Previous Article | Next Article ![]()
Molecular and Cellular Biology, January 2006, p. 169-181, Vol. 26, No. 1
0270-7306/06/$08.00+0 doi:10.1128/MCB.26.1.169-181.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Svetlana Zhenilo,2,
Sergey Salozhin,2
Daisuke Yamada,1
Egor Prokhortchouk,2* and
Pierre-Antoine Defossez1*
Institut Curie, CNRS UMR218, Paris 75248, France,1 Center "Bioengineering," Russian Academy of Sciences, Prospekt 60-let Oktyabrya 7-1, 117312 Moscow, Russia2
Received 8 July 2005/ Returned for modification 16 August 2005/ Accepted 12 October 2005
|
|
|---|
|
|
|---|
The methylation of promoter regions causes a strong and heritable transcriptional inhibition of the corresponding genes (3). An explanation for this phenomenon came with the milestone discovery that some proteins recognize the methylation marks and shut down transcription (21, 35). These proteins are characterized by a specific affinity for methylated versus nonmethylated CpGs and are collectively termed MBPs (methyl-DNA-binding proteins). In vertebrates, proteins containing the MBD (methyl-DNA-binding domain) constitute a large and well-studied family of proteins that bind single methylated CpGs (16). The MBD is not the only protein fold that can permit recognition of methylated DNA; for instance, the protein Kaiso uses a three-zinc-finger motif to bind methylated CGCGs (39). The zinc fingers of Kaiso have a dual specificity in vitro, as they can bind either DNA sequences containing methylated CGCG or the consensus Kaiso binding site (KBS), TCCTGCNA (8). Experiments in Xenopus laevis have shown that Kaiso does bind both classes of sequence elements in vivo. Indeed, it binds gene promoters containing the KBS and transmits both canonical and noncanonical Wnt signals (25, 38), but it also binds a large number of methylated promoters to repress transcription, especially before the mid-blastula transition (43). In human cells, Kaiso also binds some methylated promoters (46), as well as some KBS-containing promoters (41, 44).
DNA methylation is an essential phenomenon (29), yet none of the MBPs identified so far are required for viability (14, 15, 47), raising the possibility that other MBPs remain to be found. In an attempt to discover new MBPs, we performed a BLAST search on the human genome for proteins containing Kaiso-like zinc fingers and identified two such proteins: ZBTB4 and ZBTB38. We report that both proteins bind methylated DNA in vitro and in vivo. Unlike Kaiso, ZBTB4 and ZBTB38 can bind sequences containing a single methylated CpG. Ectopic expression in mouse cells shows specific enrichment of both proteins to highly methylated sequences. We also observed that ZBTB4 and ZBTB38 seem to be present at the methylated paternal allele of the H19/Igf2 differentially methylated region. We next showed that ZBTB4 and ZBTB38 are methyl-dependent transcriptional repressors. Finally, we determined their expression pattern and found that both genes are highly expressed in the brain.
|
|
|---|
Gel retardation assay.
Zinc finger domains ranged from residues 455 to 639 for Kaiso, 268 to 460 for ZBTB4, and 418 to 612 for ZBTB38. Protein fragments were produced in vitro using TNT rabbit reticulocyte lysate (Promega) and pCITE-4a (Novagen) constructions as DNA templates. A fragment of the lacZ gene was amplified with primers GF048 and GF050 and was used as a probe. The sequence of this fragment is TAATGCGATTAGTGAATTCGCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCG TAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGG CCACGGCGCTAATCACGACGCGCGGCATTATCACATAATGA. Methylation was carried out using SssI (NEB) according to the manufacturer's instructions. Four pmol of DNA probes was labeled using polynucleotide kinase (NEB) and 20 µCi [
-32P]ATP. Assembly of complexes was carried out in 25 µl by adding 12.5 µl 2x binding buffer (50 mM HEPES, pH 7.5, 200 mM KCl, 2 mM EDTA, pH 8.0, 20 mM MgCl2, 0.2% NP-40, 2 mM dithiothreitol, 10% glycerol), 1 µg bovine serum albumin, 1.2 µg yeast genomic DNA, 3 µl lysate, and 0.2 pmol (lacZ) or 0.08 pmol (KBS) of labeled probe. Mixes were incubated for 1 h at 4°C, and reactions were run on a 6% polyacrylamide-Tris-acetate-EDTA gel at 10 V/cm for 4 h. When used, competing double-stranded oligonucleotides were added to a final concentration of 3.3 nM (1x) or 6.6 nM (2x) when using KBS as a probe and 0.08 µM (10x) or 0.8 µM (100x) when using lacZ. Single-stranded oligonucleotides corresponding to nonmethylated CpG (GF88/GF89), hemimethylated CpG (GF88/GF91), fully methylated CpG (GF90/GF91), methylated CpA (GF110/GF109), methylated CCTGG (GF117/GF118), mutated matrilysin sequence (GF134/GF135), or wild-type matrilysin sequence (GF128/GF129) were boiled in H2O-50 mM NaCl and then annealed by cooling slowly.
Primers. Primers used are listed in Table 1.
|
View this table: [in a new window] |
TABLE 1. Primers
|
Microscopy and immunofluorescence. Twenty-four hours after transfection, GFP-expressing cells were washed with phosphate-buffered saline (PBS), fixed for 10 min at room temperature with 2% paraformaldehyde (PFA), permeabilized for 5 min at 4°C in PBS-0.5% Triton X-100, stained for 3 min with 0.3 µg/ml 4',6'-diamidino-2-phenylindole (DAPI) in PBS, and mounted in Vectashield (Vector Laboratories Inc.). Images were acquired on a Zeiss LSM-510 microscope.
Yeast two-hybrid assay.
Interactions between zinc fingers were tested by a GAL4-based system in Saccharomyces cerevisiae. Baits and prey were cloned, respectively, into pBGDU(C)1 (20) and pACT3.1 (45). Bait and prey plasmids were introduced, respectively, in strains PJ69-4a and PJ69-4
(20). Transformants were crossed on yeast extract-peptone-dextrose, and diploids were selected on plates, then grown in liquid medium to saturation, and 10-µl drops were spotted on selective synthetic complete medium without histidine, supplemented with 1 mM 3-amino-triazole, and on nonselective synthetic complete medium without leucine and uracil. Plates were then incubated at 30°C for 3 days before scoring.
Methylation-dependent repression assay. A repression test was performed as described previously (39). The lower concentration of the effector plasmid was equal to 50 ng, and the higher concentration was 125 ng.
Chromatin immunoprecipitation assay. We crossed female C57 Black mice with male Sd7 mice (13). F1 animals were sacrificed, and the brains were dissected. Approximately 5 milligrams of tissue was used for each immunoprecipitation. Chromatin was prepared on brain extracts as described on the Upstate website (http://www.upstate.com). Chromatin was immunoprecipitated overnight at 4°C on a rotating platform with 20 µg anti-CTCF antibodies (Upstate reference 06-917), 100 µg anti-Kaiso (39), anti-ZBTB4, or anti-ZBTB38 serum. After de-cross-linking, the DNA was amplified by PCR with primers DMD56/1 and DMD78/1 under the following conditions: 95°C for 5 min and 25 cycles of 95°C for 30 s, 64°C for 30 s, and 72°C for 30 s. We used a polymorphism at position 57 in the PCR product. The sequence in the Mus musculus domesticus strain is GGCC (which creates an HaeIII site), whereas it is GGAC in M. musculus spretus. The PCR products were fractionated on a 2% agarose gel. The bands were excised, and the DNA was purified, then digested with HaeIII, and again run on a 2% agarose gel which was stained with ethidium bromide (0.5 µg/ml in running buffer). The larger, uncut band represents product originated from the paternal allele, and the shorter product comes from the maternal allele. The following controls were carried out in parallel: immunoprecipitation with no antibodies, immunoprecipitation with no specific antibodies (ZBTB4 preimmune serum), and PCR in the absence of template.
Northern blotting and quantitative reverse transcription-PCR (RT-PCR). A premade mouse tissue Northern blot assay was purchased from Sigma. The full-length mouse ZBTB4 cDNA was used to probe the membrane. The blot was rehybridized with a GAPDH cDNA. Mouse cDNAs prepared from different tissues were purchased from Clontech. ZBTB4 cDNAs were amplified with the primers PAD184 and PAD185, each on a different side of an intron. Quantitation was done by real-time PCR on a LightCycler (Roche). The housekeeping gene used as a reference was RPS29, amplified with primers PAD190 and PAD191. The amount of ZBTB4 cDNA was normalized to the amount of the RPS29 cDNA. The result of an experiment performed in duplicate is shown below in Fig. 7C. It was confirmed in two independent repeats.
![]() View larger version (54K): [in a new window] |
FIG. 7. ZBTB4 is expressed in several adult tissues, but not in embryos. A. Northern blotting on RNAs extracted from adult mouse tissues. Top panel: the blot was hybridized with a full-length cDNA of ZBTB4. Lower panel: the blot was hybridized with a standardizing cDNA of GAPDH. B. RT-PCR on RNAs extracted from the indicated adult or embryonic tissues. The amount of ZBTB4 mRNA was quantified by real-time PCR after reverse transcription. It was normalized to the amount of RPS29 signal.
|
|
|
|---|
![]() View larger version (30K): [in a new window] |
FIG. 1. The human proteins ZBTB4 and ZBTB38 contain Kaiso-like zinc fingers. A. Alignment of a region of human Kaiso with ZBTB4 and ZBTB38. The three zinc fingers are boxed. Residues that are identical between the three proteins are indicated by asterisks. B. Organization of human Kaiso, ZBTB4, and ZBTB38. The proteins were centered on the three conserved zinc fingers. The region used for in vitro DNA-binding assays is underlined. The BTB/POZ domain of ZBTB4 contains an insertion (wavy lines). C. Phylogenetic tree for the Kaiso, ZBTB4, and ZBTB38 gene families. Accession numbers for all aligned genes are available on request.
|
-helix 3 and ß-sheet 4 and might not alter the dimerization surface. There is little sequence identity between Kaiso, ZBTB4, and ZBTB38 outside of the BTB/POZ domain and the three zinc fingers mentioned above. ZBTB4 and ZBTB38 contain additional zinc fingers, but those are not similar to the methyl-DNA-binding motif of Kaiso. Finally, motif prediction algorithms also identified two proline-rich domains and one glutamate-rich domain in ZBTB4. Examination of the available genome sequences showed that all vertebrates contain Kaiso and at least one gene orthologous to ZBTB4 or ZBTB38. For example, Fugu rubripes seems to have only a ZBTB4 orthologue. As the genome sequences of Bos taurus, Canis familiaris, and Gallus gallus are not yet complete, it is possible that additional genes of this family are present in those organisms. In accordance with the identity scores, the phylogenetic tree built on the Kaiso-like zinc fingers shows that Kaiso diverged earlier than the separation of ZBTB4 and ZBTB38 (Fig. 1C). The phylogenetic tree based on comparison of the full-length proteins confirmed this trend (not shown).
Kaiso, ZBTB4, and ZBTB38 bind methylated DNA in vitro. A portion of Kaiso containing the three zinc fingers (amino acids 455 to 639 in the human protein) binds methylated DNA in vitro (8). We tested whether the homologous regions in ZBTB4 and ZBTB38 (outlined in Fig. 1B) also recognize methylated DNA. We synthesized in vitro the conserved zinc fingers of Kaiso, ZBTB4, and ZBTB38. We then tested the affinity of these proteins for methylated DNA by gel retardation assay (Fig. 2A). The probe was a 161-bp CG-rich fragment from the lacZ gene that was either unmethylated or fully methylated in vitro by the bacterial methyltransferase SssI. The zinc fingers of Kaiso, ZBTB4, and ZBTB38 all failed to bind the nonmethylated DNA probe. In contrast, all three recognized the methylated probe. Multiple complexes were observed. This was likely due to the fact that each molecule of probe contains several methylated CpGs: the bands of increasing molecular weight probably correspond to the DNA probe complexed to an increasing number of protein molecules. From these results we conclude that the Kaiso-like zinc fingers of ZBTB4 and ZBTB38 have a specific affinity for methylated DNA.
![]() View larger version (87K): [in a new window] |
FIG. 2. ZBTB4 and ZBTB38 bind methylated CpGs in vitro. A. Left panel: the zinc fingers of human Kaiso, ZBTB4, and ZBTB38 were expressed in rabbit reticulocyte lysate in the presence of radioactive methionine and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Molecular masses in kilodaltons are indicated. The faster-migrating bands arise from internal initiation. The proteins were then incubated with a labeled 161-bp probe containing multiple CG, CGCG, and CGNCG sequences and resolved on a 6% polyacrylamide gel. The probe was either left unmethylated or methylated in vitro with SssI. Kaiso, ZBTB4, and ZBTB38 form complexes only with the methylated probe. The different bands correspond to complexes involving different numbers of proteins bound per DNA molecule. B. Gel retardation assay with a KBS. Kaiso and ZBTB4 bind the KBS, but ZBTB38 does not. The complex between ZBTB4 and the KBS was competed by unlabeled KBS or by equal molar amounts (onefold and twofold concentration relative to the probe) of an oligonucleotide containing a single methylated CpG. C. Complexes between the zinc fingers of ZBTB4 and the methylated probe were assembled in the presence of oligonucleotides containing the indicated sequences (10-fold and 100-fold molar excess relative to the probe). The oligonucleotide containing a single symmetrically methylated CpG efficiently displaces the complex, whereas an unmethylated oligonucleotide does not. A hemimethylated oligonucleotide has an intermediate effect. D. Results of an experiment carried out with ZBTB38 as for panel C. Only the oligonucleotide containing a single symmetrically methylated CpG displaces the complex.
|
Next we examined more precisely the capacity of ZBTB4 and ZBTB38 to bind methylated DNA. We carried out gel retardation assays with the methylated probe, in the presence of excess unlabeled competitor oligonucleotides bearing different methylated sequences. A series of oligonucleotides contained a single CpG that was unmethylated, hemimethylated, or symmetrically methylated. We also tested oligonucleotides containing a single methylated CpA or a single methylated CCTGG, which have been shown to be present in small amounts in human cells (40) (32). ZBTB4 and ZBTB38 did not bind unmethylated oligonucleotides, nor oligonucleotides containing methylated CpA or CCTGG (Fig. 2C and D). In contrast, binding of ZBTB4 and ZBTB38 to the labeled probe was efficiently competed by oligonucleotides containing a single symmetrically methylated CpG. In addition, ZBTB4 showed some affinity for hemimethylated CpGs, yet this was much lower than for symmetrically methylated CpG, since the hemimethylated competitor did not fully displace the complexes, even at 100-fold excess. These data show that ZBTB4 and ZBTB38 bind methylated CpGs, but no other methylated sequence. They also point to an important difference between Kaiso and its relatives, as Kaiso requires at least two consecutive methylated CpGs for binding (39), while ZBTB4 and ZBTB38 can both bind single methylated CpGs.
Ectopically expressed ZBTB4 and ZBTB38 are targeted to regions containing methylated DNA. In the nucleus of mouse cells, the pericentric regions of different chromosomes aggregate to form structures called chromocenters (27). The chromocenters contain the major satellite repeats, which are heavily methylated. In addition, these structures are readily detectable by microscopy, as they stain very brightly with DAPI. We asked whether ZBTB4 and ZBTB38, like MeCP2 (28) and MBD1 (22), would localize to the chromocenters when expressed in mouse cells.
We transfected NIH 3T3 cells with cDNAs encoding human ZBTB4 or ZBTB38 and performed immunofluorescence with antibodies specific for these proteins (Fig. 3A). In both cases, we detected a strong signal colocalizing with the chromocenters. There was little signal in the rest of the nucleus, suggesting that most transfected ZBTB4 or ZBTB38 is recruited to the chromocenters of mouse cells. We then constructed plasmids expressing fusions of ZBTB4 and ZBTB38 to the red fluorescent protein mRFP1 (4). We transfected the constructs in NIH 3T3 cells and observed a clear colocalization of the red fluorescence with the DAPI-bright chromocenters (Fig. 3B). This proves that the fluorescent tag does not interfere with the recruitment of the proteins to methylated DNA. Next we tested whether the three zinc fingers that bind methylated DNA in vitro could direct the proteins to the methylated chromocenters. We fused the Kaiso-like zinc fingers of ZBTB4 and ZBTB38 to mRFP1 and, again, we observed foci of red fluorescence that colocalized with the DAPI-dense chromocenters (Fig. 3C). This proves that the Kaiso-like zinc fingers are sufficient for recruitment to the chromocenters. For comparison purposes, we also transfected NIH 3T3 cells with a plasmid expressing human Kaiso fused to GFP (Fig. 3C). We observed two types of motifs: in about half of the cells the nucleus showed a diffuse GFP staining with a few bright dots. In the rest of the cells the GFP signal was present in the whole nucleus with a faint enrichment at the chromocenters. The mouse major satellite repeats do not contain the sequence CGCG; therefore, it seems unlikely that Kaiso is recruited to the chromocenters through direct binding to methylated DNA. Even though we cannot fully explain why there was an enrichment to the chromocenters in some cells, these data support the fact that Kaiso has a different in vivo specificity from ZBTB4 and ZBTB38.
![]() View larger version (40K): [in a new window] |
FIG. 3. ZBTB4 and ZBTB38 are recruited to methylated DNA in cells. A. Characterization of the antibodies directed against ZBTB4 and ZBTB38. NIH 3T3 cells (which do not detectably express ZBTB4 or ZBTB38) were transfected with the indicated human cDNAs, used for immunofluorescence, and counterstained with DAPI. Images were taken at 100x magnification. Nontransfected cells show no detectable signal. B. RFP-ZBTB4 shows the same localization pattern as ZBTB4 and is recruited to the chromocenters. 3T3 cells were transfected with an expression vector encoding a fusion of mRFP1 to ZBTB4 and then used for immunofluorescence. The red fluorescence colocalizes with the green signal observed after immunofluorescence with anti-ZBTB4 serum and with the DAPI-dense chromocenters (in blue). Cells treated with the preimmune serum (PI) show no green signal. RFP-ZBTB38, like ZBTB38, is also recruited to the chromocenters. C. The localization of GFP-Kaiso in the nucleus of transfected mouse cells is different from that of ZBTB4 or ZBTB38. The zinc fingers of ZBTB4 and ZBTB38 are sufficient for recruitment to the chromocenters. 3T3 cells were transfected with plasmids encoding the indicated fusions of fluorescent proteins to full-length Kaiso, ZBTB4, and ZBTB38 or to the zinc fingers of ZBTB4 and ZBTB38. D. ZBTB4 and ZBTB38 are removed from the chromocenters in a majority of methylation-deficient cells. The fluorescent fusion proteins were expressed in p53/ Dnmt1/ mouse embryo fibroblasts. One hundred twenty cells were scored for total loss (left column) or partial loss (right column) of signal colocalizing with the chromocenters. Both ZBTB4 and ZBTB38 colocalize with the chromocenters in 100% of control p53/ cells (not shown).
|
Endogenous ZBTB4 and ZBTB38 bind methylated DNA in vivo. We next asked whether the endogenous ZBTB4 and ZBTB38 proteins would bind a specific methylated locus. The parental origin of imprinted genes determines their methylation status and consequently their level of expression (11). The H19/Igf2 locus on mouse chromosome 7 contains two reciprocally imprinted genes whose expression depends on a differentially methylated region (DMR) methylated only on the paternal allele. To be able to distinguish alleles, we crossed female M. musculus domesticus mice to male Sd7 mice (13) (an M. musculus domesticus strain containing the distal portion of Mus spretus chromosome 7 [a gift from Wolf Reik]). We first mapped single-nucleotide polymorphisms within the part of the DMR that had the highest density of CpGs and identified a single-nucleotide polymorphism that creates an HaeIII restriction site in the M. musculus domesticus strain (Fig. 4A). We isolated chromatin from the brain of hybrid mice and then immunoprecipitated the protein-DNA complexes with antibodies directed to CTCF, Kaiso, ZBTB4, and ZBTB38. We next performed PCR on the immunoprecipitated DNA with primers that amplify the DMR. The resulting product was digested with HaeIII and analyzed on a gel (Fig. 4B). CTCF is known to bind the unmethylated maternal DMR. As expected, the CTCF antibody precipitated DNA of maternal origin. In contrast, an antiserum directed against Kaiso precipitated mostly paternal DNA. The antisera directed against ZBTB4 and ZBTB38 both precipitated the methylated paternal DMR but not the unmethylated maternal DMR. It is presently unknown if the binding of ZBTB4 and ZBTB38 to the methylated allele influences the expression of H19 and Igf2. Nevertheless, this result suggests that ZBTB4 and ZBTB38, like Kaiso, bind methylated DNA in vivo.
![]() View larger version (27K): [in a new window] |
FIG. 4. ZBTB4 and ZBTB38 bind the methylated allele of the H19/Igf2 DMR. A. Schematic showing the structure of the imprinted locus. The paternal allele of the DMR is fully methylated (black boxes), whereas the maternal allele is unmethylated (white boxes) and contains an HaeIII restriction site. B. Chromatin immunoprecipitations using the indicated antibodies were performed on mouse brain extracts as indicated in the text. Top panel: the immunoprecipitated DNA was amplified with primers that amplify both alleles. Bottom: the PCR products seen above were digested with HaeIII to identify the parental origin of the amplified DNA. CTCF interacts predominantly with the maternal unmethylated allele, whereas ZBTB4 and ZBTB38 interact mostly with the paternal methylated allele. Input, 0.5% of the input chromatin.
|
![]() View larger version (27K): [in a new window] |
FIG. 5. ZBTB4 and ZBTB38 interact with each other, but not with Kaiso or p120 catenin. A. Kaiso, but not ZBTB4 or ZBTB38, interacts with p120-catenin. B. The zinc finger domain of ZBTB4 and ZBTB38 can homo- and heterodimerize. The indicated proteins or protein domains were fused to the Gal4 DNA-binding domain (DBD) or activation domain (AD) and introduced in the reporter strain. The transformed cells were spotted on control medium (selecting for both plasmids) or on selective medium (selecting for the interaction between the proteins). C. ZBTB4 and ZBTB38 form dots in transfected HeLa cells. Some of the dots show clear colocalization, whereas others seem to contain only ZBTB38.
|
ZBTB4 and ZBTB38 are methyl-dependent transcriptional repressors. Since Kaiso and several other BTB/POZ zinc finger proteins are transcriptional repressors (6), we set out to determine whether ZBTB4 and ZBTB38 were repressors and whether repression was specific to methylated DNA. We used an assay in which ZBTB4 and ZBTB38 expression constructs were cotransfected with methylated or nonmethylated reporter plasmids. The reporter gene used was luciferase expressed from a simian virus 40 promoter, in a plasmid that contains 48 CGs and 11 CGCGs. Since the Mbd2 protein is abundant in cells and strongly represses the transcription of methylated reporter genes, we used Mbd2/ cells, in which methylated templates maintain a detectable level of expression (15).
The different expression constructs were cotransfected along with the methylated and the unmethylated reporter, and the ratio of these values was plotted. In the absence of exogenous Kaiso, ZBTB4, or ZBTB38, the activity of the methylated reporter was 25% that of the nonmethylated reporter (Fig. 6A). When increasing amounts of Kaiso expression vectors were cotransfected, this ratio fell to 12% and 6%, reflecting the fact that Kaiso represses transcription of the methylated plasmid. Upon transfection of ZBTB4, the methylated plasmid had less than 1% of the activity of the unmethylated plasmid cotransfected with the same amount of ZBTB4. This proves that ZBTB4 is a potent repressor of the methylated reporter. ZBTB38 behaved similarly to Kaiso: cotransfection with a methylated plasmid reduced the activity to 6% of control values. From these results we conclude that ZBTB4 and ZBTB38 are methyl-dependent transcriptional repressors.
![]() View larger version (20K): [in a new window] |
FIG. 6. ZBTB4 and ZBTB38 repress transcription in vivo in a methyl-CpG-dependent manner. A. Methyl-CpG-dependent repression by Kaiso, ZBTB4, and ZBTB38. The protein expression constructs (lower concentration [gray bars] and higher concentration [shadowed bars]) were cotransfected with a simian virus 40-luciferase reporter into Mbd2/ mouse cells. The percent activity of the methylated plasmid is plotted [(methylated reporter expression)/(nonmethylated reporter expression) x100]. Results are the averages of at least three experiments. B. Subcellular localization of the constructs used in the deletion study. C. The Kaiso-like zinc fingers of ZBTB4 are required for repression. The indicated truncated derivatives of ZBTB4 were transfected as for panel A. D. The BTB/POZ domain and Kaiso-like zinc fingers of ZBTB38 are required for repression. The experiment was performed as for panel C.
|
ZBTB4 and ZBTB38 have different expression patterns. The expression profile of Zenon, the rat homologue of ZBTB38, has been described in detail (24). The gene is transcribed in the brain and in neuroendocrine tissues. We investigated the expression pattern of ZBTB4 in mouse tissues. Northern blotting on adult mouse tissues revealed four species of transcripts with estimated sizes of 5.5, 6.0, 6.7, and 8.3 kb (Fig. 7A), which likely arise by alternative splicing of the six predicted exons of mouse ZBTB4. Transcripts were detected in all tissues, with high expression levels in the brain, lung, kidney, muscle, and heart, an intermediate level in placenta, liver, spleen, and thymus, and lowest expression in the testis. We also performed RT-PCR analysis on cDNAs from mouse tissues (Fig. 7B). For this we used a primer pair that spans an intron and that amplifies the cDNAs containing the zinc finger region. The results obtained on cDNAs from adult tissues were in good general agreement with the Northern blot assay, except for the muscle where the amount of transcripts is significantly higher when detected by Northern blotting. A possible explanation may be that some splice variants are not amplified by the primer pair we chose. In addition, RT-PCR revealed that transcripts were undetectable at the four embryonic stages that we tested. To get more precise information on the cell types that express ZBTB4 in the central nervous system, we performed in situ hybridization on mouse brain sections (Fig. 8). We observed staining in many areas which corresponded to neuronal populations but were not limited to a single class of neurotransmitters. We did not detect ZBTB4 expression in glial cell populations. The amount of ZBTB4 messenger was highest in the hippocampus, a region that also expresses Mbd1, Mbd2, and MeCP2 (23). Intense staining was also seen in several structures involved in olfaction: the olfactory bulb, piriform cortex, and habenular nuclei. ZBTB4 was also expressed in other specific areas, including the arcuate nuclei, the motor nuclei of the brainstem, and the granular layer of the cerebellum. Our data suggest that ZBTB4 controls gene expression in different types of neurons. More specifically, it may be involved in olfactory, motor, and hippocampal functions. The fact that Mbd1/ mutant mice have specific defects in hippocampal functions (47) suggests that the epigenetic control of gene expression may be of special importance in that structure.
![]() View larger version (61K): [in a new window] |
FIG. 8. ZBTB4 is expressed by several neuronal populations in the brain. Sections of an adult mouse brain were hybridized with a ZBTB4 riboprobe. (A to G) A series of anterior to posterior sections hybridized with the antisense probe. (H and I) Two control sections hybridized with the sense probe. (A) GrO, granular layer of the olfactory bulb; Gl, glomerular layer of the olfactory bulb; Mi, mitral layer of the olfactory bulb. (B) AO, anterior olfactory nucleus; O, orbital cortex; Prl, prelimbic cortex. (C) Cl, claustrum; ICj, island of Calleja; Pir, piriform cortex. (D) Arc, arcuate nuclei; CM, central medial thalamic nucleus; Cx, cortex; GrDG, granulate layer of the dentate gyrus; Hip, hippocampus; MHb, medial habenular nuclei; ST, subthalamic nuclei. (E) Cx, cortex; Dk, nuclei of Darkschewitsch; Hip, hippocampus; MA3, medial accessory oculomotor nucleus; MGV, medial geniculate nucleus, ventral portion. (F) DTgC, dorsal trigeminal nucleus, central portion; Gr, granular layer of the cerebellum; Mo5, motor trigeminal nucleus. (G) Gr, granular layer of the cerebellum; HN, hypoglossal nucleus.
|
|
|
|---|
This study of Kaiso-related proteins gives us some insight on how Kaiso may regulate target genes. The linker sequence most frequently found in human proteins between two adjacent zinc fingers is TGEKP, in which the glycine residue caps the preceding helix and stabilizes binding to DNA (26). The linker between the first and second zinc fingers of Kaiso is SWEKK; it is clearly divergent from the canonical sequence and does not include a glycine. A possible explanation would be that the first zinc finger of the domain is not involved in DNA binding, but in protein-protein interactions. Indeed, the first zinc finger of Kaiso is well conserved in ZBTB4 and ZBTB38, yet it is dispensable for binding DNA (8). This situation would parallel that of the protein GATA-1, in which one of the zinc fingers is used to interact with the cofactor FOG-1 (31). We observed that ZBTB4 and ZBTB38 can bind a single methylated CpG, whereas Kaiso cannot: it requires at least two consecutive CpGs for binding (39). It might be that two molecules of Kaiso each recognize a CpG and that their interaction stabilizes binding. Regulation of this hypothetical dimerization might be a mechanism to regulate the binding of Kaiso to DNA. An important question for the future will be to identify the determinants that allow Kaiso, ZBTB4, and ZBTB38 to bind methylated DNA. The examination of conserved residues between the proteins will be helpful in this prospect.
Three lines of evidence suggest that Kaiso, ZBTB4, and ZBTB38 have different biological functions. First, they have different protein partners. Kaiso interacts with the p120-catenin to regulate Wnt target genes (38), but ZBTB4 and ZBTB38 do not interact with this protein in a two-hybrid assay (Fig. 5). Also, ZBTB4 and ZBTB38 interact with each other, but do not interact with Kaiso. Second, the proteins have different DNA-binding specificities. ZBTB4 and ZBTB38 can bind single methylated CpGs, whereas Kaiso needs two such methylated CpGs in a row. Kaiso and ZBTB4 recognize the Kaiso binding site, TCCTGCNA, and ZBTB38 binds the E-box CACCTG (24). Hence, they have distinct sets of potential binding sites. Finally, the three genes have different expression patterns. ZBTB38 mRNA is restricted to the brain and neuroendocrine organs, while ZBTB4 has a broader distribution but seems to be particularly expressed in the brain. Kaiso on the other hand is widely expressed but shows the lowest expression in the brain (7).
Kaiso is a complex transcriptional regulator that targets both methylated DNA and nonmethylated consensus sequences (8, 39). It seems to be also the case for ZBTB4 and ZBTB38. Furthermore, Zenon, the rat homologue of ZBTB38, activates transcription when bound to the E-box in the tyrosine hydroxylase gene promoter (24), while it represses transcription when bound to methylated DNA in our assay. This raises the possibility that ZBTB4 may as well be a repressor or an activator depending on the context. The fact that the proteins inhibit transcription of a reporter gene when bound to methylated DNA suggests that they might be bona fide regulators of methylated sequences. Proving this possibility will require the identification of endogenous genes that are repressed by these proteins upon methylation. In mammals, they might also contribute to the regulation of parentally imprinted genes. Parental imprinting plays a key role in controlling the growth of the placenta, an organ in which ZBTB4 is present. Interestingly, recent studies suggest that expression of imprinted genes in the brain, and especially in the hippocampus, may impact on behavior (9, 10). Since ZBTB4 is highly expressed in that region, it is possible that it plays a role in this particular aspect of imprinting. Our chromatin immunoprecipitation results suggest that both ZBTB4 and ZBTB38 bind the methylated allele of the H19/Igf2 DMR locus, yet further analyses will be needed to determine if this binding plays any role in the transcriptional regulation of these genes.
There is an increasing number of reports confirming that methylated genes are transcriptional targets for the MBDs (5, 17, 18, 33). However, deletion of Mbd1 (47), Mbd2 (15), MeCP2 (14), and Kaiso (A. Prokhortchouk et al., submitted for publication) and even the combined deletion of Mbd2 and MeCP2 (14) do not significantly impair mouse development. This contrasts with the embryonic lethality observed when DNA methylation is impaired by a mutation of Dnmt1 (30). One possible explanation for this discrepancy is that MBPs are not the sole mechanism of DNA methylation-driven repression. Models have been proposed arguing that methylation of cytosines acts in part by prohibiting the binding of activating transcription factor. One such example is that methylation of the differentially methylated region in the H19/Igf2 locus prevents binding of CTCF, thereby maintaining the imprinted status of the locus (2). An alternative explanation to the discrepancy would be the existence of extensive functional redundancy within the MBP family. One last possible explanation would be that the genome contains additional, currently unidentified MBPs. Our search for new MBPs was driven by this last consideration.
While database searches of the human genome identified many proteins containing the MBD (42), only MBD1, MBD2, MBD4, and MeCP2 bind methylated DNA. Here we show that at least three zinc finger proteins bind methylated DNA in vitro and in vivo: Kaiso, ZBTB4, and ZBTB38. In the hundreds of other zinc finger-containing proteins encoded by the human genome, some might also have this ability. In addition, the genome may contain yet other proteins that bind methylated DNA through different protein folds. The existence of multiple proteins that all recognize the same seemingly simple signalmethylated CpGis intriguing and suggests that the DNA methylation signal may have complex and subtle consequences at different genomic loci and in different cell types. The identification of the genomic targets of specific MBPs and the study of the mechanisms by which they are recruited to these loci should help us address this question.
|
|
|---|
S.S. and E.P. were supported by the Wellcome Trust, grant GR067436MA. S.Z. was supported by a grant from the Russian Foundation for Basic Research. Work in the Defossez lab was supported by the Curie Institute, CNRS (program ATIP), Fondation pour la Recherche Médicale, and Association pour la Recherche contre le Cancer.
G.J.P.F. and S.Z. contributed equally to the work. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»