MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Win, T. Z.
Right arrow Articles by Wang, S.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Win, T. Z.
Right arrow Articles by Wang, S.-W.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2006, p. 4435-4447, Vol. 26, No. 12
0270-7306/06/$08.00+0     doi:10.1128/MCB.02205-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Fission Yeast Cid12 Has Dual Functions in Chromosome Segregation and Checkpoint Control

Thein Z. Win, Abigail L. Stevenson, and Shao-Win Wang*

Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, United Kingdom

Received 15 November 2005/ Returned for modification 15 December 2005/ Accepted 3 April 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fission yeast Cid12 is a member of the Cid1 family of specialized poly(A) polymerases. Like cells lacking cid1, cid12{Delta} mutants were shown to have checkpoint defects when DNA replication was inhibited. Here, we show that Cid12 is also required for faithful chromosome segregation and that mutation of amino acid residues predicted to be essential for poly(A) polymerase activity resulted in loss of Cid12 function in vivo. Cells lacking Cid12 had an increased chromosome segregation failure rate due to precocious loss of sister chromatid cohesion at the centromere but not along the chromosome arms. In keeping with a recently described function for Cid12 in RNA interference (RNAi)-mediated heterochromatin assembly, this was accompanied by an accumulation of polyadenylated transcripts corresponding to naturally silenced repeat elements within heterochromatic domains, with consequent defects in centromeric gene silencing. These cells also suffered increased meiotic defects, and their viability was dependent on the spindle checkpoint protein Bub1. To account for the effects of Cid12 on various aspects of DNA metabolism, including chromosome segregation and the checkpoint control, we suggest that Cid12 has dual functions in RNAi silencing and regulating mRNA stability.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The accurate transmission of genetic information during cell proliferation depends on chromosome duplication and the subsequent segregation of the sister chromatids to the opposite poles of the cell during mitosis. In eukaryotic cells, duplicated DNA molecules remain physically connected by cohesion from the time of their synthesis in S phase until they are separated in anaphase. Cohesion is a prerequisite for the bipolar attachment of chromatid pairs to the spindle apparatus in mitosis that enables the equal segregation of the duplicated genome to daughter cells long after DNA replication has occurred (15).

Sister chromatid cohesion is mediated by a conserved multiprotein complex called cohesin, which consists of a heterodimer of SMC proteins (Smc1 and Smc3) and two additional proteins, Scc1/Rad21 and Scc3 (15). At the metaphase-to-anaphase transition, dissolution of cohesion is brought about by the cleavage of the Scc1/Rad21 subunit of cohesin, allowing sister chromatid separation (44). In most organisms, cohesin protein complexes are enriched at centromeric repeats (23, 41, 42, 47, 53). The presence of a specialized heterochromatin structure at centromeres is vital for tight physical cohesion between sister centromeres to ensure accurate chromosome segregation (6, 31). Mutations that affect the formation of heterochromatin within centromeres adversely affect chromosome segregation. In the fission yeast Schizosaccharomyces pombe, silencing factors such as the heterochromatin protein 1 homolog Swi6 and the histone H3 Lys-9 methyltransferase Clr4 are required for centromere function and chromosome segregation (1, 29). The RNA interference (RNAi) pathway has also been implicated in heterochromatin assembly and is critical for accurate chromosome segregation (11, 12, 46).

RNAi silencing is triggered by double-stranded RNA, which is processed by the RNase III-like RNase Dicer to produce small interfering RNA (siRNA) molecules of around 21 nucleotides. These siRNAs become incorporated into the RNA-induced transcriptional silencing (RITS) complex, which contains an Argonaute family protein, and direct them to their homologous RNA target (13). In Caenorhabditis elegans, plants, and fungi, RNAi also requires RNA-directed RNA polymerases, which are involved in siRNA and template-directed production of double-stranded RNA (4, 24, 39). Recently, Motamedi et al. (26) identified Rdp1 (the fission yeast RNA-directed RNA polymerase homolog) in a complex with Hrr1 (an RNA helicase) and Cid12 (a member of the Cid1 family) that has RNA-directed RNA polymerase activity (RNA-directed RNA polymerase complex). The RNA-directed RNA polymerase complex physically interacts with the RITS complex in a manner that requires Dicer and Clr4. In cells lacking Cid12, RITS complexes are devoid of siRNA and fail to localize to centrometric DNA repeats to initiate heterochromatin assembly.

In addition to cid12, sequence comparisons have identified five other members of the S. pombe cid1 gene family (cid1, cid11, cid13, cid14, and cid16) (51). Cid1 (for caffeine-induced-death suppressor), the founding member of this family in S. pombe, was identified through its ability, when overexpressed, to confer resistance specifically to the combination of hydroxyurea and caffeine, which overrides the replication checkpoint (50). Cid13 was identified independently based on its ability, when overexpressed, to rescue the hydroxyurea sensitivity of checkpoint rad mutants (34, 36). Biochemical analysis has shown that purified recombinant Cid1 catalyzes polyadenylation in vitro (34) and that immunoprecipitated Cid13-myc from S. pombe incorporated AMP into poly(A) RNA (36). Both Cid1 and Cid13 are cytoplasmic proteins, indicating that their function is likely to be distinct from that of the nuclear poly(A) polymerase (PAP). In Saccharomyces cerevisiae, the Cid1-related protein Trf4 was reported to have DNA polymerase activity in vitro and to be required for the establishment of cohesion during S phase (52). Recently, immunoprecipitates as well as tandem affinity-purified Trf4 proteins from S. cerevisiae were shown to have PAP, but not DNA polymerase, activity (14, 22, 36, 45, 56). However, unlike Cid1 and Cid13, Trf4 is a nuclear protein (48) and is proposed to function together with the exosome in a nuclear surveillance system that targets misfolded or inappropriately expressed RNAs for rapid degradation following addition of an oligo(A) tail (17, 22, 45, 56). Therefore, depending on the cellular localization and perhaps the target RNA, polyadenylation mediated by Cid1-related proteins could lead to different consequences and affect diverse functions.

Here, we describe the characterization of a cid12 mutant and show that, in addition to possessing defects in the checkpoint control, this mutant is defective in chromosome segregation. Consistent with the recently described function in RNAi-mediated heterochromatin assembly, Cid12 is indeed essential for centromere function and normal chromosome segregation during mitosis and meiosis.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fission yeast strains and methods. Conditions for growth, maintenance, and genetic manipulation of fission yeast were met as described previously (25). A complete list of the strains used in this study is given in Table 1. Except where otherwise stated, strains were grown at 30°C in yeast extract (YE) medium or EMM2 minimal medium with appropriate supplements. Where necessary, gene expression from the nmt1 promoter was repressed by the addition of 15 µM thiamine to the growth medium. Cell concentration was determined with a Sysmex F-800 cell counter (TOA Medical Electronic, Japan).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Yeast strains used in this study

 
Mitotic chromosome stability test. Minichromosome loss rates were measured as described previously (1). Briefly, cells from ade+ colonies were plated on YE plates and incubated at 30°C for 5 days. The number of colonies with a red sector covering at least half of the colony was counted. The rate of chromosome loss per division is the number of these half-sectored colonies divided by the total number of white colonies plus half-sectored colonies.

Plasmids and site-directed mutagenesis. pREP1cid12 was constructed by PCR amplification of the cid12 open reading frame from S. pombe genomic DNA, using the primer pair CID12F (TTTGTCGACGGTAAAGTCCTGTTAGAGCTGCAT) and CID12R (TTTGCGGCCGCTTATCCGCCAGCTTGTAATTCA), followed by digestion with SalI and NotI and subsequent ligation into SalI- and NotI-cleaved pREP3-HA3, a derivate of pREP3X encoding a triple hemagglutinin (HA) tag beginning with an ATG codon between the XhoI and SalI sites. PCR using primers CID12R and DADAF (GAACAACATTATCTATAAGTGCTGTAGCTGTATCTTTGAAGTCACCTCGA) and primers CID12F and DADAR (CGAGGTGACTTCAAAGATACAGCTACAGCACTTATAGATAATGTTGTTCC) was used to generate the cid12 open reading frame in two fragments overlapping by 49 bp, with the region of overlap spanning codons 77 and 79, which were altered in the primer sequence to alanine rather than the aspartate residues specified by the wild-type gene at these positions. The resulting fragments were mixed and used in a secondary PCR with primers CID12F and CID12R. After digestion with SalI and NotI, the final product was ligated into pREP3-HA3 to generate pREP1cid12DADA. All plasmid constructions were confirmed by complete sequencing of the inserts using an ABI sequencer and ABI PRISM dRhodamine reagents (Applera United Kingdom).

Microscopy. Cells fixed in 70% ethanol were rehydrated and stained with 4',6'-diamidino-2-phenylindole (DAPI) before examination by fluorescence microscopy. Visualization of green fluorescent protein (GFP) in living cells, embedded in 0.6% low-melting-point agarose after staining with Hoechst 33342 (5 µg/ml), was performed at room temperature as previously described (33). Images were acquired using a Zeiss Axioplan 2 microscope equipped with a Planapochromat 100x objective, an Axiocam cooled charged-coupled-device camera, and Axiovision software (Carl Zeiss, Welwyn Garden City, United Kingdom) and were assembled using Adobe PhotoShop.

ChIP. Chromatin immunoprecipitation (ChIP) was performed as described previously (32). To immunoprecipitate Rad21-HA proteins, mouse anti-influenza HA monoclonal HA-11 (Babco, Berkeley, CA) was used and then PCR amplified with primer pairs specific for the centromeric dh repeat, RT-PCR1 and RT-PCR2 (GAAAACACATCGTTGTCTTCAGAG and CGTCTTGTAGCTGCATGTGAA) (26), and for fbp1, FBPF and FBPR (AATGACAATTCCCCACTAGCC and ACTTCAGCTAGGATTCACCTGG).

RNA isolation and reverse transcriptase PCR (RT-PCR). Total RNA was isolated by hot phenol extraction and purified using RNeasy (QIAGEN). A portion (0.5 µg) of total S. pombe RNA was reverse transcribed (SuperScript; Invitrogen) using a random primer and then PCR amplified with primer pairs RT-PCR1 and RT-PCR2 (26) and ACTF and ACTR (CCAAATCCAACCGTGAGAAG and TGGGTAACACCATCACCAGA) with 30 and 20 PCR cycles, respectively.

PCR poly(A) test. Polyadenylation tests were performed according to the rapid amplification of cDNA ends poly(A) test (RACE-PAT) method as described previously (38) by using an RT-PCR kit (SuperScript; Invitrogen) with an oligo(dT) anchor primer, GCGAGCTCCGCGGCCGCG-T12, and the RT-PCR1 primer. PCR products were cloned (TOPO TA cloning kit; Invitrogen) and sequenced using an ABI sequencer and ABI PRISM dRhodamine reagents (Applera United Kingdom).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Deletion of cid12 leads to loss of checkpoint control when Pol {delta} or {varepsilon} is inhibited. Cid12 is a member of the Cid1 family (51). Like cells lacking cid1, cid12{Delta} mutants are hypersensitive to the combination of hydroxyurea and low-dose caffeine, which overrides the replication checkpoint (50). In addition, deletion of cid12 resulted in accelerated loss of viability when either cdc27 (which encodes subunit of polymerase Pol {delta}) or cdc20 (which encodes Pol {varepsilon}) was inhibited by temperature-sensitive mutation (Fig. 1). In each case, the single parental cdc (for "cell division cycle") mutants arrested with the characteristic phenotype and displayed substantial retention of cell viability after the shift to the restriction temperature. The cid12{Delta} strain itself displayed no loss of viability after the shift to 36°C (data not shown). Strains carrying the cid12 deletion in combination with cdc27-P11 or cdc20-P7 failed to arrest with the cdc phenotype and displayed substantial loss of viability within 6 h after the shift to the restrictive temperature. The loss of viability correlated with the appearance of cells with the "cut" phenotype, in which septation is executed without nuclear division. Significantly elevated levels of cut cells were seen by 4 h after the temperature shift, at which time all of the cdc20-P7 cells were in G1 or S phase (9). Thus, the DNA replication checkpoint, which is normally intact in cdc20-P7 cells, can be disrupted by deletion of cid12.


Figure 1
View larger version (61K):
[in this window]
[in a new window]
 
FIG. 1. Deletion of cid12 leads to loss of checkpoint control when Pol {delta} or {varepsilon} is inhibited. (A) The Pol {delta} (cdc27) or (B) Pol {varepsilon} (cdc20) strain and the respective double mutants with cid12{Delta}, as indicated, were grown in liquid culture to mid-logarithmic phase at 26°C and shifted to 36°C, the restrictive temperature. Samples of 500 cells taken at the indicated times after the shift to 36°C were plated in duplicate onto YE agar and incubated at 26°C. After 5 days of growth, viability was scored as a percentage of the number of colonies formed by the sample taken at time zero. Samples taken at the same time points were fixed, DAPI stained, and examined by fluorescence microscopy. The percentage of each sample exhibiting the cut phenotype was scored a total of at least 200 cells for each time point. Fluorescence micrographs show representative fields of DAPI-stained cells of the indicated strains grown at 26°C or 6 h after the shift to 36°C. Cut cells are indicated by arrowheads. Bar, 10 µm. (C) Tenfold serial dilutions of the strains indicated were spotted onto YE agar plates and were photographed after 3 days of incubation at 26°C or 32°C, as indicated.

 
To address the relationship between cid12 and the checkpoint genes, we constructed strains carrying the cdc27-P11 mutation in combination with the cid12{Delta} and/or checkpoint rad mutation and compared the temperature sensitivities of the triple mutants and the respective double mutants. As shown in Fig. 1C, combination of the temperature-sensitive cdc27-P11 mutation with cid12{Delta} and/or checkpoint mutations revealed a synergistic growth inhibition effect at 32°C. We found that the cdc27 cid12{Delta} rad1{Delta} mutant was no more sensitive than the cdc27 rad1{Delta} mutant. This finding indicates that Cid12 acts in a pathway that requires the correct operation of the checkpoint Rad group of proteins. Earlier studies show that much of the loss of checkpoint integrity in the cdc27 rad1{Delta} strain is attributable to failure to signal through Chk1 rather than through Cds1 (51). Combining the cid12 mutation with the cdc27 cds1{Delta} double mutation yielded a strain more sensitive than the cdc27 cds1{Delta} or cdc27 cid12{Delta} mutant. A strain that combined the cid12 mutation with the cdc27 chk1{Delta} double mutation did not show additional sensitivity (being no more sensitive than the most sensitive mutant). In the classic interpretation of epistasis data, mutations that do not lead to increased sensitivity when combined act in the same pathway and mutations which do increase sensitivity when combined are in different pathways. Applying this interpretation, our data show that Cid12 functions in the Chk1-mediated checkpoint rad-dependent mitotic arrest but is not required for the Cds1-mediated pathway.

Fission yeast Cid12 is required for normal chromosome segregation. In addition to the defects in checkpoint control, we found that deletion of cid12 led to an increased chromosome segregation failure rate by use of a standard minichromosome assay with strains containing the nonessential ade6-M216-marked Ch16 minichromosome derivative of chromosome 3 (30). The ade6-M216 allele complements an unlinked ade6-M210 marker in these strains such that they remain ade+ as long as the minichromosome is maintained. As shown in Fig. 2B, ade sectored colonies, indicative of chromosome loss, were readily detectable in cid12{Delta} mutants. Quantitative measurements indicated that cid12{Delta} mutants lose minichromosomes at least 20-fold more frequently than the cid12+ control (average of four independent clones). In line with the elevated rate of minichromosome loss, cid12{Delta} mutants had a significantly higher percentage of cells with lagging chromosomes during late anaphase than wild-type cells (Fig. 2C). Chromosome segregation defects at the frequency seen would be sufficient to account for the elevated rate of minichromosome loss in cid12{Delta} cells. Interestingly, the chromosome segregation defects were found to be dependent on the conserved aspartate residues 77 and 79 in the nucleotidyltransferase motif (GSX10DXD) of Cid12 (Fig. 2A), which are known to be essential for the catalytic activity of this protein family (35). When expressed in the cid12{Delta} strain from the nmt1 promoter in the plasmid pREP1cid12DADA in the presence of thiamine, this mutant form of Cid12, unlike the wild-type protein, was unable to suppress the chromosome segregation defects in these cells (Fig. 2C).


Figure 2
View larger version (43K):
[in this window]
[in a new window]
 
FIG. 2. Deletion of cid12 leads to an increased chromosome segregation failure rate. (A) Alignment of the nucleotidyltransferase motif (GSX10DXD) of Cid12 with those of Cid1 and Cid13. Asterisks indicate the conserved aspartate residues, which were altered to alanine in the Cid12DADA mutant. (B) Rates of minichromosome loss were calculated for strains HM248 (cid12+) and SW573 (cid12{Delta}) as described in Materials and Methods and are expressed as mean chromosome loss per division (average of four independent clones). Mean loss rates were 0.029 and 0.0014 per division for cid12{Delta} and the wild type (cid12+), respectively. Arrowheads in the right-hand panel indicate examples of ade sectored colonies, indicative of chromosome loss. (C) Fluorescence micrographs showing lagging chromosome in living cid12{Delta} cells. The spindle (GFP-Atb2) is shown in green and DNA (Hoechst) in blue. Bar, 10 µm. Percentages of cid12{Delta} cells containing the indicated plasmids with lagging chromosome in late anaphase are given. (D) Tenfold serial dilutions of HM123 (cid12+) and cid12{Delta} strains containing the indicated plasmids were spotted onto EMM agar containing 15 µg/ml TBZ or no drug (Control) in the presence of 15 µM thiamine. Plates were photographed after 3 to 5 days of incubation at 30°C. Strains were streaked in parallel onto YE agar plates (E) or EMM agar in the presence of 15 µM thiamine (F) and photographed after 3 days of incubation at 26°C or 32°C, as indicated.

 
Consistent with the chromosome segregation defects, we found that cid12{Delta} cells were hypersensitive to the spindle poison thiabendazole (TBZ) (Fig. 2D) and that deletion of cid12 showed synthetic lethality with the nda3-KM311 ß-tubulin mutation (16) at 26°C, at which temperature the cold-sensitive nda3-KM311 single mutant is still able to grow (Fig. 2E). In line with previous results, the sensitivity to TBZ and synthetic growth defects in combination with the nda3 mutation were found to be dependent on the conserved aspartate residues in the nucleotidyltransferase motif of Cid12 (Fig. 2D and F). We conclude that loss of a nucleotidyltransferase activity requiring aspartates 77 and/or 79 is responsible for the chromosome segregation defects in cid12 mutants.

Mitotic behavior of centromeric DNA in cid12{Delta} cells. One possible explanation for the mitotic defects in cid12{Delta} cells would be that, in the absence of Cid12, some aspect of centromere function or spindle microtubule attachment is defective in a significant proportion of cells. To test whether the observed chromosome segregation defects are in part due to defects in centromeric cohesion, we performed ChIP analysis with strains carrying an epitope-tagged version of the cohesin subunit Rad21 (42). Although Rad21 was preferentially enriched at the centromeres of wild-type cells, we observed a considerable reduction in its localization at the centromeres of cid12{Delta} cells (Fig. 3A), indicating defects in the recruitment of cohesion to centromeres. Next, we further examined centromere function in cid12{Delta} mutants by monitoring green fluorescent protein associated with the centromere of chromosome 1 (cen1-GFP) (28) and the chromosome arm at the cut3 locus (cut3-GFP, which is located at the middle of the left arm of chromosome 2) (27). Cells were arrested in metaphase by inactivation of nda3. As shown in Fig. 3B, single cen1-GFP signals were detected in the majority of nda3-KM311 cells, whereas in cid12{Delta} nda3-KM311 cells, sister centromeres were clearly separated, forming two distinct signals in the mitotic arrested cells. In addition, cells displaying two separated cut3-GFP signals were dramatically reduced in cid12{Delta} nda3-KM311 cells compared with cells with separated cen1-GFP signals (17% and 46%, respectively). These data indicate that Cid12 deficiency preferentially disrupts cohesion at the centromere but not along the chromosome arms.


Figure 3
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. Mitotic behavior of centromeric DNA in wild-type and cid12{Delta} cells. (A) ChIP analysis of Rad21-HA in wild-type and cid12{Delta} mutant strains by use of the HA-11 antibody. Relative enrichments (n-fold) of dh centromeric repeats are indicated beneath each lane. As a control, wild-type cells in which Rad21 was not tagged were used. T, total; IP, immunoprecipitation. (B) Fluorescence micrographs showing centromere-marked GFP (cen1-LacO GFP-LacI-NLS) localization in nda3-KM311 and cid12{Delta} nda3-KM311 cells in EMM medium after incubation at 20°C for 8 h. Bar, 10 mm. Percentages of cells with separated GFP signals associated with the centromere of chromosome 1 (cen1-GFP) and the arm at the cut3 locus (cut3-GFP, which is located at the middle of the left arm of chromosome 2) in the indicated strains are shown (n = 200). (C) Wild-type (cid12+) or cid12{Delta} cells containing centromere-marked GFP (cen1-LacO GFP-LacI-NLS) and Cut12-CFP (the kinetochore and SPB marker) were observed by fluorescence microscopy. Arrowheads indicate examples of cen1-GFP dissociated from SPBs during mitosis. Bar, 10 µm. (D) Fluorescence micrographs showing Ndc80-GFP localization in living wild-type (cid12+) and cid12{Delta} cells. Representative GFP signals in mitotic cells are shown. Percentages of cells with separated Ndc80-GFP signals in each strain are shown (n = 200). (E) Fluorescence micrographs showing CFP-Cnp1 localization in wild-type, cid12{Delta}, and mis6-302 cells after incubation at 36°C for 6 h. Bar, 10 µm.

 
Sister chromatid cohesion is required for the establishment of bipolar attachments to the spindle microtubules and hence for accurate chromosome segregation. In order to define the cid12{Delta} defects more precisely, we next thought to visualize the centromere of a single chromosome with regard to spindle dynamics. We constructed wild-type and cid12{Delta} strains expressing both Cut12-CFP, a spindle pole body (SPB) marker (7), and GFP-LacI-NLS (where NLS is nuclear localization signal) with integrated centromeric lacO repeats (cen1-GFP) (28). The SPBs and cen1-adjacent DNA could thus be observed in the same cells. Consistent with the results shown above, biorientation of sister centromeres toward the spindle ends was defective in cid12{Delta} cells, as two cen1-GFP dots often failed to colocalize to the SPBs even after anaphase (Fig. 3C). These results were further supported by examination of kinetochore behavior in these mutants by the use of a strain expressing a GFP-tagged version of the kinetochore component Ndc80 (54). As shown in Fig. 3D, Ndc80-GFP appeared as a single fluorescent spot in interphase cells and was distributed as a series of dots along the spindle in mitotic cells. Upon entry into anaphase, these Ndc80-GFP signals coalesce into two dots that colocalize with the SPBs and then move to the ends of the cell. Although not extremely frequent, the proportion of cells with Ndc80-GFP dots distributed along the spindle increased in cid12 mutants (7.2% compared with 2.1% in wild-type cells, n = 200). More strikingly, these Ndc80-GFP signals often failed to colocalize to the SPBs in these cells (42%) even after the onset of anaphase B, showing chromosome missegregation that was not observed to occur in the wild-type cells. The chromosome segregation defects described above shared some similarity with phenotypes caused by mutation in components localized at the central core of centromeres, such as Mis6, an inner centromere protein (37). However, unlike mis6 mutants, in the absence of Cid12 Cnp1, the centromere-specific histone H3 variant (40) remained associated with the centromere, seen as single dots near the nuclear periphery in interphase cells (Fig. 3E), indicating that the central core is not defective in cid12 mutants. We conclude that one of the mitotic roles of Cid12 is to facilitate the attachment of the kinetochore to the mitotic spindle during prometaphase to ensure accurate chromosome segregation through the establishment of centromeric cohesion.

The spindle checkpoint is activated in cid12 mutants. Despite the chromosome segregation defects described above, cid12{Delta} mutants are nonetheless viable, indicating that the spindle checkpoint might be required for the survival of these cells. To address this point, we examined the localization of spindle checkpoint protein Bub1 (5). In wild-type cells, the Bub1 signal at the kinetochore is visible only in early mitotic cells (10, 43). In contrast, in cid12{Delta} mutants, Bub1 dots were observed more frequently (2.5% of the population compared with 0.6% in wild-type cells, n = 500) and often consisted of multiple dots (Fig. 4A). This phenomenon was further explored by time-lapse microscopy. As shown in Fig. 4B, in wild-type cells, Bub1-GFP localized to the kinetochore transiently (<1 min) and then disappeared. In contrast, Bub1-GFP localized to the kinetochore for a much longer period in cid12{Delta} mutants (more than 4 min) and two or three discrete Bub1-GFP dots were often observed in these cells. Live analysis revealed dynamic movement of Bub1-GFP in these mutants, as single Bub1 dots appeared and then split into two or three dots before disappearing. Consistent with previous findings, these results indicate that in the absence of Cid12 Bub1 localized to the kinetochores and that each sister chromatid displayed rapid oscillation between the two poles before the onset of anaphase. Furthermore, the prolonged association of Bub1 with the centromere was also observed to occur in rdp1{Delta} mutants (Fig. 4A and B), in keeping with recently described results that Cid12 is in a complex with RNA-directed RNA polymerases (26).


Figure 4
View larger version (59K):
[in this window]
[in a new window]
 
FIG. 4. The spindle checkpoint is activated in cid12{Delta} mutants. (A) Fluorescence micrographs showing Bub1-GFP localization at the kinetochores in the indicated strains. Percentages of cells with Bub1 localization at the kinetochores in each strain are indicated. Bar, 10 µm. (B) Time-lapse imaging of Bub1-GFP was performed at 30-s intervals (shown at top) with the indicated strains. Horizontal lines mark the periods during which Bub1-GFP at the kinetochores was visible. Multiple Bub1-GFP dots in cid12{Delta} and rdp1{Delta} cells are shown with arrowheads. (C) Tenfold serial dilutions of the wild-type strain (HM123) and the other strains indicated were spotted onto YE agar. Plates were photographed after 3 days of incubation at 30°C. The doubling time of each strain grown in YE liquid cultures at 30°C is shown. (D) Slow growth of cid12{Delta} bub1{Delta} cells is associated with chromosome segregation defects. Fluorescence micrographs of methanol-fixed, DAPI-stained cells from exponentially growing YE liquid cultures of the wild-type strain (HM123) and the other indicated strains are shown. Arrowheads indicate cells which contained numerous DAPI-staining bodies, indicative of fragmented chromosomes. Bar, 10 µm.

 
Consistent with these persisting Bub1 signals observed, cid12{Delta} mutants were delayed in progression through anaphase, with an increased proportion of metaphase/anaphase cells (13.8% of the population compared with 6.5% in wild-type cells, n = 500) (Fig. 5A). This phenomenon was further explored with single-cell analysis by time-lapse microscopy. As shown in Fig. 5B, in contrast to wild-type cells, in which the extension of the mitotic spindle occurred rapidly upon entry into anaphase, in cid12{Delta} cells the duration of mitotic spindle extension was greatly prolonged and spindle length extension was temporarily blocked (four out of seven independent samples observed).


Figure 5
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 5. Mitotic behavior of microtubules in cid12{Delta} cells. (A) Percentages of wild-type and cid12{Delta} cells expressing GFP-{alpha}2-tubulin with mitotic spindle are shown (n = 500). Representative examples of cells with metaphase and anaphase spindles are shown. (B) Visualization of mitotic spindle behaviors in living cid12{Delta} cells. Individual wild-type and cid12{Delta} cells expressing GFP-{alpha}2-tubulin were observed over a period of 20 min or 40 min, respectively, with images collected every 4 min (time in minutes shown at right). Bar, 10 µm.

 
The increased frequency of Bub1 foci suggested an involvement of the spindle checkpoint machinery in the absence of Cid12. This was reflected in the prolonged generation time of the double mutant (21.5 h compared with 2.5 and 2.7 h for the cid12{Delta} and bub1{Delta} single mutants, respectively [Fig. 4C]). In addition, these cells often contained numerous DAPI-staining bodies, indicative of fragmented chromosomes (Fig. 4D) that were not observed with the single mutants. We conclude that the spindle checkpoint is required for the survival of cid12{Delta} cells.

Cid12 and the RNAi machinery. Motamedi et al. (26) recently showed that cells lacking Cid12 fail to initiate heterochromatin assembly and are defective in centromeric gene silencing. In line with these data, we found that deletion of cid12 abolished silencing of the reporter gene ade6+ located at the outermost centromeric repeat region otr1R and produced colonies on plates limiting for adenine to the same extent as deletion of chp1, whereas wild-type cells efficiently silenced otr1R::ade6+ expression and failed to produce colonies (Fig. 6A). These defects in heterochromatin assembly would be sufficient to account for the chromosome segregation defects in cid12{Delta} cells.


Figure 6
View larger version (39K):
[in this window]
[in a new window]
 
FIG. 6. Cid12 and RNAi machinery. (A) The indicated strains with an otr1R-inserted ade6+ allele were spotted onto EMM agar plates without adenine and were photographed after 3 days of incubation at 30°C. (B) Total RNA from cultures of indicated strains grown at 30°C was reverse transcribed using a random primer and then PCR amplified with primer pairs specific for the centromeric repeat (cen) and actin (act1). RT-PCR products were separated on a 1% agarose gel. A non-reverse-transcribed negative control (–RT) was included. (C) Schematic diagram of the primers for the RACE-PAT. (D) Total RNA from cultures of the indicated strains grown at 30°C was reverse transcribed with the oligo(dT) anchor primer AT and then PCR amplified with AT and forward primer RT-PCR1 specific for the centromeric repeat. RT-PCR products were separated on a 1.5% agarose gel. Markers in base pairs are indicated. (E) 3'-terminal sequence of subcloned reverse transcription products. The cen1 genomic sequence is shown at the top as a representative. Note that clones 4 and 5 were derived from different centromeres.

 
To further explore the role of cid12 in centromeric gene silencing, we analyzed the centromeric transcripts in cid12{Delta} cells and mutants defective in RNAi machinery. In wild-type cells, pericentromeric transcripts are quickly converted into siRNA and are barely detectable, whereas the reverse is true in mutants defective in RNAi machinery, such as rdp1{Delta} and dcr1{Delta} mutants (46). RT-PCR analyses of total RNA extracted from cid12{Delta} mutants showed that transcripts from the pericentromeric region accumulated to levels comparable to those of the rdp1{Delta} and dcr1{Delta} strains (Fig. 6B). In line with the proposed model that these proteins function in the same pathway, transcript levels in the cid12{Delta} rdp1{Delta} and cid12{Delta} dcr1{Delta} double mutants were similar to those in the rdp1{Delta} and dcr1{Delta} single mutants. Similar results were obtained with strand-specific RT-PCR (data not shown). Furthermore, the function of cid12 in centromeric gene silencing was found to be dependent on the conserved aspartate residues 77 and 79 in the nucleotidyltransferase motif of Cid12 (Fig. 6B). In line with the chromosome segregation defects, when expressed in the cid12{Delta} strain from the nmt1 promoter in the plasmid pREP1cid12DADA in the presence of thiamine, this mutant form of Cid12, unlike the wild-type protein, was unable to suppress the accumulation of centromeric transcript. Taken together, these results were consistent with the function of Cid12 in chromosome segregation mediated by the RNAi machinery. Furthermore, we found that, despite the overlapping function in checkpoint control, the function in RNAi silencing appears to be specific to cid12, as no accumulation of centromeric transcripts was observed to occur in cells carrying deletion of other cid genes, including cid1, cid11, and cid13 (data not shown).

Centromeric transcripts in cid12{Delta} mutants contain poly(A) tails. Recently, RNA polymerase II has been implicated in generating centromeric transcripts required for RNAi-directed chromatin silencing (8, 19). One possible role of Cid12 in centromeric gene silencing would be to act as a specialized poly(A) polymerase, together with Pol II, in generating centromeric transcripts. To address this point, we attempted to determine the polyadenylation states of these transcripts by using a RACE-PAT (38). Total RNA extracted from wild-type cells and cid12{Delta} mutants was reverse transcribed with an anchored oligo(dT)12 primer (AT) and then PCR amplified with the same AT and either of two strand-specific primers. As shown in Fig. 6D, use of the primer corresponding to the forward transcripts yielded a distinctive product in the cid12{Delta} mutants but not in the wild-type strain, which is consistent with the rapid turnover of centromeric transcripts by the RNAi machinery in these cells. Similar results were obtained with the rdp1{Delta}, dcr1{Delta}, and cid12{Delta} double or single mutants (data not shown). The PCR-amplified products were subcloned and sequenced. As shown in Fig. 6E, each of the five randomly selected clones contained a poly(A) sequence 12 to 60 nucleotides long downstream of sequences corresponding to the pericentromeric repeats. There is no templated poly(A) tract in this region, suggesting that the poly(A) detected in this assay was not due to nonspecific priming. We concluded that the centromeric transcripts observed with cid12{Delta} mutants contained poly(A) tails. Although it has been reported that reverse transcripts were polyadenylated to a certain level (8), we were not able to detect any polyadenylated products by using an approach similar to that described above (data not shown). Taken together, these results suggest that transcription and polyadenylation of the pre-siRNA transcripts are independent of Cid12.

RNAi machinery and checkpoint control. Given the diverse functions of the RNAi-related pathway in other systems, we asked whether or not the role of cid12 in checkpoint control reported here might be linked to the involvement of the RNAi machinery in gene regulation and/or mRNA processing. To address this point, we determined the genetic interaction between cdc27-P11 and rdp1{Delta}. As shown in Fig. 7A, in contrast to results for the cdc27-P11 cid12{Delta} mutants, no synthetic growth defect was observed with the cdc27-P11 rdp1{Delta} double mutants. After the shift to the restrictive temperature of 36°C, the cdc27-P11 rdp1{Delta} strain, like the parental cdc27-P11 strain and unlike the cdc27-P11 cid12{Delta} mutant, arrested with the cdc phenotype, i.e., appeared as elongated cells with a single nucleus, and displayed substantial retention of cell viability (Fig. 7B). These data suggested that the checkpoint function of cid12 is independent of the RNAi machinery.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 7. Genetic interaction between cdc27 and mutants defective in the RNAi machinery. (A) Tenfold serial dilutions of the strains indicated were spotted onto YE agar plates and were photographed after 3 days of incubation at 26°C or 32°C, as shown. (B) cdc27-P11 strains and the respective double mutants with rdp1{Delta} or cid12{Delta}, as indicated, were grown in liquid culture to mid-logarithmic phase at 26°C and shifted to 36°C, the restrictive temperature. Samples of 500 cells taken at the indicated times after the shift to 36°C were plated in duplicate onto YE agar and incubated at 26°C. After 5 days of growth, viability was scored as a percentage of the number of colonies formed by the sample taken at time zero. Fluorescence micrographs show representative fields of DAPI-stained cdc27-P11 rdp1{Delta} cells grown at 26°C or 6 h after the shift to 36°C. Bar, 10 mm.

 
Meiosis is frequently abnormal in the absence of cid12. Having established that Cid12 has a role in the mitotic cycle, we were interested to see whether or not Cid12 also plays a role in meiosis. As shown in Fig. 8A, induction of meiosis and sporulation in a homozygous cid12{Delta} diploid strain gave rise to asci, 42.5% of which had more than four DAPI-staining bodies, while others were misshapen and abnormally sized and had substantially reduced viability. Completion of meiosis at the normal frequency thus depends on Cid12 function at some level.


Figure 8
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 8. Meiotic defects in the absence of cid12. (A) Fluorescence micrographs of ethanol-fixed, DAPI-stained cells of sporulating cid12{Delta}/cid12{Delta} and wild-type (cid12+/cid12+) strains are shown. Arrowheads indicate examples of asci with aberrant DAPI-staining bodies. The percentages of asci containing four, five, or six DAPI-staining bodies (noted at bottom of left graph) and overall spore viability of the indicated strains are shown. Bar, 10 µm. (B) One of the homologs in the wild-type (cid12+/cid12+) and cid12{Delta}/cid12{Delta} strains was marked with cen1-GFP to monitor segregation patterns during meiosis. The percentages of asci with the different segregation patterns indicated were determined by fluorescence microscopy. MI, meiosis I; MII, meiosis II.

 
To determine whether Cid12 is required for centromere function in meiosis, we marked a centromere-linked sequence (cen1-GFP) on only one of the two homologs in a zygote and monitored segregation of the GFP dots during meiosis. Chromosome segregation during meiosis and that during mitosis are distinct processes. At the first reductional meiotic division, sister chromatids remain associated at their centromeres and move to the same pole. Centromeric cohesion is lost as cells exit from meiosis II, and sister chromatids can then separate (Fig. 8B shows two adjacent spores at each end of the tetrad that are products of the second meiotic division). In contrast, two GFP signals observed at opposite poles, indicating that sister chromatids segregate equationally rather than reductionally in meiosis I, were detectable in 20% of cid12{Delta} cells. In addition, in cid12{Delta} cells, at meiosis II sister chromatids failed to segregate properly, undergoing nondisjunction in approximately 15% of cells. Because the preserved centromeric cohesion during meiosis I is required for the reductional chromosome segregation and subsequent bipolar attachment of sister chromatids to spindle microtubules at meiosis II to ensure faithful disjunction, these results indicate that centromeric function is defective in a significant proportion of cid12{Delta} cells. Taken together, these data suggest that Cid12 is required in setting up the meiotic pattern of chromosome segregation.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Cid1 family of nucleotidyltransferases is widespread in eukaryotes (21). Members of this gene family have been shown to use RNA substrates and define a novel family of poly(A) polymerases (14, 21, 22, 34, 36, 45, 49, 56). In contrast to S. cerevisiae, which has only two Cid1-related proteins with redundant functions, there are six members of this family in fission yeast and these appear to have more diverse functions. In addition to the function in checkpoint control, here we have presented evidence suggesting that this class of enzymes is required for faithful chromosome segregation in S. pombe. In addition to defects in checkpoint control (Fig. 1), Cid12 deficiency disrupts cohesion specifically at the centromere but not along the chromosome arms (Fig. 3B). These cells suffered increased spontaneous chromosome loss (Fig. 2B), and their viability was dependent on the spindle checkpoint protein Bub1 (Fig. 4).

In line with the loss of centromeric sister chromatid cohesion, Motamedi et al. (26) recently identified Cid12 in a complex that has RNA-directed RNA polymerase activity. In the absence of functional Cid12, cells were defective in heterochromatin assembly and RNAi pathways. In fission yeast, the preferential loading of cohesin complexes at centromeres depends on the presence of heterochromatin, as Swi6 directly recruits cohesin to the outer repeats (6, 31). The observed chromosome segregation defects in cid12{Delta} cells are therefore likely to be a product of changes in chromatin structure at the centromeres. In S. cerevisiae, the Cid1-related protein Trf4 was reported to be required for the establishment of cohesion during S phase (52). However, the centromere function mediated by Cid12 reported here could not account for the cohesion defects in trf4 mutants, as the budding yeast lacks both any known RNAi component and centromeric heterochromatin, although cohesin is enriched at centromeres (23, 41). Recently, Trf4 was proposed to function together with the exosome in a nuclear surveillance system whose role resembles the role of polyadenylation in bacterial RNA turnover (17, 22, 45, 56). The cohesion defects in trf4 mutants could be due to defects in general protein synthesis or in the turnover of mRNAs of genes specific for cohesion function.

What then might be the role of Cid12 in RNAi silencing? The accumulation of polyadenylated centromeric transcripts in cid12{Delta} mutants (Fig. 6) suggests that Cid12 is not required in generating these pre-siRNA transcripts but rather is involved in their processing to initiate heterochromatin assembly. In line with this model, in cells lacking Cid12, RITS complexes are devoid of siRNA and fail to localize to centromeric DNA repeats to initiate heterochromatin assembly (26). For S. cerevisiae, it has been shown that Trf4-mediated oligoadenylation of RNAs targets them for rapid degradation by the exosome (17, 22, 45, 56). By analogy, polyadenylation mediated by Cid12 might serve as a signal for the recruitment of RNAi machinery in processing pre-siRNA transcripts, although it remains to be determined whether or not Cid12 possesses polyadenylation activity. It is also possible that Cid12 might specifically polyadenylate aberrant centromeric transcripts and target them for degradation, as in the case of Trf4 (17, 22, 45, 56).

In addition to the role of Cid12 in RNAi silencing, our data show that Cid12 plays a role in checkpoint control independently of the RNAi machinery (Fig. 7). At present, the precise role of Cid12 in the regulation of checkpoint control remains unclear. It is conceivable that Cid12 might have an additional function in generating functional mRNA poly(A) tails in the nucleus. Alternatively, given its localization to the cytoplasm as well as in the nucleus (25; our unpublished data), Cid12 might act to extend the poly(A) tails of distinct subsets of cytoplasmic mRNAs to counteract deadenylation and enhance protein synthesis, as in the case of Cid13 (36). Poly(A) tail length is associated with stability and translational efficiency of the mRNA. In the absence of Cid12, mRNA of genes required for checkpoint function might become unstable and/or less efficiently translated. Unlike nuclear PAPs, Cid1-like proteins lack a recognizable RNA-binding domain and probably require an RNA binding partner protein to act as a regulatory subunit and provide substrate specificity (20). It is possible that Cid12 functions in a complex other than the RNA-directed RNA polymerase complex to regulate different functions. The interaction could be transient or involve a minor amount of Cid12 and hence not have been identified in the previous study of Motamedi et al. (26). Experiments are in progress to explore this possibility and to determine the basis of the substrate specificity of Cid12.

In line with previously described data showing that the fission yeast RNAi machinery is required for proper meiosis (11), here we show that Cid12 is also required for the completion of meiosis (Fig. 8). In C. elegans, the Cid1-related protein GLD-2 together with GLD-3 controls various aspects of germ line development, including the mitosis/meiosis decision (18), and Xenopus laevis GLD-2 is required for CPEB-mediated polyadenylation-induced translation during oocyte maturation (3). Whether Cid12 has functions in addition to the centromere/kinetochore attachment during meiosis remains to be determined. Together, these results provide evidence that polyadenylation mediated by Cid1-like proteins participates in the regulation of diverse chromosomal processes during mitosis and meiosis in fission yeast. Cid1-like proteins are widespread in eukaryotes. Studying the ways in which Cid1-like proteins function in lower eukaryotes will provide greater understanding of the biological function of polyadenylation in eukaryotic cells in general.


    ACKNOWLEDGMENTS
 
We thank R. Allshire, A. M. Carr, T. Toda, and Y. Watanabe for yeast strains and C. J. Norbury and S. Kearsey for useful discussions and comments on the manuscript.

This work was supported by The Wellcome Trust Research Career Development Fellowship to S.-W. Wang.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, United Kingdom. Phone: 44 1865 271212. Fax: 44 1865 271192. E-mail: shaowin.wang{at}zoo.ox.ac.uk. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Allshire, R. C., E. R. Nimmo, K. Ekwall, J. P. Javerzat, and G. Cranston. 1995. Mutations derepressing silent centromeric domains in fission yeast disrupt chromosome segregation. Genes Dev. 9:218-233.[Abstract/Free Full Text]

2. Appelgren, H., B. Kniola, and K. Ekwall. 2003. Distinct centromere domain structures with separate functions demonstrated in live fission yeast cells. J. Cell Sci. 116:4035-4042.[Abstract/Free Full Text]

3. Barnard, D. C., K. Ryan, J. L. Manley, and J. D. Richter. 2004. Symplekin and xGLD-2 are required for CPEB-mediated cytoplasmic polyadenylation. Cell 119:641-651.[CrossRef][Medline]

4. Baulcombe, D. 2004. RNA silencing in plants. Nature 431:356-363.[CrossRef][Medline]

5. Bernard, P., K. Hardwick, and J. P. Javerzat. 1998. Fission yeast bub1 is a mitotic centromere protein essential for the spindle checkpoint and the preservation of correct ploidy through mitosis. J. Cell Biol. 143:1775-1787.[Abstract/Free Full Text]

6. Bernard, P., J. F. Maure, J. F. Partridge, S. Genier, J. P. Javerzat, and R. C. Allshire. 2001. Requirement of heterochromatin for cohesion at centromeres. Science 294:2539-2542.[Abstract/Free Full Text]

7. Bridge, A. J., M. Morphew, R. Bartlett, and I. M. Hagan. 1998. The fission yeast SPB component Cut12 links bipolar spindle formation to mitotic control. Genes Dev. 12:927-942.[Abstract/Free Full Text]

8. Djupedal, I., M. Portoso, H. Spahr, C. Bonilla, C. M. Gustafsson, R. C. Allshire, and K. Ekwall. 2005. RNA Pol II subunit Rpb7 promotes centromeric transcription and RNAi-directed chromatin silencing. Genes Dev. 19:2301-2306.[Abstract/Free Full Text]

9. D'Urso, G., and P. Nurse. 1997. Schizosaccharomyces pombe cdc20+ encodes DNA polymerase epsilon and is required for chromosomal replication but not for the S phase checkpoint. Proc. Natl. Acad. Sci. USA 94:12491-12496.[Abstract/Free Full Text]

10. Garcia, M. A., N. Koonrugsa, and T. Toda. 2002. Spindle-kinetochore attachment requires the combined action of Kin I-like Klp5/6 and Alp14/Dis1-MAPs in fission yeast. EMBO J. 21:6015-6024.[CrossRef][Medline]

11. Hall, I. M., K. Noma, and S. I. Grewal. 2003. RNA interference machinery regulates chromosome dynamics during mitosis and meiosis in fission yeast. Proc. Natl. Acad. Sci. USA 100:193-198.[Abstract/Free Full Text]

12. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.[Abstract/Free Full Text]

13. Hannon, G. J. 2002. RNA interference. Nature 418:244-251.[CrossRef][Medline]

14. Haracska, L., R. E. Johnson, L. Prakash, and S. Prakash. 2005. Trf4 and Trf5 proteins of Saccharomyces cerevisiae exhibit poly(A) RNA polymerase activity but no DNA polymerase activity. Mol. Cell. Biol. 25:10183-10189.[Abstract/Free Full Text]

15. Hirano, T. 2002. The ABCs of SMC proteins: two-armed ATPases for chromosome condensation, cohesion, and repair. Genes Dev. 16:399-414.[Free Full Text]

16. Hiraoka, Y., T. Toda, and M. Yanagida. 1984. The NDA3 gene of fission yeast encodes beta-tubulin: a cold-sensitive nda3 mutation reversibly blocks spindle formation and chromosome movement in mitosis. Cell 39:349-358.[CrossRef][Medline]

17. Kadaba, S., A. Krueger, T. Trice, A. M. Krecic, A. G. Hinnebusch, and J. Anderson. 2004. Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev. 18:1227-1240.[Abstract/Free Full Text]

18. Kadyk, L. C., and J. Kimble. 1998. Genetic regulation of entry into meiosis in Caenorhabditis elegans. Development 125:1803-1813.[Abstract]

19. Kato, H., D. B. Goto, R. A. Martienssen, T. Urano, K. Furukawa, and Y. Murakami. 2005. RNA polymerase II is required for RNAi-dependent heterochromatin assembly. Science 309:467-469.[Abstract/Free Full Text]

20. Keller, W., and G. Martin. 2002. Gene regulation: reviving the message. Nature 419:267-268.[CrossRef][Medline]

21. Kwak, J. E., L. Wang, S. Ballantyne, J. Kimble, and M. Wickens. 2004. Mammalian GLD-2 homologs are poly(A) polymerases. Proc. Natl. Acad. Sci. USA 101:4407-4412.[Abstract/Free Full Text]

22. LaCava, J., J. Houseley, C. Saveanu, E. Petfalski, E. Thompson, A. Jacquier, and D. Tollervey. 2005. RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121:713-724.[CrossRef][Medline]

23. Laloraya, S., V. Guacci, and D. Koshland. 2000. Chromosomal addresses of the cohesin component Mcd1p. J. Cell Biol. 151:1047-1056.[Abstract/Free Full Text]

24. Mello, C. C., and D. Conte, Jr. 2004. Revealing the world of RNA interference. Nature 431:338-342.[CrossRef][Medline]

25. Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:795-823.[Medline]

26. Motamedi, M. R., A. Verdel, S. U. Colmenares, S. A. Gerber, S. P. Gygi, and D. Moazed. 2004. Two RNAi complexes, RITS and RDRC, physically interact and localize to noncoding centromeric RNAs. Cell 119:789-802.[CrossRef][Medline]

27. Nabeshima, K., Y. Kakihara, Y. Hiraoka, and H. Nojima. 2001. A novel meiosis-specific protein of fission yeast, Meu13p, promotes homologous pairing independently of homologous recombination. EMBO J. 20:3871-3881.[CrossRef][Medline]

28. Nabeshima, K., T. Nakagawa, A. F. Straight, A. Murray, Y. Chikashige, Y. M. Yamashita, Y. Hiraoka, and M. Yanagida. 1998. Dynamics of centromeres during metaphase-anaphase transition in fission yeast: Dis1 is implicated in force balance in metaphase bipolar spindle. Mol. Biol. Cell 9:3211-3225.[Abstract/Free Full Text]

29. Nakayama, J., J. C. Rice, B. D. Strahl, C. D. Allis, and S. I. Grewal. 2001. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly. Science 292:110-113.[Abstract/Free Full Text]

30. Niwa, O., T. Matsumoto, Y. Chikashige, and M. Yanagida. 1989. Characterization of Schizosaccharomyces pombe minichromosome deletion derivatives and a functional allocation of their centromere. EMBO J. 8:3045-3052.[Medline]

31. Nonaka, N., T. Kitajima, S. Yokobayashi, G. Xiao, M. Yamamoto, S. I. Grewal, and Y. Watanabe. 2002. Recruitment of cohesin to heterochromatic regions by Swi6/HP1 in fission yeast. Nat. Cell Biol. 4:89-93.[CrossRef][Medline]

32. Pidoux, A., B. Mellone, and R. Allshire. 2004. Analysis of chromatin in fission yeast. Methods 33:252-259.[CrossRef][Medline]

33. Pidoux, A. L., S. Uzawa, P. E. Perry, W. Z. Cande, and R. C. Allshire. 2000. Live analysis of lagging chromosomes during anaphase and their effect on spindle elongation rate in fission yeast. J. Cell Sci. 113:4177-4191.[Abstract]

34. Read, R. L., R. G. Martinho, S. W. Wang, A. M. Carr, and C. J. Norbury. 2002. Cytoplasmic poly(A) polymerases mediate cellular responses to S phase arrest. Proc. Natl. Acad. Sci. USA 99:12079-12084.[Abstract/Free Full Text]

35. Read, R. L., and C. J. Norbury. 2002. Roles for cytoplasmic polyadenylation in cell cycle regulation. J. Cell. Biochem. 87:258-265.[CrossRef][Medline]

36. Saitoh, S., A. Chabes, W. H. McDonald, L. Thelander, J. R. Yates, and P. Russell. 2002. Cid13 is a cytoplasmic poly(A) polymerase that regulates ribonucleotide reductase mRNA. Cell 109:563-573.[CrossRef][Medline]

37. Saitoh, S., K. Takahashi, and M. Yanagida. 1997. Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation. Cell 90:131-143.[CrossRef][Medline]

38. Salles, F. J., W. G. Richards, and S. Strickland. 1999. Assaying the polyadenylation state of mRNAs. Methods 17:38-45.[CrossRef][Medline]

39. Sijen, T., J. Fleenor, F. Simmer, K. L. Thijssen, S. Parrish, L. Timmons, R. H. Plasterk, and A. Fire. 2001. On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107:465-476.[CrossRef][Medline]

40. Takahashi, K., E. S. Chen, and M. Yanagida. 2000. Requirement of Mis6 centromere connector for localizing a CENP-A-like protein in fission yeast. Science 288:2215-2219.[Abstract/Free Full Text]

41. Tanaka, T., M. P. Cosma, K. Wirth, and K. Nasmyth. 1999. Identification of cohesin association sites at centromeres and along chromosome arms. Cell 98:847-858.[CrossRef][Medline]

42. Tomonaga, T., K. Nagao, Y. Kawasaki, K. Furuya, A. Murakami, J. Morishita, T. Yuasa, T. Sutani, S. E. Kearsey, F. Uhlmann, K. Nasmyth, and M. Yanagida. 2000. Characterization of fission yeast cohesin: essential anaphase proteolysis of Rad21 phosphorylated in the S phase. Genes Dev. 14:2757-2770.[Abstract/Free Full Text]

43. Toyoda, Y., K. Furuya, G. Goshima, K. Nagao, K. Takahashi, and M. Yanagida. 2002. Requirement of chromatid cohesion proteins rad21/scc1 and mis4/scc2 for normal spindle-kinetochore interaction in fission yeast. Curr. Biol. 12:347-358.[CrossRef][Medline]

44. Uhlmann, F., F. Lottspeich, and K. Nasmyth. 1999. Sister-chromatid separation at anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400:37-42.[CrossRef][Medline]

45. Vanacova, S., J. Wolf, G. Martin, D. Blank, S. Dettwiler, A. Friedlein, H. Langen, G. Keith, and W. Keller. 2005. A new yeast poly(A) polymerase complex involved in RNA quality control. PLoS Biol. 3:e189.[CrossRef][Medline]

46. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.[Abstract/Free Full Text]

47. Waizenegger, I. C., S. Hauf, A. Meinke, and J. M. Peters. 2000. Two distinct pathways remove mammalian cohesin from chromosome arms in prophase and from centromeres in anaphase. Cell 103:399-410.[CrossRef][Medline]

48. Walowsky, C., D. J. Fitzhugh, I. B. Castano, J. Y. Ju, N. A. Levin, and M. F. Christman. 1999. The topoisomerase-related function gene TRF4 affects cellular sensitivity to the antitumor agent camptothecin. J. Biol. Chem. 274:7302-7308.[Abstract/Free Full Text]

49. Wang, L., C. R. Eckmann, L. C. Kadyk, M. Wickens, and J. Kimble. 2002. A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature 419:312-316.[CrossRef][Medline]

50. Wang, S. W., C. Norbury, A. L. Harris, and T. Toda. 1999. Caffeine can override the S-M checkpoint in fission yeast. J. Cell Sci. 112:927-937.[Abstract]

51. Wang, S.-W., T. Toda, R. MacCallum, A. L. Harris, and C. Norbury. 2000. Cid1, a fission yeast protein required for S-M checkpoint control when DNA polymerase {delta} or {varepsilon} is inactivated. Mol. Cell. Biol. 20:3234-3244.[Abstract/Free Full Text]

52. Wang, Z., I. B. Castano, A. De Las Penas, C. Adams, and M. F. Christman. 2000. Pol kappa: a DNA polymerase required for sister chromatid cohesion. Science 289:774-779.[Abstract/Free Full Text]

53. Warren, W. D., S. Steffensen, E. Lin, P. Coelho, M. Loupart, N. Cobbe, J. Y. Lee, M. J. McKay, T. Orr-Weaver, M. M. Heck, and C. E. Sunkel. 2000. The Drosophila RAD21 cohesin persists at the centromere region in mitosis. Curr. Biol. 10:1463-1466.[CrossRef][Medline]

54. Wigge, P. A., and J. V. Kilmartin. 2001. The Ndc80p complex from Saccharomyces cerevisiae contains conserved centromere components and has a function in chromosome segregation. J. Cell Biol. 152:349-360.[Abstract/Free Full Text]

55. Win, T. Z., H. W. Mankouri, I. D. Hickson, and S. W. Wang. 2005. A role for the fission yeast Rqh1 helicase in chromosome segregation. J. Cell Sci. 118:5777-5784.[Abstract/Free Full Text]

56. Wyers, F., M. Rougemaille, G. Badis, J. C. Rousselle, M. E. Dufour, J. Boulay, B. Regnault, F. Devaux, A. Namane, B. Seraphin, D. Libri, and A. Jacquier. 2005. Cryptic pol II transcripts are degraded by a nuclear quality control pathway involving a new poly(A) polymerase. Cell 121:725-737.[CrossRef][Medline]


Molecular and Cellular Biology, June 2006, p. 4435-4447, Vol. 26, No. 12
0270-7306/06/$08.00+0     doi:10.1128/MCB.02205-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press