This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liepinsh, D. J.
Right arrow Articles by Nedospasov, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liepinsh, D. J.
Right arrow Articles by Nedospasov, S. A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2006, p. 4214-4225, Vol. 26, No. 11
0270-7306/06/$08.00+0     doi:10.1128/MCB.01751-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Novel Lymphotoxin Alpha (LT{alpha}) Knockout Mice with Unperturbed Tumor Necrosis Factor Expression: Reassessing LT{alpha} Biological Functions{dagger}

Dmitry J. Liepinsh,1,2 Sergei I. Grivennikov,2,6 Kimberly D. Klarmann,1,3 Maria A. Lagarkova,6 Marina S. Drutskaya,3,6 Stephen J. Lockett,4 Lino Tessarollo,5 Matthew McAuliffe,7 Jonathan R. Keller,1,3 Dmitry V. Kuprash,2,6 and Sergei A. Nedospasov6*

Basic Research Program, SAIC-Frederick, Inc.,1 Basic Research Laboratory,2 Cancer and Developmental Biology Laboratory,3 Image Analysis Laboratory,4 Mouse Cancer Genetics Program, Center for Cancer Research, NCI—Frederick, Frederick, Maryland 21702,5 Laboratory of Molecular Immunology, Belozersky Institute of Physico-Chemical Biology, Moscow State University, and Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia,6 Center for Information Technology, DCB, ISL, BIRSS, National Institutes of Health, Bethesda, Maryland 208927

Received 6 September 2005/ Returned for modification 4 November 2005/ Accepted 3 January 2006


arrow
ABSTRACT
 
Lymphotoxin alpha (LT{alpha}) can exist in soluble form and exert tumor necrosis factor (TNF)-like activity through TNF receptors. Based on the phenotypes of knockout (KO) mice, the physiological functions of LT{alpha} and TNF are considered partly redundant, in particular, in supporting the microarchitecture of the spleen and in host defense. We exploited Cre-LoxP technology to generate a novel neomycin resistance gene (neo) cassette-free LT{alpha}-deficient mouse strain (neo-free LT{alpha} KO [LT{alpha}{Delta}/{Delta}]). Unlike the "conventional" LT{alpha}–/– mice, new LT{alpha}{Delta}/{Delta} animals were capable of producing normal levels of systemic TNF upon lipopolysaccharide (LPS) challenge and were susceptible to LPS/D-galactosamine (D-GalN) toxicity. Activated neutrophils, monocytes, and macrophages from LT{alpha}{Delta}/{Delta} mice expressed TNF normally at both the mRNA and protein levels as opposed to conventional LT{alpha} KO mice, which showed substantial decreases in TNF. Additionally, the spleens of the neo-free LT{alpha} KO mice displayed several features resembling those of LTß KO mice rather than conventional LT{alpha} KO animals. The phenotype of the new LT{alpha}{Delta}/{Delta} mice indicates that LT{alpha} plays a smaller role in lymphoid organ maintenance than previously thought and has no direct role in the regulation of TNF expression.


arrow
INTRODUCTION
 
Lymphotoxin alpha (LT{alpha}), tumor necrosis factor (TNF), and LTß are related cytokines whose genes are clustered within 12 kb of genomic DNA inside of the major histocompatibility complex (10, 34). Their products have important but often overlapping functions in peripheral lymphoid organ development, microstructure maintenance, and immune response (2, 16, 50). LT{alpha} can exist in two main forms: the soluble homotrimeric form (sLT{alpha}), which shares receptors with TNF, and the transmembrane LT{alpha}1ß2 heterotrimeric form, which interacts with a separate LTß receptor (10, 18, 20, 50).

Because of the close proximity of LT/TNF genes, one can envision that any manipulation with one gene, involving deletions or insertions, may influence the expression of the others. Indeed, defective TNF production by conventionally engineered LT{alpha} knockout (KO) mice was previously reported (3). Additionally, another report showed that Mycobacterium bovis BCG-infected LT{alpha} KO mice displayed a 10-fold decrease in TNF production at an early stage of infection and a twofold reduction at a later time point (9). Besides, low or high copy TNF transgenes improved T/B-cell zone segregation in the LT{alpha}–/– mice via a TNF receptor I (TNFRI)-dependent mechanism, and partially restored the organization of splenic B-cell follicles, suggesting that defective TNF expression might contribute to the phenotype of LT{alpha}-deficient mice (3). Such a role of TNF was further supported by the phenotype of the double LTß/TNF KO mice, whose splenic architecture was disrupted similarly to that in "conventional" LT{alpha} KO mice (26). Thus, downregulation of TNF expression in conventional LT{alpha} KO mice might be due to targeting artifacts. An alternative hypothesis is that the LT{alpha} and TNF genes are involved in mutual regulation, perhaps through TNFRI, TNFRII, LTß receptor (LTßR), and NF-{kappa}B.

The essential role of TNF in control of several infections was documented (15, 35). At the same time, several studies utilizing LT{alpha}-deficient mice provided evidence for the TNF-independent role of soluble LT{alpha} in various physiological processes, including resistance to pathogens such as Mycobacterium tuberculosis, Listeria monocytogenes, and Toxoplasma gondii (41, 42, 44). Interestingly, a significant decrease in TNF mRNA expression after T. gondii infection was noted in the brains of neo cassette-containing LT{alpha} KO mice. Primed spleen cells from these mice displayed significantly reduced TNF synthesis upon restimulation with Toxoplasma antigen while peritoneal macrophages produced severely reduced amounts of TNF in response to different activating stimuli (44). Thus, defective TNF production by conventional LT{alpha} knockout animals could potentially lead to misinterpretation of the role of LT{alpha} in some pathophysiological models. The relative TNF deficiency in conventional LT{alpha} KO mice has been perplexing for many years but there was no tool available to directly address this problem.

In this report, we describe a novel strain of LT{alpha}-deficient mice which allow investigation of these important issues. We used LoxP-Cre technology to create neo-free LT{alpha} KO (LT{alpha}{Delta}/{Delta}) mice capable of producing normal amounts of TNF both in vitro and in vivo. Our data strongly suggest that the decreased level of TNF production in LT{alpha} deficiency is not due to mutual regulation of LT and TNF but rather correlates with the presence of the neo cassette in the genetically manipulated LT{alpha} gene locus. On the other hand, our data support the main conclusions regarding the critical role of the LT{alpha}/LTß-LTßR axis in development and maintenance of peripheral lymphoid tissues. Overall, the new LT{alpha}{Delta}/{Delta} mice will help to better define distinct and overlapping functions of TNF and LT{alpha}.


arrow
MATERIALS AND METHODS
 
Engineering of neo resistance cassette-free LT{alpha} knockout mice. A murine genomic clone in the EMBL3A phage vector containing the genes for LT{alpha}, LTß, and TNF-{alpha} (40) was used to construct the targeting vector. A 3.2-kb HindIII-KpnI fragment and a 3.5-kb KpnI-HindIII fragment were subcloned into vectors pGEM4 and pBSKS+ [pBluescript II KS(+) with a modified multiple cloning site], respectively, resulting in pLTAI and pLTAII. A cohesive end oligonucleotide duplex containing a synthetic loxP motif and BamHI and EcoRI sites was inserted into the BamHI site of pLTAI, generating the pLTAloxI vector. A neo resistance gene cassette flanked by two loxP motifs was excised from the pL2neo vector as a SalI-XbaI fragment and cloned into the AsuII site of pLTAII using the AsuII-SalI-XbaI-AsuII synthetic duplex. Subclones containing the neo resistance gene with the orientation of transcription opposite to LT{alpha} were picked. The pLTAII vector was digested with EcoRI and religated, resulting in the pLTAIImin vector. Then, the neo resistance gene cassette flanked by two loxP motifs was cloned into the AsuII site of pLTAIImin as described for the contrLTAneo vector, resulting in pLTAneomin. To assemble the final targeting vector, TV-LTa, the HindIII-KpnI genomic fragment was recovered from the pLTAloxI vector, the KpnI-EcoRI fragment was recovered from the pLTAneomin vector by digestion with KpnI and NotI, and both fragments were ligated with a HindIII-NotI-digested modified pBSKS+ vector containing a herpes simplex virus thymidine kinase gene cassette (4). The identity and orientation of loxP motifs were verified by restriction analysis using asymmetric EcoRI sites introduced into LoxP synthetic duplexes. The targeting vector was further verified by sequencing across all cloning sites. TV-LTa was digested with NotI and used for transformation of 129/Sv embryonic stem (ES) cells. Homologous recombination was detected by PCR using primers LTARTP1 (5'-AACCTGCTGCTCACCTTGTT) and LTARTP2 (5'-CAGTGCAAAGGCTCCAAAGA). Out of 155 neomycin-resistant clones, 14 tested positive and were further tested for cointegration of the third LoxP site using primers Pri1lta (5'-CTTGTGTCTGTCTTGCGT) and Pri2lta (5'-GTCTCTCGGCAGTTAAGC). Out of four positive clones, two clones, 533 and 613, were confirmed by Southern analysis and used for injection into C57BL/6 blastocysts. Chimeras were backcrossed to C57BL/6; germ line transmission was detected by PCR and further confirmed by Southern analysis. Mice with germ line transmission were crossed to actin-Cre "deleter" mice (31). Progeny with complete deletion of both the TNF gene and neo resistance cassette were detected by PCR using primers Pri1lta and pri7lta (5'-ATAACTGTGACTTGAACC) and confirmed by Southern analysis.

Genomic Southern analysis. Tissues or sorted cells were lysed in proteinase K buffer (100 mM Tris-HCl, pH 8.0, 10 mM EDTA, 200 mM NaCl, 0.5% sodium dodecyl sulfate, 50 mg/ml proteinase K) and incubated for 5 to 7 hours at 60°C. Genomic DNA was extracted using phenol-chloroform and digested with HindIII. Five to 20 mg of restricted DNA samples was loaded on 0.7% agarose gel, separated at 10 V, and then blotted to the Hybond N+ membrane (Amersham) and hybridized with 32P-labeled probe mTNFexon2, previously described (8). The results were quantified using ImageQuant software.

Northern blotting. RNA was isolated from 8 x 106 cells using the RNeasy kit (QIAGEN, Valencia, CA). DNA was digested on columns using the RNase-free DNase set (QIAGEN). RNA was run in 1x MOPS (morpholinepropanesulfonic acid) running buffer at 5 V/cm under denaturing conditions for 3 hours, transferred to a Hybond-XL membrane (Amersham Biosciences, Piscataway, NJ) in 10x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), UV cross-linked, and hybridized with the 32P-labeled probe. The probe was obtained by reverse transcription-PCR from mouse activated peritoneal macrophages using primers TNFMF (GGGTGTTCATCCATTCTCTAC) and TNFMR (TGAGATCTTATCCAGCCTCAT).

qRT-PCR. cDNA obtained from 2 µg of total splenic RNA using the SuperScript first-strand synthesis system (Invitrogen, Carlsbad, CA) was used for the quantitative real-time PCR (qRT-PCR) assay. Primers and probes were selected for murine TNF and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as follows: mouse TNF-{alpha} real-time PCR primer set (BioSource International, Camarillo, CA); TNF-{alpha} FRET probe (5'-6-carboxyfluorescein [FAM]-CCACG TCGTAGCAAACCACCA-black hole quencher [BHQ]-3'; BioSource); and GAPDH probes 5'-GGGAAGCCCATCACCATCTT-3' (forward), 5'-ACATACTCAGCACCGGCCTC-3' (reverse), and 5'-FAM-AGCGAGACCCCACTAACATCAAATGGG-BHQ-3'. The PCR mixture was prepared using ABI TaqMan universal master mixture (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. The cycling profile performed with the iCycler iQ real-time PCR detection system (Bio-Rad, Hercules, CA) involved initial denaturation at 95°C for 10 min followed by 45 cycles of 15 s at 95°C (denaturing) and 20 s at 56°C (annealing/extension).

Mice. LT{alpha}{Delta}/{Delta} mice were backcrossed to the C57BL/6 background for five generations. LT{alpha}–/– (13), TNF–/– (32), LTß/TNF–/– (26), TNF/LT{Delta}3 (triple-knockout mice) (27), LTß KO (4), LTßR KO (18), TNFRI KO (38), and TNFRII KO (37) mice were on the C57BL/6 background. All mice were housed in a specific-pathogen-free environment.

Immune challenges. Mice were injected intraperitoneally with 100 µg of lipopolysaccharide (LPS) from Escherichia coli O111:B4 (Sigma, St. Louis, MO). For LPS/D-galactosamine (D-GalN)-induced toxicity, mice were injected intraperitoneally with 1 µg LPS in combination with 20 mg D-GalN (Sigma). Mice were monitored hourly and euthanized when moribund. To induce hepatitis, mice received concanavalin A (Sigma) at the dose 18 mg/kg of body weight intravenously and were observed for 12 h. For ovalbumin (OVA)/complete Freund's adjuvant (CFA) immunization, mice were injected intraperitoneally with 50 µg OVA in 25 µl of saline emulsified 1:1 in AdjuLite Freund's adjuvant (Pacific Immunology, Ramona, CA) containing 1 mg/ml of heat-killed Mycobacterium tuberculosis H37Ra.

In vitro cell cultures. Bone marrow-derived dendritic cells were produced as described previously (1). More detailed information is available in the supplemental material.

Measurement of TNF, TNFR, and nitric oxide. TNF and soluble TNF receptor concentrations were assessed using mouse TNF, TNFRI, and TNFRII Duo Set enzyme-linked immunosorbent assay (ELISA) development system (R&D Systems, Minneapolis, MN). Levels of nitrite (NO2) in cell supernatants were measured by a colorimetric assay using modified Griess reagent (Sigma) according to the manufacturer's instructions.

Elispot. For OVA-specific gamma interferon (IFN-{gamma}) and interleukin-5 (IL-5) production paraformaldehyde-fixed protein-loaded dendritic cells were plated at 2 x 105 per well along with purified CD4+ T cells at a 1:1 ratio. After incubation for 36 h, antigen-specific IFN-{gamma} and IL-5 production was assessed using an enzyme-linked immunospot assay (Elispot) set (BD-Pharmingen, San Diego, CA) according to the manufacturer's instructions.

Measurement of antigen-specific immunoglobulin isotypes. Serum was collected from mice on day 19 after immunization and OVA-specific immunoglobulin M (IgM), IgG, IgG2a, and IgG1 were analyzed by ELISA. Briefly, 100 µl of OVA at 10 µg/ml was used to coat plates for 12 h at 4°C, and then the wells were washed three times with phosphate-buffered saline containing 0.05% Tween 20, blocked with 300 µl of 1% bovine serum albumin-phosphate-buffered saline for several hours at room temperature. After washing, 100 µl of test serum diluted 1:100 to 1:4,000 were added to the wells and incubated overnight at 4°C. For detection, solutions of 1:1,000-diluted alkaline phosphatase-conjugated goat anti-mouse IgM, IgG, IgG2a, and IgG1 (Southern Biotech, Birmingham, AL) were used in conjunction with FAST p-nitrophenyl phosphate tablets (Sigma). Plates were read at 405 nm on a microtiter plate reader.

Tissue and cytospin staining. Immunohistochemistry was performed on frozen sections as described previously (26). More detailed information is available in the supplemental material.

Flow cytometry. Labeling with the LTßR-Ig (a gift from Y.-X. Fu, University of Chicago) was performed as previously described (28). Flow cytometry was performed using the FACSCalibur analyzer and WinMDI 2.8 software. Multicolor staining for cell surface antigens and intracellular TNF was performed using antibodies and the Cytofix/Cytoperm kit (BD Pharmingen) according to the manufacturer's recommendations.

Statistical analysis. Statistical analysis was performed using the t test and Fisher's exact test online tool (http://www.matforsk.no/ola/fisher.htm).


arrow
RESULTS
 
Generation of neo-free LT{alpha} knockout mice. After homologous recombination in 129/Sv ES cells, two ES clones, verified by both PCR and Southern analysis, were injected into C57BL/6 blastocysts. After germ line transmission, mice were crossed with "deleter" mice carrying the Cre transgene under the strong ubiquitous ß-actin promoter (31) to achieve both LT{alpha} gene and neo cassette deletion in all tissues (Fig. 1A; see Fig. S1 in the supplemental material). Heterozygous mice were then intercrossed to obtain homozygous LT{alpha} KO animals and subsequently backcrossed to the C57BL/6 background. The resulting LT{alpha}{Delta}/{Delta} mice were born at the expected Mendelian ratio and did not show any gross survival or growth abnormalities.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 1. LoxP/Cre LT{alpha} gene targeting and deletion. (A) Scheme of the targeted disruption of the LT{alpha} gene. 129/Sv ES cells that have undergone homologous recombination with the targeting construct were injected into blastocysts and reimplanted into pseudopregnant females. The resulting chimeric mice were crossed with C57BL/6 mice to detect germ line transmission. After confirmation of germ line transmission by PCR and Southern analysis, the offspring were then crossed with transgenic "deleter" mice in which Cre recombinase was placed under the ß-actin promoter to achieve deletion of both the neomycin resistance (neo) cassette and LT{alpha} gene. The progeny were tested for the LT{alpha} gene and neo deletion, intercrossed to obtain homozygous mice, and then backcrossed to the C57BL/6 background. (B) Southern blot analysis of splenocytes from LT{alpha}+/+, LT{alpha}+/{Delta} and LT{alpha}{Delta}/{Delta} mice. Genomic DNA was digested with HindIII. *, 6.6-kb fragment of wild-type mouse DNA with the floxed LT{alpha} gene. (C) Surface expression of the LT{alpha}ß complex on activated splenocytes. Splenocytes were plated at 0.5 x 106/ml and activated for 7 h with phorbol myristate acetate (50 ng/ml) and anti-mouse CD40 (10 µg/ml).

Southern blotting analysis of HindIII-digested genomic DNA indicated complete LT{alpha} gene deletion (6.6-kb wild-type fragment in "floxed" LT{alpha} mice and 4.0-kb "knockout" fragment in LT{alpha}{Delta}/{Delta} mice) (Fig. 1B). To confirm the complete lack of LT{alpha} at the protein level, activated splenocytes were labeled with LTßR-Fc fusion protein to quantify surface LT complex by flow cytometry. There was no detectable surface LT expression on activated splenocytes from the LT{alpha}{Delta}/{Delta} mice (Fig. 1C).

TNF production in vivo in response to LPS is normal in the LT{alpha}{Delta}/{Delta} mice in striking contrast to conventional LT{alpha} KO mice. LPS is an important component of gram-negative bacterial cell wall sensed by Toll-like receptor 4 and CD14, which are expressed on the surface of several types of immune cells (25). LPS is a potent inducer of inflammatory factors and cytokines, including TNF (24). To assess TNF induction in the absence of LT{alpha}, mice were injected intraperitoneally with 100 µg of LPS, and sera were harvested 90 min after the injection. While conventional LT{alpha} KO mice demonstrated up to a 10-fold decrease in serum TNF (Fig. 2), LT{alpha}{Delta}/{Delta} mice produced wild-type levels of this cytokine. At the higher 250-µg LPS dose TNF levels increased in all mice compared to those obtained at the 100-µg LPS dose, and conventional LT{alpha}–/– animals still showed up to a 60% reduction relative to either wild-type or LT{alpha}{Delta}/{Delta} mice (see Fig. S2B in the supplemental material). In agreement with these data, another independently generated strain of conventional LT{alpha} KO mouse (6) was evaluated and displayed comparable results (see Fig. S2C in the supplemental material).


Figure 2
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Systemic LPS-induced TNF production is markedly decreased in conventional LT{alpha}–/–, but not in novel LT{alpha}{Delta}/{Delta} mice. Mice were injected intraperitoneally with 100 µg LPS. Serum TNF levels were measured by ELISA 90 min after injection. *, P < 0.001, wild-type versus LT{alpha}–/– mice; **, P < 0.001, LT{alpha}{Delta}/{Delta} versus LT{alpha}–/– mice.

The activity of TNF can be neutralized by shedding of TNF receptors from the membrane of the expressing cells in vivo (33). To exclude the possibility that the wild-type levels of measurable TNF in our LT{alpha}{Delta}/{Delta} mice were due to differences in the levels of shed TNF receptors, we measured TNF receptor content in sera after LPS challenge and found no difference in soluble receptor concentrations among various mouse strains (see Fig. S2D and E in the supplemental material).

The hepatotoxic agent D-GalN increases the susceptibility of mice to the toxic effects of LPS up to 100,000-fold (19). TNF was previously shown to be one of the main effectors of toxicity seen in D-GalN-sensitized mice in response to LPS (7, 38). As an additional indication of TNF production, we compared the conventional and the novel LT{alpha}-deficient mouse strains in this well-characterized TNF-dependent in vivo model. We observed statistically significant differences in survival between LT{alpha}{Delta}/{Delta} and the conventional LT{alpha}–/– animals at time points when the percentage of severely moribund neo-free LT{alpha} KO mice reached 50 and 100% (P < 0.026). Nevertheless, conventional LT{alpha} KO mice showed only partial protection from LPS/D-GalN shock (Table 1). The lower LPS dose (0.1 µg) yielded comparable results, however, at the higher LPS dose (10 µg), LT{alpha}–/– animals died with kinetics similar to that of wild-type or LT{alpha}{Delta}/{Delta} animals (see Fig. S2F and G in the supplemental material).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Survival after LPS/D-GalN challengea

In another model which is known to be largely dependent on TNF produced by T cells and macrophages/neutrophils (21), not only LT{alpha}{Delta}/{Delta} but also conventional LT{alpha}–/– mice were able to develop hepatitis after intravenous administration of a relatively high dose of concanavalin A (18 mg/kg) (data not shown). At a lower concanavalin A dose (9 mg/kg), LT{alpha}–/– mice showed a trend towards decreased TNF mRNA expression in their livers 1 hour after the injection (see Fig. S3 in the supplemental material).

Taken together, these data conclusively demonstrate that the novel LT{alpha}{Delta}/{Delta} mice express wild-type amounts of TNF. At the same time, these results suggest that TNF deficiency in conventional LT{alpha} KO animals is partial and may vary from profound TNF deficiency to almost normal TNF production, depending on the nature and/or dose of the activating stimulus.

Cells of myeloid origin in conventional LT{alpha}–/– mice have diminished ability to produce TNF. We next investigated whether or not TNF production in the conventional LT{alpha}–/– mice was negatively affected in all types of leukocytes that normally produce TNF. Our previous study with tissue-specific TNF-deficient mice showed that macrophages and neutrophils were the main source of systemic TNF after LPS challenge (21). To clarify if LT{alpha}-deficient macrophages have the potential to produce TNF in amounts comparable to those of wild-type macrophages, we stimulated bone marrow-derived macrophages (BMDM{phi}) with LPS and IFN-{gamma} for 24 h. Strikingly, BMDM{phi} from conventional LT{alpha}–/– but not from LT{alpha}{Delta}/{Delta} mice failed to produce normal amounts of TNF (Fig. 3A). At the same time, nitric oxide levels in cell culture supernatants from both LT{alpha}-deficient strains were not significantly decreased (Fig. 3B).


Figure 3
View larger version (57K):
[in this window]
[in a new window]
 
FIG. 3. Defective TNF synthesis by macrophages, monocytes, and neutrophils in the conventional LT{alpha} KO mice. (A) TNF and (B) nitric oxide (NO) production by BMDM{phi}. Cells were activated with either medium alone or LPS (10 ng/ml) and IFN-{gamma} (10 ng/ml) for 24 h. *, P = 0.025, LT{alpha}{Delta}/{Delta} versus LT{alpha}–/–. (C) Intracellular TNF staining of whole blood activated with LPS (10 ng/ml) and IFN-{gamma} (10 ng/ml) for 3 h. Events shown are gated for CD11bhi expression. (D) Wright-Giemsa-stained, sorted peripheral blood CD11bhi leukocytes subdivided into three separate populations according to GR-1 expression (representative untreated wild-type mouse). In population I, 90% of cells represent monocytes; population II consists of monocytes (50%), neutrophils (25%), and other cell types (25%); and population III is composed of neutrophils (96%). Percentages are average approximate values from multiple analyses. (E) TNF production by BMDNE. Cells were activated with 10 ng/ml LPS and IFN-{gamma}. Supernatants were harvested at 3, 8, and 12 h. TNF was measured by sandwich ELISA. *, P = 0.019, wild-type versus LT{alpha}–/–. (F) Northern blot analysis of BMDNE stimulated with 10 ng/ml LPS and IFN-{gamma}.

In the next set of experiments, we also compared the ability of peripheral blood monocytes and neutrophils to produce TNF in response to LPS and IFN-{gamma} stimulation. Monocytes and neutrophils were activated in whole blood, which provides an environment similar to the conditions existing in vivo. To discriminate between monocytes and neutrophils, whole blood was stained with anti-CD11b and GR-1 antibodies as previously described (23, 30). Cells gated on the CD11bhi population fall into three distinct populations: GR-1low-neg (mainly monocytes), GR-1int (mixture of monocytes [about 50%], neutrophils [about 25%], and other cell types), and GR-1hi population, which was >98% pure neutrophils, as confirmed by modified Wright-Giemsa staining of cytospins (Fig. 3C and D).

In the conventional LT{alpha} KO mice, all three populations displayed substantial reductions in the percentage of TNF-positive cells. In addition, mean TNF fluorescence intensity was also substantially reduced (Fig. 3C). To specifically evaluate TNF production by neutrophils, we stimulated bone marrow-derived neutrophils (BMDNE) with LPS and IFN-{gamma}. Similar to the results obtained with whole blood, the conventional LT{alpha}–/– mice but not the LT{alpha}{Delta}/{Delta} mice showed significantly impaired TNF production by BMDNE (Fig. 3E).

Since the expression of TNF is tightly regulated at the transcriptional, posttranscriptional, and translational levels, we then asked if defects in TNF production could be observed at the mRNA level. Northern analysis of TNF mRNA indicated that in the conventional LT{alpha}-deficient mice TNF expression was inhibited within 1 hour after activation (Fig. 3F). Interestingly, and in contrast to myeloid cells, intracellular and soluble cytokine analysis revealed that TNF production by activated T cells was similar in both LT{alpha} KO mouse strains and wild-type controls (Fig. 4), demonstrating a distinct difference between myeloid and lymphoid cell TNF production in LT{alpha}–/– mice.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. Normal TNF production by splenic T cells in both strains of LT{alpha} KO mice. (A) Intracellular TNF production by splenic T cells, and (B) soluble TNF production by purified T cells stimulated with phorbol myristate acetate (100 ng/ml) and ionomycin (1 µg/ml) for 5 h.

Peripheral lymphoid organs in novel neo-free LT{alpha} KO mice. LT{alpha}{Delta}/{Delta} mice display the main macroscopic hallmarks of LT deficiency, including lack of all sets of peripheral lymph nodes and Peyer's patches, splenomegaly, perivascular lymphocytic infiltrates, and other features (data not shown). We next compared defects in splenic microarchitecture between the two LT{alpha} KOs. Interestingly, double immunohistochemical staining of spleen tissue sections using anti-CD3 and anti-CD19 antibodies revealed that the splenic white pulp in LT{alpha}{Delta}/{Delta} mice was bigger than in LT{alpha}–/– animals and was reminiscent of that of LTß KO mice. Spatial segregation of T and B cells also appeared more organized in LT{alpha}{Delta}/{Delta} than in conventional LT{alpha}–/– mice (Fig. 5A and C and data not shown). Staining with ER-TR7 antibodies, which identify reticular fibroblasts and fibroblast-derived fibers, did not show visible differences between the two LT{alpha}-deficient strains. Although the staining revealed ring-like structures, ER-TR7-positive stromal elements were mostly concentrated around central arterioles rather than delineating the border between the red and white pulp (see Fig. S4A in the supplemental material).


Figure 5
View larger version (79K):
[in this window]
[in a new window]
 
FIG. 5. Better-conserved size of splenic white pulp and BP-3 expression in LT{alpha}{Delta}/{Delta} mice. (A) Serial splenic sections from mice of the indicated genotypes were stained with anti-CD3 (blue) and anti-CD19 (red) antibodies to detect T and B cells, respectively. Magnification, x40. (B) To detect T cells and BP-3-positive stromal cells, splenic sections were stained with fluorescently labeled anti-CD3 (green) and anti-BP3 (red) antibodies. Magnification, x200. (C) Quantification of the size of splenic white pulp. The size of splenic white pulp is shown as a percentage of the size of the entire image. Data were obtained using the NIH Medical Image Processing and Visualization program. Three mice per group were analyzed.

Staining for BP-3-positive subpopulations of stromal cells in peripheral lymphoid organs was previously shown to be dependent on TNF and LT{alpha}1ß2 signals (36). Remarkably, the network of BP-3-positive cells was reduced but still readily detectable in the splenic white pulp of LT{alpha}{Delta}/{Delta} mice similar to LTß KO mice, whereas there were only occasional BP-3-positive cells in some lymphoid follicles in conventional LT{alpha}–/– mice. In double LTß/TNF KO and LTßR KO mice these stromal elements could not be detected. Gradual reduction of the BP-3-positive stromal cells was observed in the following order: wild-type mice > LT{alpha}{Delta}/{Delta} mice {approx} LTß KO mice > LT{alpha}–/– mice ≥ LTß/TNF KO mice {approx} LTßR KO mice (Fig. 5B). Although conventional LT{alpha} KO mice displayed a trend towards decreased basal TNF mRNA expression in the whole spleen, and LT{alpha}{Delta}/{Delta} mice showed the opposite tendency, this difference appeared not to be statistically significant (see Fig. S4B in the supplemental material). On the other hand, the better-preserved microstructure of the spleen in the LT{alpha}{Delta}/{Delta} mice correlated with higher levels of intracellular TNF expression by activated B cells in vitro (see Fig. S4C in the supplemental material).

Other features of splenic microarchitecture in LT{alpha}{Delta}/{Delta} mice, including the absence of CR1 and FDC-M1 expression, were indistinguishable from those seen in the conventional LT{alpha}–/– animals (see Fig. S5 in the supplemental material).

Adaptive cellular and humoral immune response to OVA/CFA immunization. A Th1-polarized response is needed to efficiently protect the host from some pathogens, including mycobacteria (14). To compare the ability of the two LT{alpha} KO mice strains to mount a Th1-polarized response, we utilized the OVA/CFA immunization model.

Proliferation of purified splenic day 14 CD4+ T cells from immunized animals in coculture with OVA-loaded fixed wild-type BMDC was at the wild-type level in both LT{alpha} KO mice strains (data not shown). Nevertheless, production of OVA-specific IFN-{gamma} by CD4+ T cells was decreased up to twofold in LT{alpha} KO mice. The lower ovalbumin immunization dose (25 µg) revealed even more clearly the differences between LT{alpha} KO mice and wild-type mice, but again did not detect any dissimilarity between the LT{alpha}{Delta}/{Delta} and LT{alpha}–/– mouse strains. OVA-specific IL-5 was almost undetectable, confirming the Th1 polarization of the response (Fig. 6A and B and data not shown).


Figure 6
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6. Adaptive immune responses of novel LT{alpha}{Delta}/{Delta} mice to OVA. (A) OVA- and BSA-specific IFN-{gamma} and IL-5 production by sorted splenic CD4+ T cells from intraperitoneally OVA- and CFA-immunized mice. T cells were stimulated with OVA- or BSA-loaded fixed bone marrow-derived dendritic cells for 36 h. Antigen-specific cytokine production was determined by Elispot assay. (B) Representative wells showing OVA-specific IFN-{gamma} production by splenic CD4+ T cells from wild-type and neo-free LT{alpha} KO mice. (C) TNF production by wild-type BMDM{phi} loaded with OVA or BSA (as a negative control) and stimulated for 24 h with purified day 14 CD4+ splenocytes from OVA/CFA-immunized wild-type (black columns), LT{alpha}{Delta}/{Delta} (white columns), or LT{alpha}–/– (gray columns) mice. (D) Antigen-specific TNF production by BMDM{phi} activated with wild-type CD4+ splenic T cells from OVA/CFA-immunized mice. *, P = 0.05, wild-type versus LT{alpha}–/–. (E to H) OVA-specific production of (E) IgM, (F) IgG, (G) IgG1, and (H) IgG2a was analyzed by ELISA. Serum dilution is 1:1,000. *, IgG response data representing three independent experiments. Readings at 405 nm were normalized to the wild-type reading, which was arbitrarily defined as 1.0 in each experiment.

Then, we assessed the ability of effector CD4+ LT{alpha}-deficient T cells to induce TNF production in antigen-loaded macrophages, and the capacity of macrophages to respond to T-cell stimulation. We activated OVA- or BSA-loaded BMDM{phi} with CD4+ T cells sorted from the spleens of OVA/CFA-immunized mice. OVA-loaded wild-type BMDM{phi} stimulated with primed wild-type, LT{alpha}{Delta}/{Delta} or LT{alpha}–/– T cells produced comparable levels of TNF (Fig. 6C). At the same time, and similar to results obtained with LPS stimulation (see above), only LT{alpha}–/– macrophages were incapable of producing proper amounts of TNF in response to activation by either wild-type or LT{alpha}-deficient CD4+ T cells (Fig. 6D and data not shown). Thus, the defect in TNF production by macrophages in this model appears to be macrophage autonomous and is not due to the inability of antigen-specific helper T cells to stimulate BMDM{phi}.

Together these findings indicated that LT{alpha}-deficient CD4+ T cells were able to proliferate and could efficiently stimulate wild-type BMDM{phi} in an antigen-specific manner but were unable to produce adequate amounts of IFN-{gamma}. There was no difference between conventional and neo-free LT{alpha} KO mice with regard to T-cell responses.

In order to mount an efficient humoral immune response to nonreplicating thymus-dependent antigens, effective communication between dendritic cells, T cells, B cells, and follicular dendritic cells (FDCs) is required. We found that both LT{alpha} KO strains had elevated OVA-specific IgM antibodies in their sera 19 days after immunization, whereas the switch to an IgG isotype dropped severalfold (Fig. 6E, F, G, and H). This is a hallmark of defective humoral response observed earlier in the conventional LT{alpha} KO mice which was attributed to disturbed T- and B-cell zone segregation, absence of FDC and other abnormalities in splenic microarchitecture (17). Although both types of LT{alpha}-deficient mice displayed severely impaired antigen-specific IgG response compared to wild-type animals (Fig. 6F), there was some IgG1 production in the LT{alpha}{Delta}/{Delta} mice but not in the LT{alpha}–/– mice (Fig. 6G).

Thus, the LT{alpha} KO mouse strains have similar deficiencies in IgM/IgG isotype switching, most likely because of severely disturbed splenic microarchitecture.


arrow
DISCUSSION
 
This study defined a novel LT{alpha}-deficient mouse strain that differs from its conventional counterpart by the targeting strategy, in particular, by deletion of the entire LT{alpha} gene and excision of the neomycin resistance cassette. The presence of an actively transcribed selectable marker has been reported to cause alterations in the regulation of neighboring genes (39, 43). Given the fact that the two closely linked TNF and LT{alpha} genes encode cytokines with partly overlapping functions, such alterations may lead to inaccurate interpretation of the phenotype of mice deficient in one particular gene.

In the present report, we show that novel new neo-free LT{alpha}{Delta}/{Delta} mice generated by means of LoxP-Cre technology grossly resemble conventional LT{alpha}-deficient mice (6, 13) and LTßR KO mice (18), in agreement with most of the established functions of LT{alpha} signaling through LTßR in the development and maintenance of peripheral lymphoid tissues (16, 18, 22, 49, 50). However, one striking difference was the level of TNF production. Specifically, LT{alpha}{Delta}/{Delta} mice are fully capable of producing normal TNF levels, whereas conventional LT{alpha} KO animals display significant decreases in TNF synthesis in several critical types of leukocytes both in vitro and in vivo. For example, there was about a 10-fold difference in systemic TNF production between wild-type and conventional LT{alpha} KO mice upon intraperitoneal LPS challenge (Fig. 2).

Since the conventional LT{alpha} KO mice have normal levels of shed TNFRI and TNFRII which can regulate TNF bioavailability and activity (see Fig. S2D and E in the supplemental material), and do not show decreased numbers of monocytes and neutrophils in peripheral blood and of macrophages in peritoneal cavity (data not shown), the substantial decrease in TNF levels in vivo can be attributed to a cell-autonomous TNF production defect. Deficiency in systemic TNF production also translated into lower toxicity of LPS administered to D-GalN-sensitized conventional LT{alpha} KO mice (Table 1). However, at the higher LPS dose, D-GalN-sensitized LT{alpha}–/– animals died with the same kinetics as wild-type or LT{alpha}{Delta}/{Delta} animals (see Fig. S2F and G in the supplemental material), suggesting that TNF deficiency in conventional LT{alpha} KO mice is partial and dose dependent, and that its depth may vary depending on the pathophysiological model.

There are conflicting reports on the ability of myeloid cells from conventional LT{alpha} KO mice to produce TNF. Initially, Alexopoulou et al. (3) reported that conventional LT{alpha}-deficient thioglycolate-elicited peritoneal macrophages had decreased expression of TNF. Further, this finding was supported by Schluter et al. (44), who found dramatic decreases in TNF production by macrophages of another conventional LT{alpha} KO mouse strain. However, normal TNF production by BMDM{phi} stimulated with a high dose of LPS and IFN-{gamma} for an unusually prolonged incubation time was also documented (41).

In this report, we demonstrated that TNF production by LPS- and IFN-{gamma}-stimulated BMDM{phi}, monocytes, and neutrophils was impaired in the conventional LT{alpha} KO mice at both the protein and mRNA levels (Fig. 3A, C, E, and F). Moreover, in another model when OVA-loaded BMDM{phi} were stimulated with wild-type CD4+ T cells sorted from the spleens of OVA- and CFA-immunized mice, reduced TNF production was detected only in the conventional LT{alpha} KO macrophages (Fig. 6D), confirming our previous finding.

Utilizing real-time PCR and Northern blotting analysis, it was previously shown that splenocytes from conventional LT{alpha} KO mice activated with the T-cell mitogen concanavalin A or phorbol myristate acetate produce normal amounts of TNF mRNA (6, 13, 45). Employing intracellular TNF protein staining and ELISA, we confirmed and extended this observation to activated T cells from both conventional and neo-free LT{alpha}-deficient mice (Fig. 4).

Taken together, our findings suggest that in conventional LT{alpha} KO mice, TNF production is impaired in myeloid cells but not lymphoid cells, supporting the idea of discrete regulation of TNF production in different cell types.

Indeed, the mechanisms controlling transcriptional initiation of the TNF gene may be different in distinct populations of leukocytes. Earlier promoter studies indicated that the sequence of the TNF promoter from –200 to –20 nucleotides relative to the TNF transcription start site is essential for TNF production by T cells in response to T-cell receptor engagement, ionophore stimulation, or viral infection. The histone acetyltransferases CBP and p300 are required for interaction and complex formation with all major lymphocyte transcription factors such as SP1, Ets-1, NFATp, ATF-2/Jun, and others, facilitating their binding to regulatory elements in this TNF gene promoter-proximal region (47).

In contrast, a major role of the distal region of the TNF gene promoter was documented in macrophages triggered through Toll-like receptors. The distal region contains several important elements, including four {kappa}B binding sites that interact with a unique repertoire of NF-{kappa}B/Rel complexes as well as other transcription factors. In particular, there is a highly conserved element 0.6 kb upstream of the TNF transcription start site that contains a cluster of transcription factor binding sites, including {kappa}B sites 2 and 2a. This region was shown to be critical for maximal NF-{kappa}B-dependent activity of the TNF promoter (29, 46, 48). Thus, the transcriptional regulation of TNF in different cell types or even in a single cell type depends on the nature of the stimulus which leads to the recruitment of distinct sets of transcription factors and architectural proteins to distinct or shared regulatory elements of the TNF gene promoter. Besides, the formation of different NF-{kappa}B/Rel complexes in response to the same stimulus may depend on the cell type. In this regard, increased levels of inhibitory p50 homodimers that interact with three {kappa}B elements in the distal TNF promoter region were observed in macrophages but not in fibroblasts during the late stage of response to LPS (5).

Our targeting strategy could potentially introduce defects in TNF regulation by deleting putative control elements located within the deleted portion of the LT{alpha} gene or put some transcription-enhancing regulatory elements located upstream of the LT{alpha} gene closer to the TNF gene. However, no such elements were previously reported for TNF transcription in macrophages/monocytes, in which case the distal elements of the promoter are confined to an approximately 1-kb region fully retained in our targeting vector. More importantly, normal or almost normal levels of TNF production in several cell types analyzed in this study strongly argue that TNF is not downregulated due to LT{alpha} deficiency and the existence of a "cytokine network." This conclusion is further supported by the fact that neo-free LTß KO mice and LTßR KO mice also have normal levels of TNF in serum after LPS challenge (see Fig. S2A in the supplemental material). Thus, reduced TNF levels in the conventional LT{alpha} KO mice appear to be due to the targeting strategy employed and are likely to be associated with the presence of the neo cassette upstream of the TNF gene. Further studies may be needed to determine the exact mechanism of TNF downregulation in myeloid cells of conventional LT{alpha} KO mice.

The importance of macrophages, neutrophils, and TNF in host protection against intracellular pathogens has been extensively documented (11, 12, 21, 35). Thus, in the case of intracellular infection, efficient innate immune response is of paramount importance and early adequate TNF production can be critical not only for initial bacteria containment but also for the overall resolution of the disease. Although TNF and LT{alpha} were reported to be independently important for host defense against BCG infection, up to fourfold reduction of serum TNF levels after BCG infection was documented in conventional LT{alpha}–/– mice (9).

Another study (42) utilizing bone marrow chimeras with different neo cassette-containing LT{alpha}-deficient mice as donors and RAG/ mice as recipients claimed a TNF-independent protective role for soluble LT{alpha} in host protection against Listeria monocytogenes infection. Interestingly, peritoneal macrophages from this LT{alpha}-deficient strain were shown to have significantly reduced TNF production after activation with IFN-{gamma}, and up to a 30-fold decrease after in vitro infection with T. gondii (44). Our data demonstrated severely impaired TNF production by neutrophils, monocytes, and to some extent mature macrophages in the conventional LT{alpha} KO mice and may call into question the "independent" protective role of soluble LT{alpha} in intracellular infections. These issues have to be resolved in the future.

Finally, we documented that T- and B-cell segregation, the size of splenic white pulp, and the extent of remaining BP-3-positive stromal cell network in spleens of novel LT{alpha}{Delta}/{Delta} mice resemble those seen in the spleens of LTß KO mice (Fig. 5A, B, and C and data not shown). LTß-, TNF-, and TNFRI-deficient mice have significantly reduced staining for BP-3 antigen in the spleen (36), suggesting the importance of both TNF and LT{alpha}1ß2 ligands. Interestingly, BP-3-positive stromal cells are completely absent in LTß/TNF double knockout mice, implying cooperation between TNF and LT{alpha}1ß2 (Fig. 5B). It also implies that sLT{alpha}3->TNFRI signals were either not important or not sufficient to support the BP-3-positive stromal network in LTß/TNF KO mice.

However, LTßR KO mice show a complete lack of BP-3 staining in spite of the fact that they normally express TNF, perhaps suggesting that an additional ligand for the LTßR, possibly LIGHT, may act in cooperation with TNF in supporting BP-3-positive stromal elements in splenic white pulp.

Taken together, these findings suggest that the role of LT{alpha} in the maintenance of at least some elements of splenic microarchitecture may be less significant than previously thought. By comparing splenic architecture in LTß, LTß/TNF (both neo free), and conventional LT{alpha} KO mice we have previously made conclusions about the contribution of TNF signaling in the maintenance of the spleen (26). We believe that this TNF-dependent component is at least partially impaired in conventional LT{alpha} KO mice.

In conclusion, the newly engineered neo-free LT{alpha}-deficient mice shed new light on the regulation of gene expression at the TNF/LT locus as well as on the contribution of individual TNF/LT family members to adaptive immune responses and lymphoid organ maintenance. This new mouse strain offers an important new tool for dissecting unique and overlapping functions of TNF and LT{alpha} in various pathophysiological situations.


arrow
ACKNOWLEDGMENTS
 
We are grateful to A. Shakhov, A. Tumanov, Y. Shebzukhov, and A. Hurwitz for fruitful discussion and critical remarks. We thank T. Banks and C. Ware for providing the alternative strain of LT{alpha} KO mice, Y. X. Fu for the LTßR-Ig protein, A. Garcia-Pineres for help with real-time PCR, and E. Southon and S. Reid for assistance in knockout mouse engineering. We are indebted to R. Matthai and K. Noer for cell sorting as well as to L. Drutskaya, S. Stull, and T. Stull for excellent technical support.

This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research, with federal funds from the National Cancer Institute, National Institutes of Health, under contract no. NO1-CO-12400, and by a grant from the Russian Academy of Sciences (Molecular and Cell Biology). S.A.N. is an International Research Scholar of the Howard Hughes Medical Institute.

The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (NIH Publication no. 86-23, 1985).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratory of Molecular Immunology, Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 32 Vavilov St., 119991 Moscow, Russia. Phone: 7 (495) 135-9964. Fax: 7 (495) 135-1405. E-mail: snedos{at}online.ru. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Abe, K., F. O. Yarovinsky, T. Murakami, A. N. Shakhov, A. V. Tumanov, D. Ito, L. N. Drutskaya, K. Pfeffer, D. V. Kuprash, K. L. Komschlies, and S. A. Nedospasov. 2003. Distinct contributions of TNF and LT cytokines to the development of dendritic cells in vitro and their recruitment in vivo. Blood 101:1477-1483.[Abstract/Free Full Text]
  2. 2
  3. Aggarwal, B. B. 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nat. Rev. Immunol. 3:745-756.[CrossRef][Medline]
  4. 3
  5. Alexopoulou, L., M. Pasparakis, and G. Kollias. 1998. Complementation of lymphotoxin alpha knockout mice with tumor necrosis factor-expressing transgenes rectifies defective splenic structure and function. J. Exp. Med. 188:745-754.[Abstract/Free Full Text]
  6. 4
  7. Alimzhanov, M. B., D. V. Kuprash, M. H. Kosco-Vilbois, A. Luz, R. L. Turetskaya, A. Tarakhovsky, K. Rajewsky, S. A. Nedospasov, and K. Pfeffer. 1997. Abnormal development of secondary lymphoid tissues in lymphotoxin beta-deficient mice. Proc. Natl. Acad. Sci. USA 19;94:9302-9307.
  8. 5
  9. Baer, M., A. Dillner, R. C. Schwartz, C. Sedon, S. A. Nedospasov, and P. F. Johnston. 1998. TNF alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-{kappa}B p50. Mol. Cell. Biol. 18:5678-5689.[Abstract/Free Full Text]
  10. 6
  11. Banks, T. A., B. T. Rouse, M. K. Kerley, P. J. Blair, V. L. Godfrey, N. A. Kuklin, D. M. Bouley, J. Thomas, S. Kanangat, and M. L. Mucenski. 1995. Lymphotoxin-alpha-deficient mice. Effects on secondary lymphoid organ development and humoral immune responsiveness. J. Immunol. 155:1685-1693.[Abstract]
  12. 7
  13. Beutler, B., I. W. Milsark, and A. C. Cerami. 1985. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin. Science 229:869-871.[Abstract/Free Full Text]
  14. 8
  15. Biragyn, A., and S. A. Nedospasov. 1995. Lipopolysaccharide-induced expression of TNF-alpha gene in the macrophage cell line ANA-1 is regulated at the level of transcription processivity. J. Immunol. 155:674-683.[Abstract]
  16. 9
  17. Bopst, M., I. Garcia, R. Guler, M. L. Olleros, T. Rulicke, M. Muller, S. Wyss, K. Frei, M. Le Hir, and H. P. Eugster. 2001. Differential effects of TNF and LTalpha in the host defense against M. bovis BCG. Eur. J. Immunol. 31:1935-1943.[CrossRef][Medline]
  18. 10
  19. Browning, J. L., A. Ngam-ek, P. Lawton, J. DeMarinis, R. Tizard, E. P. Chow, C. Hession, B. O'Brine-Greco, S. F. Foley, and C. F. Ware. 1993. Lymphotoxin beta, a novel member of the TNF family that forms a heteromeric complex with lymphotoxin on the cell surface. Cell 72:847-856.[CrossRef][Medline]
  20. 11
  21. Conlan, J. W., and R. J. North. 1992. Roles of Listeria monocytogenes virulence factors in survival: virulence factors distinct from listeriolysin are needed for the organism to survive an early neutrophil-mediated host defense mechanism. Infect. Immun. 60:951-957.[Abstract/Free Full Text]
  22. 12
  23. Conlan, J. W., and R. J. North. 1994. Neutrophils are essential for early anti-Listeria defense in the liver, but not in the spleen or peritoneal cavity, as revealed by a granulocyte-depleting monoclonal antibody. J. Exp. Med. 179:259-268.[Abstract/Free Full Text]
  24. 13
  25. De Togni, P., J. Goellner, N. H. Ruddle, P. R. Streeter, A. Fick, S. Mariathasan, S. C. Smith, R. Carlson, L. P. Shornick, J. Strauss-Schoenberger, J. H. Russell, R. Karr, and D. D. Chaplin. 1994. Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin. Science 264:703-707.[Abstract/Free Full Text]
  26. 14
  27. Flynn, J. L., and J. Chan. 2001. Immunology of tuberculosis. Annu. Rev. Immunol. 19:93-129.[CrossRef][Medline]
  28. 15
  29. Flynn, J. L., M. M. Goldstein, J. Chan, K. J. Triebold, K. Pfeffer, C. J. Lowenstein, R. Schreiber, T. W. Mak, and B. R. Bloom. 1995. Tumor necrosis factor-alpha is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2:561-572.[CrossRef][Medline]
  30. 16
  31. Fu, Y. X., and D. D. Chaplin. 1999. Development and maturation of secondary lymphoid tissues. Annu. Rev. Immunol. 17:399-433, 399-433.[CrossRef][Medline]
  32. 17
  33. Fu, Y. X., H. Molina, M. Matsumoto, G. Huang, J. Min, and D. D. Chaplin. 1997. Lymphotoxin-alpha (LTalpha) supports development of splenic follicular structure that is required for IgG responses. J. Exp. Med. 185:2111-2120.[Abstract/Free Full Text]
  34. 18
  35. Futterer, A., K. Mink, A. Luz, M. H. Kosco-Vilbois, and K. Pfeffer. 1998. The lymphotoxin beta receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9:59-70.[CrossRef][Medline]
  36. 19
  37. Galanos, C., M. A. Freudenberg, and W. Reutter. 1979. Galactosamine-induced sensitization to the lethal effects of endotoxin. Proc. Natl. Acad. Sci. USA 76:5939-5943.[Abstract/Free Full Text]
  38. 20
  39. Gommerman, J. L., and J. L. Browning. 2003. Lymphotoxin/light, lymphoid microenvironments and autoimmune disease. Nat. Rev. Immunol. 3:642-655.[CrossRef][Medline]
  40. 21
  41. Grivennikov, S. I., A. V. Tumanov, D. J. Liepinsh, A. A. Kruglov, B. I. Marakusha, A. N. Shakhov, T. Murakami, L. N. Drutskaya, I. Forster, B. E. Clausen, L. Tessarollo, B. Ryffel, D. V. Kuprash, and S. A. Nedospasov. 2005. Distinct and nonredundant in vivo functions of TNF produced by T cells and macrophages/neutrophils: protective and deleterious effects. Immunity. 22:93-104.[Medline]
  42. 22
  43. Hehlgans, T., and K. Pfeffer. 2005. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology 115:1-20.[CrossRef][Medline]
  44. 23
  45. Hestdal, K., F. W. Ruscetti, J. N. Ihle, S. E. Jacobsen, C. M. Dubois, W. C. Kopp, D. L. Longo, and J. R. Keller. 1991. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J. Immunol. 147:22-28.[Abstract]
  46. 24
  47. Holst, O., A. J. Ulmer, H. Brade, H. D. Flad, and E. T. Rietschel. 1996. Biochemistry and cell biology of bacterial endotoxins. FEMS Immunol. Med. Microbiol. 16:83-104.[CrossRef][Medline]
  48. 25
  49. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5:987-995.[CrossRef][Medline]
  50. 26
  51. Kuprash, D. V., M. B. Alimzhanov, A. V. Tumanov, A. O. Anderson, K. Pfeffer, and S. A. Nedospasov. 1999. TNF and lymphotoxin beta cooperate in the maintenance of secondary lymphoid tissue microarchitecture but not in the development of lymph nodes. J. Immunol. 163:6575-6580.[Abstract/Free Full Text]
  52. 27
  53. Kuprash, D. V., M. B. Alimzhanov, A. V. Tumanov, S. I. Grivennikov, A. N. Shakhov, L. N. Drutskaya, M. W. Marino, R. L. Turetskaya, A. O. Anderson, K. Rajewsky, K. Pfeffer, and S. A. Nedospasov. 2002. Redundancy in tumor necrosis factor (TNF) and lymphotoxin (LT) signaling in vivo: mice with inactivation of the entire TNF/LT locus versus single-knockout mice. Mol. Cell. Biol. 22:8626-8634.[Abstract/Free Full Text]
  54. 28
  55. Kuprash, D. V., A. V. Tumanov, D. J. Liepinsh, E. P. Koroleva, M. S. Drutskaya, A. A. Kruglov, A. N. Shakhov, E. Southon, W. J. Murphy, L. Tessarollo, S. I. Grivennikov, and S. A. Nedospasov. 2005. Novel tumor necrosis factor-knockout mice that lack Peyer's patches. Eur. J. Immunol. 35:1592-1600.[CrossRef][Medline]
  56. 29
  57. Kuprash, D. V., I. A. Udalova, R. L. Turetskaya, D. Kwiatkowski, N. R. Rice, and S. A. Nedospasov. 1999. Similarities and differences between human and murine TNF promoters in their response to lipopolysaccharide. J. Immunol. 162:4045-4052.[Abstract/Free Full Text]
  58. 30
  59. Lagasse, E., and I. L. Weissman. 1996. Flow cytometric identification of murine neutrophils and monocytes. J. Immunol. Methods 197:139-150.[CrossRef][Medline]
  60. 31
  61. Ma, W., L. Tessarollo, S. B. Hong, M. Baba, E. Southon, T. C. Back, S. Spence, C. G. Lobe, N. Sharma, G. W. Maher, S. Pack, A. O. Vortmeyer, C. Guo, B. Zbar, and L. S. Schmidt. 2003. Hepatic vascular tumors, angiectasis in multiple organs, and impaired spermatogenesis in mice with conditional inactivation of the VHL gene. Cancer Res. 63:5320-5328.[Abstract/Free Full Text]
  62. 32
  63. Marino, M. W., A. Dunn, D. Grail, M. Inglese, Y. Noguchi, E. Richards, A. Jungbluth, H. Wada, M. Moore, B. Williamson, S. Basu, and L. J. Old. 1997. Characterization of tumor necrosis factor-deficient mice. Proc. Natl. Acad. Sci. USA 94:8093-8098.[Abstract/Free Full Text]
  64. 33
  65. Mohler, K. M., D. S. Torrance, C. A. Smith, R. G. Goodwin, K. E. Stremler, V. P. Fung, H. Madani, and M. B. Widmer. 1993. Soluble tumor necrosis factor (TNF) receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously as both TNF carriers and TNF antagonists. J. Immunol. 151:1548-1561.[Abstract]
  66. 34
  67. Muller, U., C. V. Jongeneel, S. A. Nedospasov, K. Fisher Lindahl, and M. Steinmetz. 1987. Tumour necrosis factor and lymphotoxin genes map close to H-2D in the mouse major histocompatibility complex. Nature 325:265-267.[CrossRef][Medline]
  68. 35
  69. Nakane, A., T. Minagawa, and K. Kato. 1988. Endogenous tumor necrosis factor (cachectin) is essential to host resistance against Listeria monocytogenes infection. Infect. Immun. 56:2563-2569.[Abstract/Free Full Text]
  70. 36
  71. Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, R. D. Sean, M. D. Cooper, J. L. Browning, J. D. Sedgwick, and J. G. Cyster. 1999. Lymphotoxin alpha/beta and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189:403-412.[Abstract/Free Full Text]
  72. 37
  73. Peschon, J. J., D. S. Torrance, K. L. Stocking, M. B. Glaccum, C. Otten, C. R. Willis, K. Charrier, P. J. Morrissey, C. B. Ware, and K. M. Mohler. 1998. TNF receptor-deficient mice reveal divergent roles for p55 and p75 in several models of inflammation. J. Immunol. 160:943-952.[Abstract/Free Full Text]
  74. 38
  75. Pfeffer, K., T. Matsuyama, T. M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P. S. Ohashi, M. Kronke, and T. W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:457-467.[CrossRef][Medline]
  76. 39
  77. Pham, C. T., D. M. MacIvor, B. A. Hug, J. W. Heusel, and T. J. Ley. 1996. Long-range disruption of gene expression by a selectable marker cassette. Proc. Natl. Acad. Sci. USA 93:13090-13095.[Abstract/Free Full Text]
  78. 40
  79. Pokholok, D. K., I. G. Maroulakou, D. V. Kuprash, M. B. Alimzhanov, S. V. Kozlov, T. I. Novobrantseva, R. L. Turetskaya, J. E. Green, and S. A. Nedospasov. 1995. Cloning and expression analysis of the murine lymphotoxin beta gene. Proc. Natl. Acad. Sci. USA 92:674-678.[Abstract/Free Full Text]
  80. 41
  81. Roach, D. R., H. Briscoe, B. Saunders, M. P. France, S. Riminton, and W. J. Britton. 2001. Secreted lymphotoxin-alpha is essential for the control of an intracellular bacterial infection. J. Exp. Med. 193:239-246.[Abstract/Free Full Text]
  82. 42
  83. Roach, D. R., H. Briscoe, B. M. Saunders, and W. J. Britton. 2005. Independent protective effects for tumor necrosis factor and lymphotoxin alpha in the host response to Listeria monocytogenes infection. Infect. Immun. 73:4787-4792.[Abstract/Free Full Text]
  84. 43
  85. Scarff, K. L., K. S. Ung, J. Sun, and P. I. Bird. 2003. A retained selection cassette increases reporter gene expression without affecting tissue distribution in SPI3 knockout/GFP knock-in mice. Genesis 36:149-157.[CrossRef][Medline]
  86. 44
  87. Schluter, D., L. Y. Kwok, S. Lutjen, S. Soltek, S. Hoffmann, H. Korner, and M. Deckert. 2003. Both lymphotoxin-alpha and TNF are crucial for control of Toxoplasma gondii in the central nervous system. J. Immunol. 170:6172-6182.[Abstract/Free Full Text]
  88. 45
  89. Sean, R. D., H. Korner, D. H. Strickland, F. A. Lemckert, J. D. Pollard, and J. D. Sedgwick. 1998. Challenging cytokine redundancy: inflammatory cell movement and clinical course of experimental autoimmune encephalomyelitis are normal in lymphotoxin-deficient, but not tumor necrosis factor-deficient, mice. J. Exp. Med. 187:1517-1528.[Abstract/Free Full Text]
  90. 46
  91. Shakhov, A. N., M. A. Collart, P. Vassalli, S. A. Nedospasov, and C. V. Jongeneel. 1990. Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. J. Exp. Med. 171:35-47.[Abstract/Free Full Text]
  92. 47
  93. Tsytsykova, A. V., and A. E. Goldfeld. 2002. Inducer-specific enhanceosome formation controls tumor necrosis factor alpha gene expression in T lymphocytes. Mol. Cell. Biol. 22:2620-2631.[Abstract/Free Full Text]
  94. 48
  95. Udalova, I. A., J. C. Knight, V. Vidal, S. A. Nedospasov, and D. Kwiatkowski. 1998. Complex NF-kappaB interactions at the distal tumor necrosis factor promoter region in human monocytes. J. Biol. Chem. 273:21178-21186.[Abstract/Free Full Text]
  96. 49
  97. Ware, C. F. 2003. The TNF superfamily. Cytokine Growth Factor Rev. 14:181-184.[CrossRef][Medline]
  98. 50
  99. Ware, C. F. 2005. Network communications: lymphotoxins, LIGHT, and TNF. Annu. Rev. Immunol. 23:787-819, 787-819.[CrossRef][Medline]


Molecular and Cellular Biology, June 2006, p. 4214-4225, Vol. 26, No. 11
0270-7306/06/$08.00+0     doi:10.1128/MCB.01751-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Takahashi, M., Galligan, C., Tessarollo, L., Yoshimura, T. (2009). Monocyte Chemoattractant Protein-1 (MCP-1), Not MCP-3, Is the Primary Chemokine Required for Monocyte Recruitment in Mouse Peritonitis Induced with Thioglycollate or Zymosan A. J. Immunol. 183: 3463-3471 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liepinsh, D. J.
Right arrow Articles by Nedospasov, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liepinsh, D. J.
Right arrow Articles by Nedospasov, S. A.