gull. 1989. Definition of individual components within the cytoskeleton of Trypanosoma brucei by a library of monoclonal antibodies. J. Cell Sci. 93:491-500.
44. Woodward, R., and K. Gull. 1990. Timing of nuclear and kinetoplast DNA replication and early morphological events in the cell cycle of Trypanosoma brucei. J. Cell Sci. 95:49-57.
45. Woodward, R., M. J. Carden, and K. Gull. 1995. Immunological characterization of cytoskeletal proteins associated with the basal body, axoneme and flagellum attachment zone of Trypanosoma brucei. Parasitology 111:77-85.
46. Xue, J. C., and E. Goldberg. 2000. Identification of a novel testis-specific leucine-rich protein in humans and mice. Biol. Reprod. 62:1278-1284.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
