This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, W.
Right arrow Articles by Dutta, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, W.
Right arrow Articles by Dutta, A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2006, p. 4601-4611, Vol. 26, No. 12
0270-7306/06/$08.00+0     doi:10.1128/MCB.02141-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

An ATR- and BRCA1-Mediated Fanconi Anemia Pathway Is Required for Activating the G2/M Checkpoint and DNA Damage Repair upon Rereplication{dagger}

Wenge Zhu and Anindya Dutta*

Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, Virginia 22908

Received 4 November 2005/ Returned for modification 14 December 2005/ Accepted 29 March 2006


arrow
ABSTRACT
 
The timely assembly of prereplicative complexes at replication origins is tightly controlled to ensure that genomic DNA is replicated once per cell cycle. The loss of geminin, a DNA replication inhibitor, causes rereplication that activates a G2/M checkpoint in human cancer cells. Fanconi anemia (FA) is an autosomal recessive and X-linked disorder associated with cancer susceptibility. Here we show that rereplication activates the FA pathway both for the activation of a G2/M checkpoint and for repair processes, like recruitment of RAD51. Both ATR and BRCA1 are required to activate the FA pathway. The G2/M checkpoint-mediated arrest of the cell cycle is critical for the prevention of both apoptosis and the accumulation of cells with rereplicated DNA, because the loss of ATR, BRCA1, or FANCA promotes apoptosis and suppresses the accumulation. The accumulation of cells with rereplicated DNA is restored by the artificial induction of a G2-phase arrest even when ATR, BRCA1, or FANCA is absent. Therefore, the ATR- and BRCA1-mediated FA pathway is required for the activation of a G2/M checkpoint and for DNA damage repair in response to the endogenous signal of rereplication. In its absence, the cells rapidly lose viability when faced with rereplication.


arrow
INTRODUCTION
 
Licensing of origins through the assembly of prereplicative complexes is tightly controlled to ensure that genomic DNA is replicated once per cell cycle. Multiple mechanisms have evolved in cells to prevent rereplication (3, 19). The balance between Cdt1 and geminin is one such mechanism (23, 31). Cdt1 is a replication initiation factor that promotes the assembly of the prereplicative complex (20, 28). Overexpression of Cdt1 in human cells results in rereplication (43), and increased expression of Drosophila melanogaster Cdt1 (Dup) in diploid cells is sufficient to induce polyploidization (40). In Xenopus laevis egg extract, addition of Cdt1 after one round of DNA replication causes rereplication (2). Failure to degrade Cdt1 in S phase causes rereplication in Caenorhabditis elegans, Xenopus, and human cells (16, 35, 49). Geminin plays a critical role in preventing rereplication by limiting Cdt1 activity (34, 46). Rereplication has been reported for both human and Drosophila cells upon depletion of geminin by small interfering RNA (siRNA) (22, 24, 50). Rereplication by loss of geminin activates a G2/M checkpoint that prevents cells from entering mitosis and thus restricts the proliferation of cells with overreplicated DNA. Abrogation of this checkpoint in geminin-depleted cells leads to apoptosis (22, 50). Not much is known about the proteins that sense the rereplication products and activate the checkpoint pathways or about the repair pathways activated by rereplication.

Several genes implicated in chromosome instability syndromes are critical for sensing different types of DNA damage. Fanconi anemia (FA) is an autosomal recessive and X-linked disorder associated with cancer susceptibility (5). FA cells are hypersensitive to DNA cross-linking agents. Eleven FA genes have been cloned out of 12 FA complementation groups, and among these, eight FA proteins (A, B, C, E, F, G, L, and M) form a nuclear complex (FA core complex) that is required for monoubiquitination of FANCD2 after DNA cross-links. Monoubiquitinated FANCD2 interacts with BRCA2 and promotes the assembly of BRCA2 foci. BRCA2 is itself mutated in familial breast cancers and in FA patients from the FA-D1 complementation group and is involved in homology-directed repair (HDR) through its interaction with RAD51 (6, 25, 44, 47). Consistent with the involvement of HDR in this pathway, FANCD2 colocalizes with RAD51. In addition, the FA pathway is required for the formation of RAD51 nuclear foci in response to DNA damage (7, 44, 48). FANCA, FANCG, and FANCD2 also promote HDR (27). Thus, the FA pathway is important for activating HDR DNA repair pathways after DNA damage induced by cross-linking agents.

In addition to their role in DNA repair, FA proteins are involved in checkpoint activation after DNA damage (11, 26, 29, 37). FANCD2 was phosphorylated by ATM and shown to be required for intra-S-phase checkpoint activation but not for G2/M checkpoint activation (37). In contrast, FANCC from the FA core complex was not required for the intra-S-phase checkpoint activation (37) but was required for the activation of the G2/M checkpoint in response to ionizing radiation treatment (10).

Accumulating evidence also indicates that there are genetic and physical interactions between FA genes and the breast cancer susceptibility gene BRCA1. For instance, in response to mitomycin C, the BRCA1–/– cell line HCC1937 shows phenotypes similar to those of FA cells: chromosome instability and increased triradial and tetraradial chromosome formation (32, 41). BRCA1 is required for monoubiquitination and nuclear focus formation of FANCD2 (11). Furthermore, BRCA1 physically interacts with both monoubiquitinated FANCD2 and FANCA (9, 11).

Despite the implication of the FA/BRCA pathway in the cellular response to exogenous DNA-damaging agents, not much is known about whether this pathway responds to endogenous errors of DNA replication. Here, we examine whether the FA/BRCA pathway is involved in the cell's response to rereplication. We find that DNA rereplication generates single-stranded DNA (ssDNA), which is colocalized with chromatin-associated monoubiquitinated FANCD2 and RAD51 nuclear foci, suggesting activation of the HDR pathway. The formation of RAD51 foci is dependent on the activation of FANCD2. The chromatin association of monoubiquitinated FANCD2 is suppressed by silencing of ATR, BRCA1, or FANCA. ATR, BRCA1, or FANCA is required both for the accumulation of rereplicated cells and for G2/M checkpoint activation in geminin-depleted cells. The suppression of ATR, BRCA1, FANCA, or FANCD2 in rereplicating cells leads to apoptosis, suggesting that induction of rereplication may be selectively toxic for cancers with complete loss of BRCA1 or FA pathways. Therefore, the FA/BRCA pathway is involved in responding to rereplication in order to activate checkpoints that prevent cell cycle progression and promote homology-directed repair.


arrow
MATERIALS AND METHODS
 
Cell culture. Human colorectal cancer HCT116 cell lines were grown in 10% fetal bovine serum and 1% penicillin-streptomycin in McCoy's 5A modified medium (Cellgro). HCC1937 cells were grown in 10% fetal bovine serum and 1% penicillin-streptomycin in RPMI 1640 medium (Cellgro).

siRNA. siRNA oligonucleotides (Invitrogen) were made to the following target sequences (sense): geminin (GEM) and control GL2, as described in reference 50; ATR, AAGACGGTGTGCTCATGCGGC (12); BRCA1, CCUGUCUCCACAAAGUGUG; FANCA, GGGUCAAGAGGGAAAAAUA (1); FANCD2, GGAGAUUGAUGGUCUACUA; and cyclin A, AGCCAGTGAGTGTTAATGA. Transfections were performed with 100 nM siRNA oligonucleotide duplexes by using Oligofectamine (Invitrogen) according to the instructions of the manufacturer.

Antibodies, immunoblotting, and immunofluorescence. Rabbit antigeminin was raised as described earlier (46). Rabbit anti-phospho-H2AX (serine 139), rabbit anti-PARPp24, rabbit anti-PARPp85 (Upstate), mouse anti-ß-actin (Sigma), rabbit anti-phospho-Cdc2 (Cell Signaling Technology), rabbit anti-cyclin A (H432), mouse anti-Cdc2, mouse anti-FANCD2, goat anti-ATR (Santa Cruz), rabbit anti-Rad51, mouse anti-BRCA1 (Oncogene), rabbit anti-ORC2 (BD), rabbit anti-FANCA (gift from Alan D'Andrea, Dana-Farber Cancer Institute), and mouse anti-RPA70 (gift from Bruce Stillman, Cold Spring Harbor Laboratory) were used for immunoblotting and immunofluorescence. Western blotting was performed as described earlier (50). Immunofluorescence was performed as follows. Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min and permeabilized with 0.2% Triton X-100 for 10 min at room temperature. Coverslips were blocked with 3% bovine serum albumin in PBS with 0.02% Tween 20 and incubated with primary antibody for 1 to 3 h at room temperature. Cells were then washed and incubated with tetramethyl rhodamine isothiocyanate- or fluorescein isothiocyanate-conjugated secondary antibody (Dako Corporation). Cells were mounted with a solution containing DAPI (4',6'-diamidino-2-phenylindole) (Vector Lab) before being examined under a microscope. To detect ssDNA, cells were labeled with 10 µM BrdU after the first transfection until harvest 72 h later.

Fluorescence-activated cell sorter (FACS) analysis. Cells were collected by trypsinization and fixed with 70% ethanol overnight at 4°C. After fixation, cells were centrifuged and stained in 1 ml of propidium iodide solution (0.05% NP-40, 50 µg/ml propidium iodide, and 10 µg/ml RNase A). The labeled cells were analyzed with a Becton Dickinson flow cytometer by using Cellquest software.

Single-cell gel electrophoresis. Single-cell gel electrophoresis was performed using a Comet assay kit (Trevigen, Inc., Gaithersburg, MD) as described in the manual. Briefly, harvested cells were washed two times with cold PBS at a concentration of 1.5 x 106 cells/ml. Cells were then suspended in molten agarose and transferred to glass slides, which were immersed in lysis buffer for 1 h at 4°C. For neutral unwinding conditions, slides were transferred to a horizontal electrophoresis apparatus in Tris-borate-EDTA and subjected to 10 V for 20 min. Slides were then fixed in 70% ethanol, air dried, and stained with SYBR green. For alkaline unwinding conditions, cells were immersed in 300 mM NaOH for 1 h prior to electrophoresis. To score cells, nuclei with a tail larger than 2 nuclear diameters were counted as positive for DNA damage. The percentage of nuclei with comet tails was the number of nuclei positive for DNA damage divided by the total number of nuclei counted.


arrow
RESULTS
 
Rereplication by depletion of geminin generates both ssDNA and double-stranded DNA breaks. Although single-stranded DNA is generated during rereplication (22), the activation of Chk2 (50) suggests that double-stranded DNA breaks must also be generated. The appearance of ssDNA was measured by detecting previously incorporated BrdU by immunofluorescence with anti-BrdU antibody without prior DNA denaturation (22). Consistent with previous results, BrdU foci were detected in rereplicating cells and the foci colocalized with foci of the single-stranded DNA binding protein RPA70 (data not shown). Accompanying this, there was an increase in association with the chromatin of RPA70, the largest subunit of RPA, upon rereplication by geminin depletion (see Fig. 2A).


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. FA pathway is activated in geminin-depleted cells. (A) Association of RPA70 and FANCD2 with chromatin. HCT116 cells were transfected with control siRNA oligonucleotide GL2 or geminin siRNA oligonucleotide GEM as described in the legend for Fig. 1A. Chromatin fractionation was performed as described by Zou et al. (51). The resultant fractions were resolved on sodium dodecyl sulfate-polyacrylamide gels and immunoblotted with the indicated antibodies (FANCD2-L is monoubiquitinated, and FANCD2-S is unubiquitinated). Orc2 served as a loading control for the chromatin fractions (Chr.) *, protein cross-reacting with anti-ORC2 antibody served as a loading control for the soluble fractions (Sol.). (B) FANCD2 colocalizes with single-stranded BrdU in geminin-depleted cells. HCT116 cells treated as described in the legend for Fig. 1A were immunostained with anti-FANCD2 and anti-BrdU antibodies without denaturation.

Phosphorylated H2AX was detected in geminin-depleted cells (22, 50), suggesting but not proving the presence of double-stranded breaks. To directly look for double-stranded breaks, we utilized single-cell gel electrophoresis (Comet assay). Under neutral conditions, the Comet assay detects primarily double-stranded breaks, while under alkaline conditions, the assay detects both double-stranded breaks and single-stranded breaks. Under both neutral and alkaline unwinding conditions, the Comet assay detected significantly more comet tails in geminin-depleted cells than in control-treated cells (Fig. 1A and B). Thus, double-stranded DNA breaks are generated in geminin-depleted cells, explaining why Chk2 is activated (50).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. Depletion of geminin leads to generation of both ssDNA and double-stranded breaks in human cancer cells. (A) Double-stranded breaks are generated in geminin-depleted cells. HCT116 cells were transfected with control siRNA oligonucleotide GL2 or geminin siRNA oligonucleotide GEM twice and harvested 72 h after the first transfection. Shown are results from the Comet assay done under neutral conditions, which detects primarily double-stranded DNA breaks, and alkaline unwinding conditions, which detects both double-stranded and single-stranded DNA breaks. (B) Percentages of cells with DNA damage under both neutral and alkaline unwinding conditions as shown in panel A. At least 80 cells were counted for each experiment. Means ± standard deviations from two experiments are shown. (C) ssDNA is generated in geminin-depleted cells. HCT116 cells were transfected with control siRNA oligonucleotide GL2 or geminin siRNA oligonucleotide GEM with the addition of BrdU after the first transfection and harvested 72 h after the first transfection. Coimmunostaining with anti-BrdU antibody without denaturation and phospho-H2AX antibody (P-H2AX) (Ser139) is shown.

In addition, the sites of generation of double-stranded breaks could be different from the sites of ssDNA generation. Phosphorylated H2AX, however, colocalized with BrdU (Fig. 1C), suggesting that phosphorylated histone H2AX is physically at the same sites where ssDNA is formed upon rereplication. These results suggest that the single-stranded interruptions in rereplicating chromosomes are close to sites of double-stranded breaks (15).

FA pathway is activated in cells undergoing rereplication. While screening for damage-responsive pathways that might sense rereplication, we discovered that the FA pathway is activated in geminin-depleted cells. In control GL2-treated cells, a small fraction of FANCD2 was associated with chromatin, and the chromatin-associated FANCD2 had lower mobility on electrophoresis, consistent with its monoubiquitinated status (Fig. 2A) (44). In geminin-depleted rereplicating cells, however, a large fraction of FANCD2 was associated with chromatin and was highly monoubiquitinated compared to the GL2-treated cells (Fig. 2A), indicating that the FA pathway is activated in cells undergoing rereplication.

To determine the relationship of FANCD2 loading relative to the sites of rereplication, we took advantage of the fact that the sites of rereplication could be detected cytologically as sites enriched in ssDNA. FANCD2 foci were detected in geminin-depleted cells and colocalized with sites where BrdU was detected without denaturation of DNA (Fig. 2B), indicating that activated FANCD2 was recruited to sites near where ssDNA was produced by rereplication. Therefore, FANCD2 is activated and loaded on chromatin at or near sites of rereplication.

FA proteins involved in FANCD2 activation and checkpoint activation in cells undergoing rereplication. The activation of FANCD2 in geminin-depleted cells led us to test whether FA core complex proteins are involved in this activation. We first examined whether FANCA is required for the loading of FANCD2 to chromatin in geminin-depleted cells, as has been shown after other types of DNA damage (21). In cells with both FANCA and geminin silenced, less FANCD2 was monoubiquitinated and associated with chromatin (Fig. 3A and B, lane 7). In addition, there was an increase in the soluble fraction of FANCD2 (Fig. 3B, lane 3). Therefore, FANCA is upstream from FANCD2 in activation after rereplication.


Figure 3
View larger version (42K):
[in this window]
[in a new window]
 
FIG. 3. FA proteins are required for rereplication and activation of the G2/M checkpoint in geminin-depleted cells. (A) Schematic of transfection protocol. (B) HCT116 cells treated as shown in panel A were fractionated as described in the legend for Fig. 2A. The resultant fractions were resolved on sodium dodecyl sulfate-polyacrylamide gels and immunoblotted with the indicated antibodies. See the legend for Fig. 2A for additional explanations. (C) HCT116 cells treated as shown in panel A were harvested for flow cytometry analysis. Cells with more than G2/M DNA content are regarded as cells with rereplicated DNA. Primary data are shown in Fig. S1 in the supplemental material. (D) HCT116 cells treated as shown in panel A were immunoblotted for the indicated proteins. (E) Cell cycle distribution of transfected cells. HCT116 cells treated as shown in panel A or Fig. 5A were stained with propidium iodide and subjected to FACS analysis. >G2, cells with more than G2/M DNA content (Cellquest).

We next examined the role of the FA pathway in activating the G2/M checkpoint. Abrogation of the G2/M checkpoint suppresses the accumulation of rereplicated cells (50), and so an easy screen for checkpoint activation is to assay the percentage of cells in the culture with more than 4N DNA content. As shown in Fig. 3C (also see Fig. S1 and S5 in the supplemental material), silencing FANCA significantly suppressed the accumulation of rereplicated cells upon geminin depletion. Additionally, the silencing of FANCL suppressed the accumulation of rereplicated cells (data not shown). Therefore, the Fanconi core complex may be required for checkpoint activation. Surprisingly, the cosilencing of FANCD2 with geminin had no influence on the accumulation of rereplicated cells (Fig. 3C) (also see Fig. S1 and S5 in the supplemental material). Therefore, FANCD2, unlike FANCA, was not required for the survival of rereplicated cells after the depletion of geminin.

To confirm the observations made above, we measured the activation of the G2/M checkpoint pathway biochemically. Consistent with our previous results (50), deletion of geminin elevated inhibitory phosphorylation of Cdc2 at Tyr15 (Fig. 3D) (also see Figure S2 in the supplemental material). The silencing of FANCA in geminin-depleted cells suppressed the inhibitory phosphorylation of Cdc2, while the silencing of FANCD2 had no effect on this phosphorylation. Thus, FANCA, but not FANCD2, is required for G2/M checkpoint activation after rereplication, in agreement with the accumulation of rereplicated cells after FANCA, but not FANCD2, depletion.

When the G2/M checkpoint is activated, fewer cells are expected to be in active mitosis. We therefore verified the observations made above by two-color FACS analysis for phospho-histone H3 staining and DNA content (see Fig. S3 in the supplemental material). Consistent with the conclusions described above, geminin depletion decreased the phospho-histone H3-positive 4N cells from 2.73% to 0.88%. Entry into mitosis was restored by codepletion of FANCA (2.03%) but not of FANCD2 (0.38%). A minor (background) percentage of cells had more than 4N DNA content and phosphoH3 staining in all preparations.

Since FANCD2 is monoubiquitinated during S phase in the cell cycle (36), a trivial explanation of the observations discussed above would be that the increase or decrease of FANCD2 ubiquitination merely reflected the percentage of cells in active DNA replication. We therefore measured the distribution of cells in the cell cycle after the various manipulations described above. The percentage of cells in S phase was decreased in geminin-depleted cells compared to the percentage in GL2-treated cells (Fig. 3E), and so an increase in replicating cells cannot explain the ubiquitination of FANCD2. In addition, codepletion of FANCA with geminin increased the S-phase population but decreased FANCD2 ubiquitination. Therefore, the changes in FANCD2 ubiquitination cannot be explained by changes in the population of cells in active DNA replication.

Together, these results suggest that rereplication in human cancer cells leads to monoubiquitination of FANCD2 through FANCA activation and also that G2/M checkpoint activation is dependent on some other target of FANCA.

FANCD2 is required for the accumulation of RAD51 foci in cells undergoing rereplication. Although FANCD2 is activated, FANCD2 is not required for G2/M checkpoint activation in geminin-depleted cells. We wondered, therefore, whether FANCD2 activation is required for activating DNA repair pathways in rereplicating cells. Rereplication by loss of geminin led to formation of Rad51 foci (Fig. 4A). The cosilencing of FANCD2 did not suppress the formation of giant rereplicated nuclei in geminin-depleted cells (Fig. 4A), consistent with the fact that FANCD2 is not required for the accumulation of rereplicated cells (Fig. 3C). Loss of FANCD2, however, dramatically suppressed the accumulation of Rad51 foci in the cells with the giant nuclei (Fig. 4A and B), suggesting that active FANCD2 is involved in recruiting Rad51 to sites of rereplication, presumably for DNA damage repair.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. FANCD2 is required for the accumulation of Rad51 foci in cells undergoing rereplication. (A) HCT116 cells transfected as shown in Fig. 3A were coimmunostained with anti-Rad51 and anti-FANCD2 antibodies. (B) Rad51 focus-positive cells after different siRNA transfections. Cells containing more than five Rad51 foci in the nucleus were scored as focus-positive cells. For GEM or GEM plus FANCD2 siRNA-transfected cells, only cells with giant nuclei were counted. At least 100 cells were examined and the percentages of positive cells calculated from two independent experiments.

ATR and BRCA1 are required for FA pathway activation in cells undergoing rereplication. The involvement of the FA proteins raised the possibility that proteins known to be upstream from FA are also involved in the cell's response to rereplication. ATR and RPA are required for efficient activation of the FANCA pathway in response to DNA damage (1). As shown in Fig. 5B (also see Fig. S1 in the supplemental material), the silencing of ATR suppressed the appearance of nuclei with rereplicated DNA. The silencing of ATR in geminin-depleted cells also suppressed the monoubiquitination of FANCD2 (Fig. 5D, lane 7) and increased the amount of FANCD2 in the soluble fraction (Fig. 5D, lane 3). Therefore, ATR is required upstream of the FA complex to sense rereplication.


Figure 5
View larger version (35K):
[in this window]
[in a new window]
 
FIG. 5. ATR and BRCA1 are required for FA protein-mediated G2/M checkpoint activation. (A) Schematic of transfection protocol. (B) HCT116 cells treated as shown in panel A were harvested for flow cytometry analysis. Cells with more than G2/M DNA content are regarded as cells with rereplicated DNA. (C) HCT116 cells treated as shown in panel A were immunoblotted for the indicated proteins. (D) HCT116 cells were treated as shown in panel A. The resultant fractions were resolved on sodium dodecyl sulfate-polyacrylamide gels and immunoblotted with the indicated antibodies. See the legend for Fig. 2A for additional explanations. (E) HCC1937 (BRCA1+/+) and HCC1937 (BRCA1–/–) cells were transfected with control oligonucleotide GL2 or GEM twice and harvested 72 h after the first transfection for flow cytometry analysis (left panel) or immunoblotting with the indicated antibodies (right panel). *, protein cross-reacting with antigeminin antibody served as a loading control. FL2, filter that detects fluorescence with emission range at 595 ± 20 nm.

BRCA1 is also involved in the activation of the FA pathway after DNA damage. Consistent with this, we found that the accumulation of cells with more than 4N DNA content was suppressed in BRCA1 cells (HCC1937) but not in BRCA1+ cells (Fig. 5E). To confirm this, we used siRNA to silence BRCA1 together with geminin in HCT116 cells. Silencing BRCA1 also decreased the appearance of rereplicated nuclei (Fig. 5B) (also see Fig. S1 in the supplemental material), suppressed monoubiquitination of FANCD2 (Fig. 5D, lane 8), and released FANCD2 from the chromatin fraction to the soluble fraction in geminin-depleted cells (Fig. 5D, lane 4). Thus, BRCA1 is also required for the activation of the FA pathway in geminin-depleted cells.

Again we measured the percentage of cells in active DNA replication after ATR or BRCA1 depletion (along with geminin) to assess whether the decrease in FANCD2 activation could be accounted for by a decrease in S-phase population (Fig. 3E). The increase in S-phase population under both of these conditions ruled out this explanation.

If ATR or BRCA1 is upstream from the FA proteins, it is expected to be required for G2/M checkpoint activation in geminin-silenced cells. In agreement with this, the cosilencing of either ATR or BRCA1 with geminin decreased the inhibitory phosphorylation of Cdc2 at Tyr15 (Fig. 5C). Thus, ATR and BRCA1 are required to activate the G2/M checkpoint in cells with rereplicated DNA, most likely through the Fanconi core complex but not through FANCD2.

Premitotic arrest is required for rereplication caused by loss of geminin. Until now, there has been a perfect concordance between failure to activate the G2/M checkpoint and failure to accumulate cells with rereplicated DNA, leading to the hypothesis that the G2 arrest by the ATR-, BRCA1-, and FANCA-mediated G2 checkpoint is required for cells to accumulate with rereplicated DNA. An alternate hypothesis, however, is that ATR, BRCA1, and FANCA are required for the stabilization of replication forks and for the actual rereplication process. We therefore tested whether a premitotic arrest created by silencing cyclin A would substitute for G2/M checkpoint activation, as far as the accumulation of cells with rereplicated DNA was concerned. As shown in Fig. 6B, the silencing of cyclin A rescues the appearance of cells with overreplicated DNA even in the absence of ATR or BRCA1, indicating that cell cycle arrest before mitosis is essential for detecting this phenotype. In cyclin A, geminin, and ATR triple-silenced cells, Cdc2 phosphorylated at Tyr15 is decreased (Fig. 6C), indicating that the checkpoint has indeed been inactivated. Thus, introducing a G2-phase arrest in cells by reduction of cyclin A obviates the need for the G2/M checkpoint, supporting our notion that the accumulation of cells with rereplicated DNA is dependent on a premitotic arrest. Reduction of cyclin A also restores the appearance of rereplicated cells when FANCA is codepleted with geminin (Fig. 6E).


Figure 6
View larger version (39K):
[in this window]
[in a new window]
 
FIG. 6. Premitotic arrest bypasses the requirement of a checkpoint pathway for cells to accumulate rereplicated DNA. (A) Schematic of transfection protocol. (B) Silencing cyclin A rescues the accumulation of cells with overreplicated DNA in geminin and ATR or geminin and BRCA1 cosilenced cells. HCT116 cells treated as shown in panel A were harvested for flow cytometry analysis. (C) HCT116 cells treated as shown in panel A were immunoblotted with the indicated antibodies. (D) Schematic of transfection protocol. (E) Silencing cyclin A rescues the accumulation of cells with overreplicated DNA in geminin and FANCA cosilenced cells. HCT116 cells treated as shown in panel D were harvested for flow cytometry analysis.

Restoration of the rereplicated phenotype by cyclin A depletion indicates that ATR, BRCA1, and FANCA are not required for the actual rereplication process but are required specifically for allowing the accumulation of cells with the rereplicated DNA.

Depletion of geminin induces apoptosis in cells when ATR, BRCA1, FANCA, or FANCD2 is downregulated. PARP-1 is a zinc finger nuclear protein that is cleaved by active caspase-3 and caspase-7 to 24- and 85-kDa fragments during apoptosis (8, 39). PARPp24 and PARPp85 cleavage fragments were not detected in geminin-depleted cells when the checkpoint pathway was intact (Fig. 7A). However, depletion of geminin in cells with downregulated ATR, BRCA1, or FANCA induced the generation of 24- and 85-kDa PARP-1 cleavage products (Fig. 7A). Thus, the loss of ATR, BRCA1, or FANCA makes cells with rereplicated DNA vulnerable to apoptosis. We therefore examined cell viability by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay with cells where geminin and ATR, geminin and BRCA1, or geminin and FANCA are codepleted. As shown in Fig. 7B, the silencing of geminin in ATR-, BRCA1-, or FANCA-downregulated cells decreased the cell viability. The Fanconi core complex is required both for activating the G2/M checkpoint and for activating DNA repair pathways through monoubiquitination of FANCD2, so either of these activities may be important for preventing apoptosis upon rereplication.


Figure 7
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 7. Downregulation of geminin in ATR-, BRCA1-, FANCA-, or FANCD2-depleted cells causes apoptosis. (A) HCT116 cells were codepleted of geminin and ATR (Fig. 5A), BRCA1 (Fig. 5A), FANCA (Fig. 3A), or FANCD2 (Fig. 3A) and harvested 72 h after the first transfection for immunoblotting using the indicated antibodies. (B) HCT116 cells were treated as shown in Fig. 3A or 5A, and cell viability was measured by an MTT cell growth assay kit (Promega) according to the manufacturer's instructions. OD, optical density.

Since the cosilencing of cyclin A facilitated the persistence of cells with rereplicated DNA, we initially thought that failure to activate the G2/M checkpoint is the primary reason why rereplicated cells with the loss of ATR, BRCA1, or FANCA undergo apoptosis. The cosilencing of FANCD2 and geminin, however, revealed that although FANCD2 was not required for the activation of the G2/M checkpoint or the accumulation of rereplicated nuclei, it too was required to protect cells from apoptosis after rereplication (Fig. 7A). This suggests that activation of the DNA repair pathways by monoubiquitinated FANCD2 is the critical function required for prevention of apoptosis in rereplicated cells and is independent of any role of the Fanconi core complex in the activation of the G2/M checkpoint. Given the evidence that FANCD2 is required for assembly of RAD51 foci in geminin-depleted cells (Fig. 4) and that RAD51 focus formation specifically protects cells from undergoing apoptosis after DNA damage (30), it is likely that the apoptosis induced by loss of FANCD2 in rereplicated cells is due to the loss of functional nuclear RAD51 structure.


arrow
DISCUSSION
 
The loss of geminin in human cells causes rereplication, which activates a G2/M checkpoint (22, 50). In this paper, we demonstrate that ATR, BRCA1, and the Fanconi core complex are required for activating the G2/M checkpoint in response to this error of DNA replication. Abrogation of the FA pathway or of ATR or BRCA1 leads to apoptosis in geminin-depleted cells. We also found that an artificial premitotic arrest allows cells to accumulate with rereplicated DNA even with an inactive G2/M checkpoint, suggesting that the checkpoint is not required for rereplication per se but for the accumulation of cells with sufficient rereplication to produce a detectable phenotype.

The increase in the number of DNA replication forks in rereplicating nuclei might account for the excess of single-stranded DNA in rereplicating cells, as seen after increased initiation of DNA replication due to increased Cdk activity (33). Additionally, the uncoupling of MCM helicase and DNA polymerase activities by an inhibitor of DNA polymerase alpha, aphidicolin, induces ssDNA in Xenopus egg extract (4). If the abnormal loading of the replicative helicase in the absence of geminin leads to helicase activity in the absence of polymerase, then such uncoupling could also generate excess ssDNA. Alternatively, rereplication might lead to fork collapse. If collapsed forks are processed as double-stranded breaks, then processing of the double-stranded breaks by the Mre11 nuclease might lead to the formation of extensive single-stranded DNA (14). It is also possible that single-strand stretches in replicating chromosomes might lead to double-stranded breaks (15). Thus, there are multiple possible pathways by which double-stranded breaks and single-stranded DNA might be created in rereplicating cells.

FANCC, a component of the FA core complex, is required for maintaining the G2/M checkpoint in mouse embryo fibroblasts in response to ionizing radiation (10). Here we find the role of FANCA, another component of the FA core complex, in activating the G2/M checkpoint in response to rereplication. The FA core complex associates with chromatin during S phase, indicating a possible role of the complex in monitoring the normal progression of replication forks (45). The FA core complex interacts with the BLM helicases, which are involved in the direct resolution of stalled replication forks (13). Therefore, it is not surprising that the FA core complex is activated in response to rereplication and helps in transducing the signal for G2/M checkpoint activation (Fig. 8).


Figure 8
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 8. Rereplication-induced activation of the FA pathway is required for activation of the G2/M checkpoint and DNA damage repair. Rereplication by loss of geminin generates double-stranded breaks (DSB) and ssDNA. The ssDNA is sensed through ATR and BRCA1, resulting in activation of the FA pathway. The pathway bifurcates at the Fanconi core complex to activate the G2/M checkpoint and to monoubiquitinate FANCD2. The DNA damage repair initiated by active FANCD2 appears essential to prevent apoptosis and short-term loss of viability.

Unlike FANCA, FANCD2 appears dispensable for activating the G2/M checkpoint. This result is consistent with the observation by Taniguchi et al. that FANCD2 mutant cells show a defect in the intra-S-phase checkpoint but not in the G2/M checkpoint (37). However, another study recently showed that the G2/M checkpoint is induced but cannot be maintained in FANCD2-deficient FA-D2 fibroblasts treated with ionizing radiation (10). Of course, the mode of DNA damage (ionizing radiation versus rereplication) might influence the exact pathway of checkpoint activation and partially explain the difference. Either way, FANCD2 is downstream from the FA core complex and is less essential for G2/M checkpoint activation by rereplication. Since FANCA is essential for G2/M checkpoint activation but FANCD2 is not, we suggest that there must be other targets of the FA core complex that link FA to G2/M checkpoint activation (Fig. 8).

Instead, FANCD2 may be involved in the damage repair process, which is in turn important for preventing apoptosis in the rereplicated cells. We show that active FANCD2 is targeted to the sites of ssDNA and is required for the accumulation of DNA-repair foci containing RAD51 in cells with rereplicated DNA (Fig. 8). Given the evidence that monoubiquitinated FANCD2 is required for the loading of BRCA2 to chromatin and that it colocalizes with BRCA2 (44), as well as the evidence that BRCA2 stabilizes stalled DNA replication forks (17), FANCD2 may be involved in recruiting BRCA2 to chromatin to stabilize forks on rereplicated DNA.

We attempted to demonstrate the requirement of the Fanconi core complex in G2/M checkpoint activation by using fibroblast lines carrying mutations in FANCA or FANCD2. However, even in the FANCA-corrected control cell lines, decrease of geminin failed to produce any rereplication (see Fig. S4 in the supplemental material). Several cell lines (e.g., HeLa and A549) respond to geminin depletion with a G1 block and do not exhibit any rereplication. The reason for this is unclear, but since the fibroblasts we tested appear to belong to the same category, we will have to await methods to induce rereplication in these cell lines before we can use FA mutant cell lines to confirm the findings reported here.

Both ATR and BRCA1 are involved in the FA pathway following exposure to ionizing radiation or cross-linking agents. ATR is required for the monoubiquitination of FANCD2 (1, 11). BRCA1 colocalizes with activated monoubiquitinated FANCD2 and is required for FANCD2 monoubiquitination and focus formation (1, 11). Although another study indicates that BRCA1 is not essential for the monoubiquitination of FANCD2 in response to mitomycin C or ionizing radiation (42), our data show that the activation of the FA core complex and of FANCD2 by errors of DNA replication uses both ATR and BRCA1.

Given the evidence that ATR is present at the replication fork and stabilizes replication forks during S phase (18, 38), one possibility is that ATR is required to stabilize replication forks during rereplication. An alternative possibility, supported by the rescue of rereplication by an artificial premitotic arrest, is that the ATR-mediated G2/M checkpoint causes a G2-phase arrest that is required for cells to accumulate rereplication. The intra-S-phase checkpoint is not activated in response to rereplication (50), and consistent with this, the deletion of FANCD2, which is required for the intra-S-phase checkpoint, has no effect on rereplication.

Silencing geminin in ATR-, BRCA1-, FANCA-, or FANCD2-depleted cells causes apoptosis. Since many cancer cells have mutated checkpoint proteins, including BRCA1 and FANCA, these results are significant because they suggest that the induction of rereplication (perhaps by targeting geminin) would be particularly toxic to cancers that have these mutations.

BRCA1 and FA are usually activated by DNA damage induced by exogenous signals, like radiation, hydroxyurea, or mitomycin C. This report shows that disorders of endogenous processes, like DNA replication, can also activate BRCA1 or FA pathways. An interesting possibility is that the low-level activation of FANCD2 seen with all cultures synchronized in S phase is actually in response to low levels of rereplication that are not detectable by FACS analysis. Such subdetectable amounts of rereplication may be sufficient to activate the FA and G2/M checkpoint pathways in the few affected cells. Resolution of the rereplicated segments by HDR may relieve the checkpoint and allow the cell cycle to proceed. Alternatively, a small percentage of cells might be irreversibly arrested in G2/M and eventually lose viability and be lost from the culture.


arrow
ACKNOWLEDGMENTS
 
We thank members of the Dutta laboratory for technical support and helpful discussions.

This work was supported by grant CA60499 to A.D.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Box 800733, Jordan Hall 1240, 1300 Jefferson Park Avenue, Charlottesville, VA 22908. Phone: (434) 924-1277. Fax: (434) 924-5069. E-mail: ad8q{at}virginia.edu. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Andreassen, P. R., A. D. D'Andrea, and T. Taniguchi. 2004. ATR couples FANCD2 monoubiquitination to the DNA-damage response. Genes Dev. 18:1958-1963.[Abstract/Free Full Text]
  2. 2
  3. Arias, E. E., and J. C. Walter. 2005. Replication-dependent destruction of Cdt1 limits DNA replication to a single round per cell cycle in Xenopus egg extracts. Genes Dev. 19:114-126.[Abstract/Free Full Text]
  4. 3
  5. Bell, S. P., and A. Dutta. 2002. DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71:333-374.[CrossRef][Medline]
  6. 4
  7. Byun, T. S., M. Pacek, M. C. Yee, J. C. Walter, and K. A. Cimprich. 2005. Functional uncoupling of MCM helicase and DNA polymerase activities activates the ATR-dependent checkpoint. Genes Dev. 19:1040-1052.[Abstract/Free Full Text]
  8. 5
  9. D'Andrea, A. D., and M. Grompe. 2003. The Fanconi anaemia/BRCA pathway. Nat. Rev. Cancer 3:23-34.[CrossRef][Medline]
  10. 6
  11. Davies, A. A., J. Y. Masson, M. J. McIlwraith, A. Z. Stasiak, A. Stasiak, A. R. Venkitaraman, and S. C. West. 2001. Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol. Cell 7:273-282.[CrossRef][Medline]
  12. 7
  13. Digweed, M., S. Rothe, I. Demuth, R. Scholz, D. Schindler, M. Stumm, M. Grompe, A. Jordan, and K. Sperling. 2002. Attenuation of the formation of DNA-repair foci containing RAD51 in Fanconi anaemia. Carcinogenesis 23:1121-1126.[Abstract/Free Full Text]
  14. 8
  15. Duriez, P. J., and G. M. Shah. 1997. Cleavage of poly(ADP-ribose) polymerase: a sensitive parameter to study cell death. Biochem. Cell Biol. 75:337-349.[CrossRef][Medline]
  16. 9
  17. Folias, A., M. Matkovic, D. Bruun, S. Reid, J. Hejna, M. Grompe, A. D'Andrea, and R. Moses. 2002. BRCA1 interacts directly with the Fanconi anemia protein FANCA. Hum. Mol. Genet. 11:2591-2597.[Abstract/Free Full Text]
  18. 10
  19. Freie, B. W., S. L. Ciccone, X. Li, P. A. Plett, C. M. Orschell, E. F. Srour, H. Hanenberg, D. Schindler, S. H. Lee, and D. W. Clapp. 2004. A role for the Fanconi anemia C protein in maintaining the DNA damage-induced G2 checkpoint. J. Biol. Chem. 279:50986-50993.[Abstract/Free Full Text]
  20. 11
  21. Garcia-Higuera, I., T. Taniguchi, S. Ganesan, M. S. Meyn, C. Timmers, J. Hejna, M. Grompe, and A. D. D'Andrea. 2001. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol. Cell 7:249-262.[CrossRef][Medline]
  22. 12
  23. Goldberg, M., M. Stucki, J. Falck, D. D'Amours, D. Rahman, D. Pappin, J. Bartek, and S. P. Jackson. 2003. MDC1 is required for the intra-S-phase DNA damage checkpoint. Nature 421:952-956.[CrossRef][Medline]
  24. 13
  25. Hickson, I. D. 2003. RecQ helicases: caretakers of the genome. Nat. Rev. Cancer 3:169-178.[CrossRef][Medline]
  26. 14
  27. Jazayeri, A., J. Falck, C. Lukas, J. Bartek, G. C. Smith, J. Lukas, and S. P. Jackson. 2006. ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nat. Cell Biol. 8:37-45.[CrossRef][Medline]
  28. 15
  29. Kuzminov, A. 2001. Single-strand interruptions in replicating chromosomes cause double-strand breaks. Proc. Natl. Acad. Sci. USA 98:8241-8246.[Abstract/Free Full Text]
  30. 16
  31. Li, A., and J. J. Blow. 2005. Cdt1 downregulation by proteolysis and geminin inhibition prevents DNA re-replication in Xenopus. EMBO J. 24:395-404.[CrossRef][Medline]
  32. 17
  33. Lomonosov, M., S. Anand, M. Sangrithi, R. Davies, and A. R. Venkitaraman. 2003. Stabilization of stalled DNA replication forks by the BRCA2 breast cancer susceptibility protein. Genes Dev. 17:3017-3022.[Abstract/Free Full Text]
  34. 18
  35. Lupardus, P. J., T. Byun, M. C. Yee, M. Hekmat-Nejad, and K. A. Cimprich. 2002. A requirement for replication in activation of the ATR-dependent DNA damage checkpoint. Genes Dev. 16:2327-2332.[Abstract/Free Full Text]
  36. 19
  37. Machida, Y. J., and A. Dutta. 2005. Cellular checkpoint mechanisms monitoring proper initiation of DNA replication. J. Biol. Chem. 280:6253-6256.[Free Full Text]
  38. 20
  39. Maiorano, D., J. Moreau, and M. Mechali. 2000. XCDT1 is required for the assembly of pre-replicative complexes in Xenopus laevis. Nature 404:622-625.[CrossRef][Medline]
  40. 21
  41. Meetei, A. R., Z. Yan, and W. Wang. 2004. FANCL replaces BRCA1 as the likely ubiquitin ligase responsible for FANCD2 monoubiquitination. Cell Cycle 3:179-181.[Medline]
  42. 22
  43. Melixetian, M., A. Ballabeni, L. Masiero, P. Gasparini, R. Zamponi, J. Bartek, J. Lukas, and K. Helin. 2004. Loss of geminin induces rereplication in the presence of functional p53. J. Cell Biol. 165:473-482.[Abstract/Free Full Text]
  44. 23
  45. Melixetian, M., and K. Helin. 2004. Geminin: a major DNA replication safeguard in higher eukaryotes. Cell Cycle 3:1002-1004.[Medline]
  46. 24
  47. Mihaylov, I. S., T. Kondo, L. Jones, S. Ryzhikov, J. Tanaka, J. Zheng, L. A. Higa, N. Minamino, L. Cooley, and H. Zhang. 2002. Control of DNA replication and chromosome ploidy by geminin and cyclin A. Mol. Cell. Biol. 22:1868-1880.[Abstract/Free Full Text]
  48. 25
  49. Moynahan, M. E., A. J. Pierce, and M. Jasin. 2001. BRCA2 is required for homology-directed repair of chromosomal breaks. Mol. Cell 7:263-272.[CrossRef][Medline]
  50. 26
  51. Nakanishi, K., T. Taniguchi, V. Ranganathan, H. V. New, L. A. Moreau, M. Stotsky, C. G. Mathew, M. B. Kastan, D. T. Weaver, and A. D. D'Andrea. 2002. Interaction of FANCD2 and NBS1 in the DNA damage response. Nat. Cell Biol. 4:913-920.[CrossRef][Medline]
  52. 27
  53. Nakanishi, K., Y. G. Yang, A. J. Pierce, T. Taniguchi, M. Digweed, A. D. D'Andrea, Z. Q. Wang, and M. Jasin. 2005. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. Proc. Natl. Acad. Sci. USA 102:1110-1115.[Abstract/Free Full Text]
  54. 28
  55. Nishitani, H., Z. Lygerou, T. Nishimoto, and P. Nurse. 2000. The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404:625-628.[CrossRef][Medline]
  56. 29
  57. Pichierri, P., and F. Rosselli. 2004. Fanconi anemia proteins and the s phase checkpoint. Cell Cycle 3:698-700.[Medline]
  58. 30
  59. Raderschall, E., A. Bazarov, J. Cao, R. Lurz, A. Smith, W. Mann, H. H. Ropers, J. M. Sedivy, E. I. Golub, E. Fritz, and T. Haaf. 2002. Formation of higher-order nuclear Rad51 structures is functionally linked to p21 expression and protection from DNA damage-induced apoptosis. J. Cell Sci. 115:153-164.[Abstract/Free Full Text]
  60. 31
  61. Saxena, S., and A. Dutta. 2005. Geminin-Cdt1 balance is critical for genetic stability. Mutat. Res. 569:111-121.[Medline]
  62. 32
  63. Scully, R., S. Ganesan, K. Vlasakova, J. Chen, M. Socolovsky, and D. M. Livingston. 1999. Genetic analysis of BRCA1 function in a defined tumor cell line. Mol. Cell 4:1093-1099.[CrossRef][Medline]
  64. 33
  65. Sorensen, C. S., L. T. Hansen, J. Dziegielewski, R. G. Syljuasen, C. Lundin, J. Bartek, and T. Helleday. 2005. The cell-cycle checkpoint kinase Chk1 is required for mammalian homologous recombination repair. Nat. Cell Biol. 7:195-201.[CrossRef][Medline]
  66. 34
  67. Tada, S., A. Li, D. Maiorano, M. Mechali, and J. J. Blow. 2001. Repression of origin assembly in metaphase depends on inhibition of RLF-B/Cdt1 by geminin. Nat. Cell Biol. 3:107-113.[CrossRef][Medline]
  68. 35
  69. Takeda, D. Y., J. D. Parvin, and A. Dutta. 2005. Degradation of Cdt1 during S phase is Skp2-independent and is required for efficient progression of mammalian cells through S phase. J. Biol. Chem. 280:23416-23423.[Abstract/Free Full Text]
  70. 36
  71. Taniguchi, T., I. Garcia-Higuera, P. R. Andreassen, R. C. Gregory, M. Grompe, and A. D. D'Andrea. 2002. S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood 100:2414-2420.[Abstract/Free Full Text]
  72. 37
  73. Taniguchi, T., I. Garcia-Higuera, B. Xu, P. R. Andreassen, R. C. Gregory, S. T. Kim, W. S. Lane, M. B. Kastan, and A. D. D'Andrea. 2002. Convergence of the fanconi anemia and ataxia telangiectasia signaling pathways. Cell 109:459-472.[CrossRef][Medline]
  74. 38
  75. Tercero, J. A., M. P. Longhese, and J. F. Diffley. 2003. A central role for DNA replication forks in checkpoint activation and response. Mol. Cell 11:1323-1336.[CrossRef][Medline]
  76. 39
  77. Tewari, M., L. T. Quan, K. O'Rourke, S. Desnoyers, Z. Zeng, D. R. Beidler, G. G. Poirier, G. S. Salvesen, and V. M. Dixit. 1995. Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81:801-809.[CrossRef][Medline]
  78. 40
  79. Thomer, M., N. R. May, B. D. Aggarwal, G. Kwok, and B. R. Calvi. 2004. Drosophila double-parked is sufficient to induce re-replication during development and is regulated by cyclin E/CDK2. Development 131:4807-4818.[Abstract/Free Full Text]
  80. 41
  81. Tomlinson, G. E., T. T. Chen, V. A. Stastny, A. K. Virmani, M. A. Spillman, V. Tonk, J. L. Blum, N. R. Schneider, I. I. Wistuba, J. W. Shay, J. D. Minna, and A. F. Gazdar. 1998. Characterization of a breast cancer cell line derived from a germ-line BRCA1 mutation carrier. Cancer Res. 58:3237-3242.[Abstract/Free Full Text]
  82. 42
  83. Vandenberg, C. J., F. Gergely, C. Y. Ong, P. Pace, D. L. Mallery, K. Hiom, and K. J. Patel. 2003. BRCA1-independent ubiquitination of FANCD2. Mol. Cell 12:247-254.[CrossRef][Medline]
  84. 43
  85. Vaziri, C., S. Saxena, Y. Jeon, C. Lee, K. Murata, Y. Machida, N. Wagle, D. S. Hwang, and A. Dutta. 2003. A p53-dependent checkpoint pathway prevents rereplication. Mol. Cell 11:997-1008.[CrossRef][Medline]
  86. 44
  87. Wang, X., P. R. Andreassen, and A. D. D'Andrea. 2004. Functional interaction of monoubiquitinated FANCD2 and BRCA2/FANCD1 in chromatin. Mol. Cell. Biol. 24:5850-5862.[Abstract/Free Full Text]
  88. 45
  89. Wang, X., and A. D. D'Andrea. 2004. The interplay of Fanconi anemia proteins in the DNA damage response. DNA Repair 3:1063-1069.[Medline]
  90. 46
  91. Wohlschlegel, J. A., B. T. Dwyer, S. K. Dhar, C. Cvetic, J. C. Walter, and A. Dutta. 2000. Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science 290:2309-2312.[Abstract/Free Full Text]
  92. 47
  93. Yang, H., P. D. Jeffrey, J. Miller, E. Kinnucan, Y. Sun, N. H. Thoma, N. Zheng, P. L. Chen, W. H. Lee, and N. P. Pavletich. 2002. BRCA2 function in DNA binding and recombination from a BRCA2-DSS1-ssDNA structure. Science 297:1837-1848.[Abstract/Free Full Text]
  94. 48
  95. Yang, Y. G., Z. Herceg, K. Nakanishi, I. Demuth, C. Piccoli, J. Michelon, G. Hildebrand, M. Jasin, M. Digweed, and Z. Wang. 2005. The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells. Carcinogenesis 26:1731-1740.[Abstract/Free Full Text]
  96. 49
  97. Zhong, W., H. Feng, F. E. Santiago, and E. T. Kipreos. 2003. CUL-4 ubiquitin ligase maintains genome stability by restraining DNA-replication licensing. Nature 423:885-889.[CrossRef][Medline]
  98. 50
  99. Zhu, W., Y. Chen, and A. Dutta. 2004. Rereplication by depletion of geminin is seen regardless of p53 status and activates a G2/M checkpoint. Mol. Cell. Biol. 24:7140-7150.[Abstract/Free Full Text]
  100. 51
  101. Zou, L., D. Cortez, and S. J. Elledge. 2002. Regulation of ATR substrate selection by Rad17-dependent loading of Rad9 complexes onto chromatin. Genes Dev. 16:198-208.[Abstract/Free Full Text]


Molecular and Cellular Biology, June 2006, p. 4601-4611, Vol. 26, No. 12
0270-7306/06/$08.00+0     doi:10.1128/MCB.02141-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Sobeck, A., Stone, S., Landais, I., de Graaf, B., Hoatlin, M. E. (2009). The Fanconi Anemia Protein FANCM Is Controlled by FANCD2 and the ATR/ATM Pathways. J. Biol. Chem. 284: 25560-25568 [Abstract] [Full Text]  
  • Zhu, W., DePamphilis, M. L. (2009). Selective Killing of Cancer Cells by Suppression of Geminin Activity. Cancer Res. 69: 4870-4877 [Abstract] [Full Text]  
  • Hein, J., Boichuk, S., Wu, J., Cheng, Y., Freire, R., Jat, P. S., Roberts, T. M., Gjoerup, O. V. (2009). Simian Virus 40 Large T Antigen Disrupts Genome Integrity and Activates a DNA Damage Response via Bub1 Binding. J. Virol. 83: 117-127 [Abstract] [Full Text]  
  • Mehrotra, S., Maqbool, S. B., Kolpakas, A., Murnen, K., Calvi, B. R. (2008). Endocycling cells do not apoptose in response to DNA rereplication genotoxic stress. Genes Dev. 22: 3158-3171 [Abstract] [Full Text]  
  • Ullah, Z., Kohn, M. J., Yagi, R., Vassilev, L. T., DePamphilis, M. L. (2008). Differentiation of trophoblast stem cells into giant cells is triggered by p57/Kip2 inhibition of CDK1 activity. Genes Dev. 22: 3024-3036 [Abstract] [Full Text]  
  • Zajac, M., Moneo, M. V., Carnero, A., Benitez, J., Martinez-Delgado, B. (2008). Mitotic catastrophe cell death induced by heat shock protein 90 inhibitor in BRCA1-deficient breast cancer cell lines. Molecular Cancer Therapeutics 7: 2358-2366 [Abstract] [Full Text]  
  • Teer, J. K., Dutta, A. (2008). Human Cdt1 Lacking the Evolutionarily Conserved Region That Interacts with MCM2-7 Is Capable of Inducing Re-replication. J. Biol. Chem. 283: 6817-6825 [Abstract] [Full Text]  
  • Briot, D., Mace-Aime, G., Subra, F., Rosselli, F. (2008). Aberrant activation of stress-response pathways leads to TNF-{alpha} oversecretion in Fanconi anemia. Blood 111: 1913-1923 [Abstract] [Full Text]  
  • Lau, E., Tsuji, T., Guo, L., Lu, S.-H., Jiang, W. (2007). The role of pre-replicative complex (pre-RC) components in oncogenesis. FASEB J. 21: 3786-3794 [Abstract] [Full Text]  
  • Liu, E., Lee, A. Y.-L., Chiba, T., Olson, E., Sun, P., Wu, X. (2007). The ATR-mediated S phase checkpoint prevents rereplication in mammalian cells when licensing control is disrupted. JCB 179: 643-657 [Abstract] [Full Text]  
  • Lee, A. Y.-L., Liu, E., Wu, X. (2007). The Mre11/Rad50/Nbs1 Complex Plays an Important Role in the Prevention of DNA Rereplication in Mammalian Cells. J. Biol. Chem. 282: 32243-32255 [Abstract] [Full Text]  
  • Lin, J. J., Dutta, A. (2007). ATR Pathway Is the Primary Pathway for Activating G2/M Checkpoint Induction After Re-replication. J. Biol. Chem. 282: 30357-30362 [Abstract] [Full Text]  
  • Sobeck, A., Stone, S., Hoatlin, M. E. (2007). DNA Structure-Induced Recruitment and Activation of the Fanconi Anemia Pathway Protein FANCD2. Mol. Cell. Biol. 27: 4283-4292 [Abstract] [Full Text]  
  • Arias, E. E., Walter, J. C. (2007). Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells. Genes Dev. 21: 497-518 [Abstract] [Full Text]  
  • Sansam, C. L., Shepard, J. L., Lai, K., Ianari, A., Danielian, P. S., Amsterdam, A., Hopkins, N., Lees, J. A. (2006). DTL/CDT2 is essential for both CDT1 regulation and the early G2/M checkpoint. Genes Dev. 20: 3117-3129 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, W.
Right arrow Articles by Dutta, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, W.
Right arrow Articles by Dutta, A.