![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Laboratory of Biochemical Neuroendocrinology, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montreal, Quebec H2W 1R7, Canada,1 Diseases of Aging Program, Ottawa Health Research Institute, 725 Parkdale Avenue, Ottawa, Ontario K1Y 4K9, Canada2
Received 7 September 2005/ Returned for modification 7 October 2005/ Accepted 14 October 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4-deficient allele missing exon 4 that encodes the catalytic Asp173. While 4/+ heterozygotes were healthy and fertile, genotyping of progeny obtained from 4/+ interbreeding indicated that 4/4 embryos died between embryonic days 4.5 and 7.5. These data demonstrate that Pcsk5 is an essential gene. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, in which n = 0, 2, 4, or 6. The basic residues present at the C terminus of the smaller product are usually trimmed out by a carboxypeptidase that generates an active molecule, although, in some cases, additional posttranslational modifications may be required (for a review, see reference 13). PCs themselves are synthesized as precursors. Autocatalytic cleavage at one or two intramolecular sites allows the activation of the zymogen by removal of its N-terminal prosegment. The latter acts as an intramolecular chaperone for folding of the enzyme and as a transient in trans inhibitor. PC1/3 and PC2 are present in neuroendocrine tissues, where they contribute to activate hormones or neuropeptides. PC4 is restricted to gonads. Although widespread, the other basic motif-specific PCs exhibit different and contrasting expression patterns (31). In cell lines, coexpression of candidate precursors with these PCs revealed that, in many cases, substrates preferentially processed by PC5 are also efficiently cleaved by furin, PC7, and to a lesser extent by PACE4. This is the case in some 
chains of integrins (1); the neural adhesion molecule L1 (17); transforming growth factor ß-like proteins (10, 36), including Müllerian inhibiting substance (22); the receptor protein tyrosine phosphatase RPTPµ (5); membrane-bound metalloproteinases such as ADAM-17 (34); and possibly the membrane type-1 matrix metalloproteinase MT1-MMP (39). This ex vivo redundancy probably reflects the ability of these enzymes to compensate for each other in vivo in a tissue-specific manner. In this context, the knockout of these enzymes is very informative. Furin expression is essential during development since its knockout leads to embryonic lethality around embryonic day 11 (E11) (28). However, its liver-specific knockout had no effect on the viability of mice, and in this organ, several candidates for substrates of furin were still well processed (27). The mouse PC5 gene, Pcsk5, encodes two isoforms generated by alternative splicing, PC5A and PC5B (Fig. 1). They share their first 20 exons, which encode the signal peptide, prosegment, catalytic domain, and N-terminal region of the Cys-rich domain (CRD). A specific additional exon (21A) encodes the last 38 residues of PC5A, while exons 21B to 38 encode the last 1,000 residues of PC5B. PC5A and its closest family member, PACE4, share similar C-terminal CRDs. The latter were recently shown (26) to be responsible for the interaction of these enzymes with cell surface heparan sulfate proteoglycans (HSPGs) via tissue inhibitors of metalloproteases (TIMPs). This agrees with the cell surface localization of most PC5 candidate substrates.
|
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Quantitative analysis of the PC5 transcripts in cell lines and tissues. Cells, which were washed three times with phosphate-buffered saline (PBS), and fresh mouse tissues were directly incubated with Trizol reagent (Invitrogen, Burlington, Ontario, Canada). Total RNA was extracted as recommended by the manufacturer. RNA integrity, cDNA synthesis, and quantitative PCR (QPCR) were performed as previously described (11). For each tissue or cell line, one to three RNA samples were analyzed at least twice in triplicates. Specific primers sitting on different exons were used for the simultaneous amplification of the normalizing cDNA for ribosomal protein S16 (11) and the cDNA for either PC5A+B, PC5A, or PC5B messengers: 5'-ACTCTTCAGAGGGTGGCTA versus 5'-GCTGGAACAGTTCTTGAATC and 5'-TGACCACTCTTCAGAGAATGGATAC versus 5'-GAGATACCCACTAGGGCAGC for human and mouse PC5A+B, respectively; 5'-AGGATTCAAGAACTGTTCCA versus 5'-AGCATACAGAAGCCTCCTT for mouse PC5A; and 5'-GCAATGCCTCCCACTCCC versus 5'-TGCTCGTAAAACTCAGCCTCC for mouse PC5B.
Construction of the targeting vector. The 12-kb Ecl136II-XhoI genomic region comprising exon 4 was subcloned in three steps in the 38LoxPNeo vector containing a PGK-neo cassette framed with loxP sites (IncyteGenomics). First, the 5' arm, a 4,061-bp Ecl136II fragment, was subcloned upstream of the loxP1 site in the vector digested with EcoRI and filled (Ecl136II recognizes the same site as SacI and generates blunt ends). Second, a 4,427-bp EcoRV fragment was inserted downstream of the loxP1 site in a filled HindIII site, leading thus to the replacement of 66 bp of genomic DNA that lay between the Ecl136II and EcoRV sites by the 96-bp loxP1 segment. Finally, the 3' arm, a 3,454-bp EcoRV-filled XhoI fragment, was subcloned downstream of the loxP2 site in a blunt SfiI site. Digestion of the targeting vector with NotI (5' region of the polylinker) and KpnI (1,100 bp upstream of the XhoI site in the 3' arm) generated a 12,869-bp insert that was gel purified and transfected into R1 embryonic stem (ES) cells, (129/Sv x 129/Sv-CP)F1 (23).
Creation of a PC5-null allele.
ES cells were selected for G418 resistance, and about 600 clones were digested by HindIII and analyzed by Southern blotting using an XhoI-HindIII 507-bp probe that lies downstream of the 3' arm. Six positive clones were identified by the presence of 9.2- and 7.2-kb bands corresponding to Pcsk5neo and wild-type alleles, respectively. After expansion and further analysis, all of the positive clones presented multiple insertions at the Pcsk5 locus. However, the analysis of one of them, 5B10, revealed correct 5' and 3' insertion sites of the tandem repeats by using external 5' and 3' probes and digestion with various restriction enzymes. This ES clone was thus injected into C57BL/6 blastocysts to produce chimeras that successfully transmitted the neo allele when mated to C57BL/6 mice. Heterozygous mice were then crossed with cytomegalovirus (CMV)-Cre-expressing transgenic mice (12), leading to the excision of the exon 4 (Pcsk54 allele).
Probes and PCR for ES characterization and genotyping mice.
The 5' and 3' external probes were EcoRI-EcoNI (652 bp) and XhoI-HindIII (507 bp) fragments, both located outside of the region included in the targeting vector. Two internal probes were used either located in the neomycin resistance gene or downstream of the neo cassette insertion site (482 bp starting from the EcoRV site). For PCR genotyping of mice, specific pairs of primers for wild type (WT) (5'-AGCCTGTGGGCACATGTACGTT versus 5'AGAGCCCTGAGACCTCAATGAGAA) and 4 (5'TTGGTGAGAATTCCGATCATATTCAA versus 5'TGCACTTTGCCCATTCCAGA) alleles were used.
Animals. PC5 wild-type and heterozygous mice in the C57BL/6 background (mimimum of five successive backcrosses) were housed in a 12-h dark cycle and fed a standard laboratory diet (Charles River rodent chow 5075; Purina Mills, St. Louis, MO). Mice were genotyped by PCR analysis of tail DNA. The institutional Animal Care and Ethics Committee approved all procedures described below.
PCR genotyping of embryos.
PC54/+ females were superstimulated with 5 IU of pregnant mare serum gonadotropin (PMSG) and superovulated with 5 IU of human chorionic gonadotropin (hCG) 47 h later (23). They were then mated to PC54/+ males, and embryos were either collected the next morning at E0.5 in the ampulla of the oviduct or dissected at E7.5. After a brief treatment with 
300 mg/ml hyaluronidase, E0.5 embryos were washed in potassium simplex optimized medium (KSOM) containing 20 mM HEPES, pH 7.4, transferred in 20-µl droplets of KSOM (25 to 30 embryos/droplet) overlaid with mineral oil, and incubated for 5 days at 37°C (3). Each blastocyst was recovered in 5 µl of PBS and incubated for 1 h at 95°C. Because of the small amount of DNA available, genotypes were analyzed by a nested PCR using 1 µl of matrix and the primers used for genotyping (see above) and, for nesting, the following primers: 5'-CACTTGGCTACAAATATGCGAAC versus 5'-TTTCAGCATTCTAGGTTTCCAGA and 5'-GGTCCCTCGAAGAGGTTCA versus 5'-CTCACAGGAAACACAGGCACT for detection of the WT and 4 alleles, respectively.
PC54-expressing vector.
Deletion of the sequence corresponding to exon 4 in a pIRES2-enhanced green fluorescent protein (EGFP) recombinant vector containing a mouse PC5A cDNA (pIR-mPC5A-V5) was achieved by a two-step PCR (15). Two sense and antisense primers reconstituting the exon 3-to-exon 5 junction (5'-GTATGTGGTACATGGATGCTCTGGCAAGTTGCG and 5'-GCAACTTGCCAGAGCATCCATGTACCACATACTTGGCC) and two distal primers, located upstream of a unique EcoRI site in the polylinker (sense, 5'-CGGACTCAGATCTCGAGC) and downstream of a unique BsmBI in the mPC5A sequence (antisense, 5'-CACATCGCAACTTGCCATGTACCACATACTTGGCC), led to the final amplification of a 1,180-bp fragment that was subcloned in a pDRIVE vector (QIAGEN, Mississauga, Ontario, Canada). The recombinant pDRIVE was then double digested with EcoRI and BsmBI to generate a 1,121-bp fragment that substituted for the original one containing exon 4 in pIR-mPC5A-V5.
Cell culture, transfections, Western blotting, and antibodies. Human embryonic kidney HEK293 cells were grown in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal calf serum (Canadian Life Technologies, Burlington, Ontario, Canada) at 37°C in 5% CO2. Cells (1 x 106 plated on 35-mm plates) were transfected with plain or recombinant vectors (0.6 µg) using Effectene (QIAGEN, Mississauga, Ontario, Canada). The medium was replaced 12 h after transfection by a serum-free medium, and cells were grown for an additional 24 h before being harvested for protein extraction in 1x radioimmunoprecipitation assay (RIPA) buffer. Media were also collected for Western blot analysis and activity measurements. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose filters (Hybond-ECL; Amersham Biosciences). After blocking with 5% dry milk in Tris-buffered saline containing 0.05% Tween 20, filters were incubated with anti-V5-horseradish peroxidase conjugate (InVitrogen, Carlsbad, CA) at a dilution of 1:5,000. The antigen-antibody complexes were revealed using an enhanced chemiluminescence kit (ECL Plus; Amersham Biosciences). For immunoprecipitations, media or protein extracts were diluted and adjusted at 0.5x RIPA buffer, incubated overnight at 4°C with an anti-prosegment of PC5 (ppPC5) (25) at 1/100, and further incubated 2 h with 20 µl of protein A/G-agarose (Santa-Cruz Biotechnology, Santa Cruz, CA). The beads were then washed twice with 1x RIPA buffer and a third time with PBS before being boiled in loading buffer.
In vitro PC5 activity.
Supernatants (60 µl) of HEK293 cells transfected with the empty or PC5A- or PC54-expressing vectors were incubated in presence of a mixture of 50 µM fluorogenic substrate pyruvic acid-RTKR-7-amido-4-methylcomarine, 2 mM CaCl2, 50 mM Tris (pH 7), and 100 µM ß-mercaptoethanol in a total volume of 100 µl after a 20-min preincubation of the 40-µl mixture. Fluorescence emission was detected at 460 nm, as described previously (25).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
4.5 kb comprising exon 4 (Pcsk54 allele), as revealed by digestion of genomic DNA with BstEII that cleaves outside of the region corresponding to the transfected insert (Fig. 5B). Accordingly, this resulted in a nonconditional knockout of the Pcsk5 gene. In order to eliminate the possibility of rearrangements elsewhere in the genome, we backcrossed 4/+ mice to C57BL/6 mice for a minimum of 5 generations.
|
|
4/4 genotype is embryonic lethal.
No homozygous mice were obtained from 4/+ intercrosses. Out of 204 mice, 65% were 4/+ and 35% were +/+, as expected if the 4/4 genotype leads to embryonic death, and no bias was observed between male and female progeny (Table 1, data for 3 weeks). To determine the stage of lethality, heterozygous males were mated with stimulated females and the 35 embryos isolated at E14.5 were genotyped: 77% were 4/+ and 23% were +/+, indicating that lethality had occurred before this developmental stage. In a second step, 36 embryos were carefully dissected at E7.5 and their genotyping also revealed the absence of any 4/4 embryos. Finally, zygotes were collected in the ampulla of the oviduct at E0.5 and cultured for 5 days at 37°C to obtain blastocysts. Their genotyping revealed a Mendelian distribution of the +/+, 4/+, and 4/4 genotypes (Table 1), indicating that oocyte fertilization and cell division in the early embryo were efficiently achieved, independent of the PC5 genotype. Altogether, our data suggest that embryonic death likely occurs between implantation (E4.5) and E7.5.
|
4/+ PC5 mRNA and protein.
To follow the fate of the PC5 mRNA, QPCR analysis was performed on RNA isolated from either +/+ or 4/+ livers. Primers hybridizing to exons 3 and 5 were used since connection of neighboring exons was reported to occur upon exon deletion (4, 14). Indeed, the presence of a lower band (95 bp) in 4/+ samples and sequencing of the corresponding DNA revealed that exons 3 and 5 are fused in the mRNA deriving from the recombinant allele (Fig. 6A). In addition, quantitative analysis showed that the 4 mRNA is as well produced as the wild-type one (data not shown), indicating that heterozygotes have 50% of mRNA coding for active PC5 compared to that in wild-type mice. Since exons 3 and 5 share the same reading frame, exon 4 deletion may lead to the synthesis of a truncated PC54 protein lacking 48 residues (from His140 to Tyr187). To check the cellular fate of PC54, a recombinant pIRES2-EGFP vector containing a cDNA encoding mouse PC5A C-terminally tagged with V5 was modified to mimic the exon 4 deletion (–144 bp). In transfected HEK293 cells and their media, PC54 showed a slightly lower apparent molecular mass than PC5A, compatible with the loss of 48 residues (5 kDa; Fig. 6B). Microsequencing revealed that proPC5A is the major intracellular species (25). Since similar ratios of PC5A to PC54 (experiment done three times) were revealed by V5 Western blotting, without or with prior immunoprecipitation with a PC5 prosegment-specific antibody, we can deduce that proPC54 is predominant in the cell. In the medium of wild-type PC5A, in addition to the 110-kDa PC5A, an 50-kDa C-terminal product (V5 positive) was observed, representing the cleaved CRD as previously reported (26). Taking into account the 10-fold-higher loading for the media than for the cell lysates, we estimated that while most of PC5A was secreted, only 5% of PC54 was found in the medium. Although the same quantity of DNA was used for transfection, the total amount of PC54 detected was much lower than that of PC5A, suggesting that PC54 was largely degraded. Interestingly, the secreted fraction of PC54, which migrated faster than PC5A, underwent zymogen processing since otherwise proPC54 would have been 4 kDa heavier than PC5A. This indicates that proPC54 can exit from the endoplasmic reticulum and be processed in trans. The inactivity of PC54 in HEK293 media, although expected from the loss of one of the catalytic residues, wasassessed using the fluorogenic substrate Pyr-RTKR-AMC. PC54 activity was not detected since it was found equivalent to that of control medium (empty vector), which was at least 30-fold lower than that obtained from PC5A (Fig. 6C).
|
4 allele, the possible in trans inhibitory effect of PC54 on the activity of the other PCs, namely furin, whose knockout is also embryonic lethal, was assessed. For this, the extent of cleavage of a V5-tagged pro-PDGF-A, which is efficiently processed by furin in HEK293 cells (33), was estimated in the absence or in presence of overexpressed 1-PDX, the prosegment of furin, or the prosegment of PC5 or PC54 (Fig. 6D). No inhibitory effect of PC54 could be detected while the PC inhibitors, 1-PDX and the furin prosegment, efficiently inhibited proPDGF-A processing. In addition, only a very mild inhibitory effect of the PC5 prosegment was detected. Finally, even under overexpression conditions, PC54 is not inhibitory. |
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In order to assess the in vivo functions of PC5, we developed a knockout strategy that led to the inactivation of both isoforms involving deletion of the common exon 4 encoding the catalytic Asp173 (Fig. 4). While heterozygote mice harboring a Pcsk54 allele (+/4) are healthy and fertile, homozygosity leads to early embryonic lethality that occurs between the blastocyst implantation stage (E4.5) and E7.5 (Table 1), demonstrating that Pcsk5 is an essential gene.
Deletion of exon 4 resulted in a truncated mRNA in which exons 3 and 5 are fused in frame (Fig. 6A). Cellular overexpression of a cDNA mimicking the exon 4 deletion resulted in low levels of PC54. In addition, the protein was mostly found in the cell as a zymogen, whereas only a small fraction (<5%) was processed in trans and secreted (Fig. 6B). Thus, the level of the inactive PC54 protein produced from the Pcsk54 allele is expected to be negligible. Indeed, the available antibodies directed against PC5 did not detect endogenous PC54 in heterozygotes (data not shown). Furthermore, media obtained from HEK293 cells overexpressing PC54 revealed no in vitro activity as compared to that of the wild type (Fig. 6C), and there was no inhibitory effect on the ex vivo processing of pro-platelet-derived growth factor A (proPDGF-A) by endogenous PCs (Fig. 6D). Taken together, these data demonstrate that the residual expression of PC54 is not responsible for the observed lethality. Similarly, PC2 inactivation through disruption of exon 3 also led to an alternative splicing producing proPC23 that remained as an inactive zymogen in vivo (14). Finally, using the Flp/loxP system, the recent production of a conditional PC5 knockout in which exon 1 was targeted led, in the presence of a CMV-Cre transgene, to the absence of PC5 transcripts and resulted in early lethality of 1/1 embryos (Essalmani et al., unpublished data).
Using an antisense morpholino oligonucleotide (24), it was shown that uterine expression of PC5 is required for decidualization at the implantation site in the mouse, but no information is available concerning the requirement for embryonic expression of PC5 at the same stage. Since the litter size does not differ between +/+ and +/4 females (data not shown), we can rule out that the embryonic lethality observed upon intercrosses of +/4 mice is due to a maternal PC5 deficit. This indicates that early de novo synthesis of PC5 in either embryonic or extraembryonic cells is essential. Whether embryonic expression of PC5 is essential for implantation or at later stages remains to be defined. It has been mentioned in a review article (35), but without experimental details, that PC5B inactivation led to embryonic death at E10.5 to E11.5, i.e., at least 3 days after that observed herein upon PC5A+B inactivation. This suggests that PC5B is essential, but the lethality observed in its absence may be delayed by PC5A. Is PC5A also essential? If not, then the key role(s) played by PC5B may reside in extraembryonic giant trophoblasts (41) or unidentified early progenitor cells. In that context, the extensive expression at E9 of PC5, but not furin and PACE4, in the rat materno-embryonic junction, whose trophoblast giant cells derive from the embryo, is compelling (41). Finally, the elucidation of the critical cognate substrate(s) will require the identification of the exact stage and cell types associated with the observed lethality. Future studies will determine if the essential role of PC5 observed during early development also applies to later stages. The available conditional knockout will allow the induction of PC5 inactivation at different stages as well as in specific tissues, thereby leading to the identification of the substrates and physiological roles of PC5.
|
ACKNOWLEDGMENTS |
|---|
This work was entirely supported by CIHR grant MGP-44363 to N.G.S.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bergeron, E., M. J. Vincent, L. Wickham, J. Hamelin, A. Basak, S. T. Nichol, M. Chretien, and N. G. Seidah. 2005. Implication of proprotein convertases in the processing and spread of severe acute respiratory syndrome coronavirus. Biochem. Biophys. Res. Commun. 326:554-563.[CrossRef][Medline]
3. Biggers, J. D., L. K. McGinnis, and M. Raffin. 2000. Amino acids and preimplantation development of the mouse in protein-free potassium simplex optimized medium. Biol. Reprod. 63:281-293.
4. Bruneau, B. G., G. Nemer, J. P. Schmitt, F. Charron, L. Robitaille, S. Caron, D. A. Conner, M. Gessler, M. Nemer, C. E. Seidman, and J. G. Seidman. 2001. A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell 106:709-721.[CrossRef][Medline]
5. Campan, M., M. Yoshizumi, N. G. Seidah, M. E. Lee, C. Bianchi, and E. Haber. 1996. Increased proteolytic processing of protein tyrosine phosphatase mu in confluent vascular endothelial cells: the role of PC5, a member of the subtilisin family. Biochemistry 35:3797-3802.[CrossRef][Medline]
6. Constam, D. B., and E. J. Robertson. 2000. SPC4/PACE4 regulates a TGFbeta signaling network during axis formation. Genes Dev. 14:1146-1155.
7. De, B., I. M. Marcinkiewicz, D. Malide, C. Lazure, K. Nakayama, M. Bendayan, and N. G. Seidah. 1996. The isoforms of proprotein convertase PC5 are sorted to different subcellular compartments. J. Cell Biol. 135:1261-1275.
8. Dong, W., M. Marcinkiewicz, D. Vieau, M. Chretien, N. G. Seidah, and R. Day. 1995. Distinct mRNA expression of the highly homologous convertases PC5 and PACE4 in the rat brain and pituitary. J. Neurosci. 15:1778-1796.[Abstract]
9. Dong, W., B. Seidel, M. Marcinkiewicz, M. Chretien, N. G. Seidah, and R. Day. 1997. Cellular localization of the prohormone convertases in the hypothalamic paraventricular and supraoptic nuclei: selective regulation of PC1 in corticotrophin-releasing hormone parvocellular neurons mediated by glucocorticoids. J. Neurosci. 17:563-575.
10. Dubois, C. M., F. Blanchette, M. H. Laprise, R. Leduc, F. Grondin, and N. G. Seidah. 2001. Evidence that furin is an authentic transforming growth factor-beta1-converting enzyme. Am. J. Pathol. 158:305-316.
11. Dubuc, G., A. Chamberland, H. Wassef, J. Davignon, N. G. Seidah, L. Bernier, and A. Prat. 2004. Statins upregulate PCSK9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase-1 implicated in familial hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol. 24:1454-1459. (First published 3 June 2004; doi:10.1161/01.ATV.0000134621.14315.43.)
12. Dupe, V., M. Davenne, J. Brocard, P. Dolle, M. Mark, A. Dierich, P. Chambon, and F. M. Rijli. 1997. In vivo functional analysis of the Hoxa-1 3' retinoic acid response element (3'RARE). Development 124:399-410.[Abstract]
13. Fricker, L. D., and E. H. Leiter. 1999. Peptides, enzymes and obesity: new insights from a ‘dead’ enzyme. Trends Biochem. Sci. 24:390-393.[CrossRef][Medline]
14. Furuta, M., H. Yano, A. Zhou, Y. Rouille, J. J. Holst, R. Carroll, M. Ravazzola, L. Orci, H. Furuta, and D. F. Steiner. 1997. Defective prohormone processing and altered pancreatic islet morphology in mice lacking active SPC2. Proc. Natl. Acad. Sci. USA 94:6646-6651.
15. Hospital, V., E. Nishi, M. Klagsbrun, P. Cohen, N. G. Seidah, and A. Prat. 2002. The metalloendopeptidase nardilysin (NRDc) is potently inhibited by heparin-binding EGF-like growth factor (HB-EGF). Biochem. J. 367:229-238.[CrossRef][Medline]
16. Jin, W., I. V. Fuki, N. G. Seidah, S. Benjannet, J. M. Glick, and D. J. Rader. 2005. Proprotein covertases are responsible for proteolysis and inactivation of endothelial lipase. J. Biol. Chem. 280:36551-36559.
17. Kalus, I., B. Schnegelsberg, N. G. Seidah, R. Kleene, and M. Schachner. 2003. The proprotein convertase PC5A and a metalloprotease are involved in the proteolytic processing of the neural adhesion molecule L1. J. Biol. Chem. 278:10381-10388. (First published 15 January 2003; doi:10.1074/jbc.M208351200.)
18. Lissitzky, J. C., J. Luis, J. S. Munzer, S. Benjannet, F. Parat, M. Chretien, J. Marvaldi, and N. G. Seidah. 2000. Endoproteolytic processing of integrin pro-alpha subunits involves the redundant function of furin and proprotein convertase (PC) 5A, but not paired basic amino acid converting enzyme (PACE) 4, PC5B or PC7. Biochem. J. 346:133-138.
19. Lusson, J., D. Vieau, J. Hamelin, R. Day, M. Chretien, and N. G. Seidah. 1993. cDNA structure of the mouse and rat subtilisin/kexin-like PC5: a candidate proprotein convertase expressed in endocrine and nonendocrine cells. Proc. Natl. Acad. Sci. USA 90:6691-6695.
20. Marcinkiewicz, M., J. Marcinkiewicz, A. Chen, F. Leclaire, M. Chretien, and P. Richardson. 1999. Nerve growth factor and proprotein convertases furin and PC7 in transected sciatic nerves and in nerve segments cultured in conditioned media: their presence in Schwann cells, macrophages, and smooth muscle cells. J. Comp. Neurol. 403:471-485.[CrossRef][Medline]
21. Mbikay, M., H. Tadros, N. Ishida, C. P. Lerner, E. De Lamirande, A. Chen, M. El Alfy, Y. Clermont, N. G. Seidah, M. Chretien, C. Gagnon, and E. M. Simpson. 1997. Impaired fertility in mice deficient for the testicular germ-cell protease PC4. Proc. Natl. Acad. Sci. USA 94:6842-6846.
22. Nachtigal, M. W., and H. A. Ingraham. 1996. Bioactivation of Mullerian inhibiting substance during gonadal development by a kex2/subtilisin-like endoprotease. Proc. Natl. Acad. Sci. USA 93:7711-7716.
23. Nagy, A., M. Gersenstein, K. Vintersten, and R. Behringer. 2003. Manipulating the mouse embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
24. Nie, G., Y. Li, M. Wang, Y. X. Liu, J. K. Findlay, and L. A. Salamonsen. 2005. Inhibiting uterine PC6 blocks embryo implantation: an obligatory role for a proprotein convertase in fertility. Biol. Reprod. 72:1029-1036.
25. Nour, N., A. Basak, M. Chretien, and N. G. Seidah. 2003. Structure-function analysis of the prosegment of the proprotein convertase PC5A. J. Biol. Chem. 278:2886-2895.
26. Nour, N., G. Mayer, J. S. Mort, A. Salvas, M. Mbikay, C. J. Morrison, C. M. Overall, and N. G. Seidah. 2005. The cysteine-rich domain of the secreted proprotein convertases PC5A and PACE4 functions as a cell surface anchor and interacts with tissue inhibitors of metalloproteinases. Mol. Biol. Cell 16:5215-5226.
27. Roebroek, A. J., N. A. Taylor, E. Louagie, I. Pauli, L. Smeijers, A. Snellinx, A. Lauwers, W. J. Van De Ven, D. Hartmann, and J. W. Creemers. 2004. Limited redundancy of the proprotein convertase furin in mouse liver. J. Biol. Chem. 279:53442-53450.
28. Roebroek, A. J., L. Umans, I. G. Pauli, E. J. Robertson, F. van Leuven, W. J. Van De Ven, and D. B. Constam. 1998. Failure of ventral closure and axial rotation in embryos lacking the proprotein convertase furin. Development 125:4863-4876.[Abstract]
29. Seidah, N. G., S. Benjannet, L. Wickham, J. Marcinkiewicz, S. B. Jasmin, S. Stifani, A. Basak, A. Prat, and M. Chretien. 2003. The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc. Natl. Acad. Sci. USA 100:928-933.
30. Seidah, N. G., and M. Chretien. 1999. Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides. Brain Res. 848:45-62.[CrossRef][Medline]
31. Seidah, N. G., M. Chretien, and R. Day. 1994. The family of subtilisin/kexin like pro-protein and pro-hormone convertases: divergent or shared functions. Biochimie 76:197-209.[Medline]
32. Seidah, N. G., and A. Prat. 2002. Precursor convertases in the secretory pathway, cytosol and extracellular milieu. Essays Biochem. 38:79-94.[Medline]
33. Siegfried, G., A. M. Khatib, S. Benjannet, M. Chretien, and N. G. Seidah. 2003. The proteolytic processing of pro-platelet-derived growth factor-A at RRKR(86) by members of the proprotein convertase family is functionally correlated to platelet-derived growth factor-A-induced functions and tumorigenicity. Cancer Res. 63:1458-1463.
34. Srour, N., A. Lebel, S. McMahon, I. Fournier, M. Fugere, R. Day, and C. M. Dubois. 2003. TACE/ADAM-17 maturation and activation of sheddase activity require proprotein convertase activity. FEBS Lett. 554:275-283.[CrossRef][Medline]
35. Taylor, N. A., W. J. Van De Ven, and J. W. Creemers. 2003. Curbing activation: proprotein convertases in homeostasis and pathology. FASEB J. 17:1215-1227.
36. Ulloa, L., J. W. Creemers, S. Roy, S. Liu, J. Mason, and S. Tabibzadeh. 2001. Lefty proteins exhibit unique processing and activate the MAPK pathway. J. Biol. Chem. 276:21387-21396.
37. Villeneuve, P., S. Feliciangeli, G. Croissandeau, N. G. Seidah, M. Mbikay, P. Kitabgi, and A. Beaudet. 2002. Altered processing of the neurotensin/neuromedin N precursor in PC2 knock down mice: a biochemical and immunohistochemical study. J. Neurochem. 82:783-793.[CrossRef][Medline]
38. Xiang, Y., S. S. Molloy, L. Thomas, and G. Thomas. 2000. The PC6B cytoplasmic domain contains two acidic clusters that direct sorting to distinct trans-Golgi network/endosomal compartments. Mol. Biol. Cell 11:1257-1273.
39. Yana, I., and S. J. Weiss. 2000. Regulation of membrane type-1 matrix metalloproteinase activation by proprotein convertases. Mol. Biol. Cell 11:2387-2401.
40. Yang, J., J. L. Goldstein, R. E. Hammer, Y. A. Moon, M. S. Brown, and J. D. Horton. 2001. Decreased lipid synthesis in livers of mice with disrupted Site-1 protease gene. Proc. Natl. Acad. Sci. USA 98:13607-13612.
41. Zheng, M., N. G. Seidah, and J. E. Pintar. 1997. The developmental expression in the rat CNS and peripheral tissues of proteases PC5 and PACE4 mRNAs: comparison with other proprotein processing enzymes. Dev. Biol. 181:268-283.[CrossRef][Medline]
42. Zhu, X., A. Zhou, A. Dey, C. Norrbom, R. Carroll, C. Zhang, V. Laurent, I. Lindberg, R. Ugleholdt, J. J. Holst, and D. F. Steiner. 2002. Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc. Natl. Acad. Sci. USA 99:10293-10298.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
/HindIII" contain specific ladders.