Previous Article | Next Article 
Molecular and Cellular Biology, June 2006, p. 4701-4711, Vol. 26, No. 12
0270-7306/06/$08.00+0 doi:10.1128/MCB.00303-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Regulation of Late G1/S Phase Transition and APCCdh1 by Reactive Oxygen Species
Courtney G. Havens,
Alan Ho,
Naohisa Yoshioka, and
Steven F. Dowdy*
Howard Hughes Medical Institute, Department of Cellular and Molecular Medicine, University of CaliforniaSan Diego School of Medicine, 9500 Gilman Drive, La Jolla, California 92093-0686
Received 17 February 2006/
Returned for modification 14 March 2006/
Accepted 29 March 2006

ABSTRACT
Proliferating cells have a higher metabolic rate than quiescent
cells. To investigate the role of metabolism in cell cycle progression,
we examined cell size, mitochondrial mass, and reactive oxygen
species (ROS) levels in highly synchronized cell populations
progressing from early G
1 to S phase. We found that ROS steadily
increased, compared to cell size and mitochondrial mass, through
the cell cycle. Since ROS has been shown to influence cell proliferation
and transformation, we hypothesized that ROS could contribute
to cell cycle progression. Antioxidant treatment of cells induced
a late-G
1-phase cell cycle arrest characterized by continued
cellular growth, active cyclin D-Cdk4/6 and active cyclin E-Cdk2
kinases, and inactive hyperphosphorylated pRb. However, antioxidant-treated
cells failed to accumulate cyclin A protein, a requisite step
for initiation of DNA synthesis. Further examination revealed
that cyclin A continued to be ubiquitinated by the anaphase
promoting complex (APC) and to be degraded by the proteasome.
This antioxidant arrest could be rescued by overexpression of
Emi1, an APC inhibitor. These observations reveal an intrinsic
late-G
1-phase checkpoint, after transition across the growth
factor-dependent G
1 restriction point, that links increased
steady-state levels of endogenous ROS and cell cycle progression
through continued activity of APC in association with Cdh1.

INTRODUCTION
Maintenance of cell size during cellular division requires the
coordinated regulation of the cell cycle machinery and cell
growth (
31,
36). Metabolism or reactive oxygen species (ROS)
has been proposed to stimulate cell cycle progression as an
intrinsic cellular signal (
9,
66); however, a direct role for
growth or metabolism in regulating the cell cycle machinery
has remained elusive. Tumor cells and transformed cells are
often characterized by a robust metabolic rate, including increased
glucose utilization, increased lipid synthesis, and increased
levels of ROS (
20,
29,
40,
74). Jones et al. (
35) recently reported
a G
1 cell cycle checkpoint monitoring glucose availability that
links the AMP-activated protein kinase and the p53 tumor suppressor.
In addition, members of the retinoblastoma tumor suppressor
(pRb) family have been shown to regulate the expression of genes
involved in cell cycle progression as well as metabolism and
mitochondrial biogenesis (
10). Furthermore, three groups (
8,
28,
43) have provided important insight into the von Hippel-Lindau/hypoxia-inducible
factor pathway, mutated in some cancers, that determines how
cells sense and respond to changes in oxygen availability. In
low oxygen, mitochondria produce increased ROS levels that stabilize
Hif-1

, resulting in the transcription of genes involved in glucose
transport and glycolytic enzymes. Together, these observations
suggest that cells inherently possess a mechanism to monitor
and control cellular metabolism and that this regulation is
important for proliferation and tumorigenesis.
ROS has been reported to be involved in a number of cellular processes. High levels of ROS have been shown to cause cellular damage, oxidative stress, and DNA damage, whereas low endogenous ROS levels play a role in redox signaling pathways in cellular biology (9, 66). For example, nitric oxide (NO) is used as a cell-to-cell signaling molecule (5), demonstrating that cells utilize endogenous ROS for important biological functions. Low physiologic levels of ROS (H2O2) have been shown to stimulate cell proliferation in multiple cell types including fibroblast, prostate, macrophage, endothelial, and smooth muscle (16, 52, 60, 64, 78). Likewise, reducing intracellular ROS levels by the addition of catalase, vitamins (E, C and A), or N-acetyl-L-cysteine decreases cellular proliferation (34, 45, 47, 58, 59, 76).
Growth factor stimulation by platelet-derived growth factor, epidermal growth factor, and insulin-like growth factor results in an increase in intracellular ROS (65). This ROS production can inactivate phosphatases at the cell membrane (46), activate kinases, and activate transcription factors (65) leading to cell cycle progression. Lambeth and others have shown that many nonphagocytic cells express homologues of the NADPH oxidase that produce ROS at the cell membrane (39). Overexpression of Nox1, the catalytic subunit of the NADPH oxidase, causes an increase in the intracellular H2O2 concentration, cellular transformation, and tumor growth in mice (40, 49). Furthermore, fibroblasts transformed with constitutively active Ras or Rac1 expressed dramatically higher levels of ROS, and antioxidant treatment reverses the phenotype (49, 73). Taken together, these observations suggest that ROS plays a role in intracellular signaling and cell proliferation, potentially influencing transformation and tumor progression.
Progression of cells through early G1, across the restriction point into late G1 and then into S phase requires the coordinated regulation of multiple positive and negative factors (31). Cyclin D-Cdk4/6 complexes promote early G1 progression, but cyclin E (or cyclin A)-Cdk2 (or Cdk1) activity (2) is required to inactive pRb by hyperphosphorylation to transit the restriction point into late G1 phase. pRb inactivation results in release of E2F transcription factors and induction of late-G1-specific genes, including dihydrofolatereductase (DHFR), Emi1, and cyclin A (21, 33). Cyclin A-associated kinase activity is required to initiate DNA synthesis, prevent rereplication, and enter mitosis (14, 80). Although cyclin A is transcriptionally induced by E2Fs at the restriction point, cyclin A protein does not accumulate until the late G1/S phase transition due to ubiquitination by the anaphase promoting complex (APC) and subsequent proteolysis by the 26S proteasome (33). APC is active throughout G1 phase by association with Cdh1 (APCCdh1), an activator that confers substrate specificity (22). Prior to initiation of S phase, APCCdh1 is inactivated by the binding of Emi1 to Cdh1, resulting in stabilization of cyclin A (33), activation of cyclin A-associated kinase activity, and subsequent inactivation of Cdh1 by phosphorylation (42, 71). Thus, tight regulation of cyclin E- and A-associated kinase activity results in a coordinated G1 cell cycle progression. Here, we find that an increase in the steady-state levels of endogenous ROS is required to inactivate APCCdh1, allow cyclin A accumulation, and transition into S phase. These observations point to a novel intrinsic late G1/S phase checkpoint that coordinates cellular ROS production and possibly metabolism with cell cycle progression.

MATERIALS AND METHODS
Cell culture and reagents.
Human foreskin fibroblasts (a kind gift from M. Haas, University
of California-San Diego), NIH 3T3 fibroblasts, and Rat1a fibroblasts
were maintained in Dulbecco's modified Eagle's medium high glucose
(Life Technologies), 10% fetal bovine serum (FBS; Sigma), and
penicillin-streptomycin. Human Jurkat T cells and T98G human
glioblastoma cells were obtained from ATCC and maintained in
RPMI 1640 medium or minimal essential medium (Life Technologies),
respectively, supplemented with 5% FBS, 1
x penicillin-streptomycin.
All cells were grown at 37°C in 5% CO
2. Stocks (1 M) of
tempol (Calbiochem), a free radical scavenger/spin trap (
48,
67), and diethyldithiocarbamic acid (DDC; Sigma) (
51), a superoxide
dismutase peptidyl mimetic, in water were used at final concentrations
of 1 to 5 mM and 10 to 100 µM, respectively. Other antioxidants
or reducing agents used were the following: pyrrolidine dithiocarbamate
(
11,
12,
73), dimethylthiourea (
65),
N-acetyl-
L-cysteine (
73),
vitamins E and C (
69), and catalase (
59). Cyclin A-expressing
retrovirus was made by inserting human cyclin A-hemagglutinin
(HA) cDNA into pCX4bsr retrovirus vector (
1), followed by packaging
in BOSC23 cells. Cycloheximide was purchased from Sigma, while
MG132 and MG115 were purchased from Calbiochem.
Cell cycle synchronization.
Centrifugal elutriations of G1 and G2/M phase cell populations were performed as previously described using human Jurkat T cells (41). T98G, NIH 3T3, and Rat1a cells were serum deprived for 72 h, followed by restimulation with 5% serum (T98G cells) and 10% serum (NIH 3T3 Rat1a cells). Human foreskin fibroblast cells were synchronized by contact inhibition at high density (6 x 106 cells/10-cm dish) in 10% serum for 48 h and then replated at low density (1 x 106 cells/10-cm dish). G2/M enriched NIH 3T3s were serum starved and restimulated until the majority of the population reached G2/M (20 h). For transfection experiments cells were thymidine (Sigma) blocked for 20 h, released, and then transfected using Effectene (QIAGEN) for 4 h. Cells were harvested and analyzed by fluorescence-activated cell sorting (FACS) analysis 22 h later. For cyclin A [35S]methionine pulse-chase experiments, T98G cells were synchronized as before, treated with medium without methionine for 30 min, then pulsed with 200 µCi/ml Pro-Mix L[35S] in vitro cell labeling mix (Amersham) for 15 min, and chased with medium containing nonradiolabeled methionine. Cells were lysed in radioimmunoprecipitation assay buffer and precleared with protein A-Sepharose beads (Amersham), and cyclin A was immunoprecipitated (H432; Santa Cruz Biotech) and analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and phosphorimaging. Densitometry was done using Imagequant, software, version 1.1 (Molecular Dynamics).
Immunoblotting and kinase assays.
Cells were lysed in radioimmunoprecipitation assay buffer, and immunoblotting was performed as previously described (21) using anti-cyclin E1 (HE12), anti-cyclin A2 (H432), anti-cyclin B1 (245), anti-Cdk2 (M20 and D12), anti-p27 (C19), anti-p21 (C19), anti-Skp2 (H435), anti-CDC6 (H-304), anti-CDC27 (AF3.1), anti-Cdc20 (8358), anti-Myc (9e10), anti-E2F1 (KH95), anti-p107 (C18), anti-p130 (C20), anti-actin (I19; Santa Cruz Biotech); anti-pRb (554136; BD Biosciences); anti-alpha-tubulin (Sigma); anti-CDH1 (DH01; Neomarkers); anti-UbcH10 (Boston Biochem); and anti-Emi1 and anti-Plk1 (Zymed) antibodies. Immunoprecipitation kinase assays were performed as previously described (21) using glutathione transferase (GST) C terminus pRb substrate for Cdk4/6 and histone H1 (Calbiochem) substrate for cyclin E and cyclin A and anti-Cdk6 (C-21), anti Cdk4 (C-22), anti-cyclin E (C-19), and anti-cyclin A antibodies (H-432; Santa Cruz Biotech).
RT-PCR.
RNA was purified using an RNeasy kit (QIAGEN). Reverse transcription-PCR (RT-PCR) was performed using a QIAGEN Omniscript RT kit with the minimum number of PCR cycles to detect a signal using the following primers: human cyclin A2 (GGCCGAAGACGAGACGGGTTGCACC and CAGGCCAGCTTTGTCCCGTGAC), 20 cycles; human DHFR (ATGCCTTTCTCCTCCTGG and CGCTAAACTGCATCGTCGC), 25 cycles; human Emi1 (GCCTCCTGGAGGAGAATTTCGG and CCTTTCTGATCACCTTGATTGG), 30 cycles; and human beta actin (TGAACCCCAAGGCCAACCGCGAGAA and AAGCAGCCGTGGCCATCTCTTG), 20 cycles.
Flow cytometry analysis.
Cell cycle progression was assayed by DNA content using propidium iodide and flow cytometry as previously described (21). ROS levels and mitochondrion content were measured by flow cytometry using H2DCFDA (2',7'-dichlorofluorescein diacetate) (53, 55) and MitoTracker Green (Molecular Probes), respectively. T98G cells deprived of serum for 72 h were restimulated with 10% serum and pulsed with bromodeoxyuridine (BrdU; Amersham Biosciences) at 16 to 20 h and assayed by flow cytometry as previously described (41). Relative cell size was measured by forward scatter flow cytometry.
APC immunoprecipitation and in vitro ubiquitination assay.
Cells were lysed in buffer A (20 mM Tris-Hcl, pH 7.5, 100 mM NaCl, 10% glycerol, 0.2% NP-40, EDTA-free complete protease inhibitor cocktail [Roche]) (77), spun at 10,000 x g for 10 min, and precleared with protein A-Sepharose beads (Amersham). APC was immunoprecipitated using anti-Cdc27 AF3.1 antibody (sc-9972; Santa Cruz Biotech) conjugated to protein A-Sepharose beads. APC beads were then washed three times, aliquoted, and frozen at 80°C until use. For in vitro ubiquitination assay, 2.5 mM UbcH10-His, 1 mM E1-GST, 10 mg/ml ubiquitin, 1x energy regeneration system (Boston Biochem), immunoprecipitated APC beads, and 1 ml of in vitro translated 35S-labeled cyclin A-HA (Promega) were incubated at 30°C for 1 h. The reaction was stopped with the addition of SDS sample buffer and analyzed by SDS-polyacrylamide gel electrophoresis and phosphorimaging. Densitometry was done using Imagequant software, version 1.1 (Molecular Dynamics).

RESULTS
Endogenous intracellular ROS increases throughout the cell cycle.
Prior to division into two new daughter cells, cells must double
their cellular and mitochondrial mass each cell cycle. To further
understand the relationship between cellular growth, metabolism,
and cell cycle progression, we examined various parameters of
highly synchronized cell cycle fractions obtained by centrifugal
elutriation of asynchronously dividing Jurkat leukemic T cells.
As expected, both cell size and mitochondrion content increased
linearly with similar slopes in fractions from early G
1 to S
phase (Fig.
1A), while mitochondrial potential did not fluctuate
in a cell cycle-dependent manner (not shown). Unexpectedly,
endogenous levels of ROS increased as cells progressed from
early G
1 to S phase (Fig.
1A). Consistent with the increase
in ROS from early G
1 to S phase, ROS levels also decreased as
cells transited from mitosis into early G
1 and then increased
as they progressed into S phase (Fig.
1B). In addition to Jurkats,
we also detected ROS levels increasing throughout the cell cycle
in G
1 phase-synchronized T98G human glioblastoma cells and primary
human fibroblasts (data not shown). Cells treated with antioxidants
demonstrated decreased ROS levels, whereas cells treated with
concentrations of hydrogen peroxide known to cause DNA damage
demonstrated dramatically increased ROS levels (Fig.
1B to D)
(
3). These observations show that physiologic, intracellular
ROS accumulates and oscillates in a cell cycle-dependent manner,
suggesting a potential role for ROS in proliferative signaling.
Increase in the ROS steady-state level is required for entry into S phase.
To determine if the observed ROS accumulation was required for
cell cycle progression, we treated cells with antioxidants to
prevent the increase in intracellular ROS. Treatment of serum-deprived
and restimulated G
1-synchronized T98G cells with tempol or DDC
antioxidants reduced intracellular ROS levels and induced a
strong G
1 cell cycle arrest (Fig.
2A). Untreated control cells
exhibited an increase in ROS levels and progressed into S/G
2/M
phases. Similarly, serum-deprived NIH 3T3 cells and contact
inhibited-released primary fibroblasts treated with antioxidants
also arrested in G
1 (see Fig. S1A in the supplemental material),
while control cells progressed into S and G
2/M phases. Furthermore,
G
2/M elutriated Jurkat cells treated with antioxidants progressed
from G
2/M into G
1 but failed to enter S phase, while untreated
control cells progressed through G
1 into S phase (Fig.
2A).
Likewise, antioxidant-treated G
2/M NIH 3T3 cells exited mitosis
and arrested in G
1, whereas control cells progressed into S
phase (not shown). Consistent with these observations, treatment
of primary human fibroblasts, immortalized rodent (NIH 3T3 and
Rat1a) fibroblasts, transformed human keratinocytes (HaCat cells),
T98G glioblastoma, and Jurkat leukemic T cells with various
antioxidants (DDC, dimethylthiourea, pyrrolidine dithiocarbamate,
tempol, vitamins E and C, and catalase) also induced a G
1 cell
cycle arrest (not shown). Taken together, these observations
suggest that an increase in endogenous ROS levels is necessary
for cell cycle progression through the G
1 phase of the cell
cycle.
To exclude the possibility that antioxidant-treated cells had
arrested just after initiation of DNA synthesis (a difficult
position to detect by propidium iodide-FACS analysis), G
1-synchronized
T98G cells were restimulated with 10% FBS, treated with antioxidants,
and pulsed with BrdU from 16 to 20 h. By immunofluorescence
microscopy, antioxidant-treated cells contained only background
levels of BrdU-positive cells, confirming that they arrest before
initiation of DNA synthesis (Fig.
2B). In strong agreement with
these results, FACS analysis of BrdU-pulsed cells showed background
levels of BrdU incorporation, whereas control cells had

80%
BrdU-positive cells (Fig.
2C). Although antioxidant-treated
cells failed to initiate DNA synthesis, cells remained viable
and continued to grow in size with kinetics similar to that
of control cells progressing into S/G
2/M phases (Fig.
2C). Furthermore,
upon removal of antioxidants, cells progressed into S phase
and continued to divide normally (not shown). Taken together,
these observations demonstrate that failure to accumulate a
physiologic threshold level of ROS results in a G
1 phase arrest;
however, cells continue to grow in size.
Failure to accumulate endogenous ROS results in a late G1 cell cycle arrest.
We next assessed molecular markers to define where antioxidant-treated cells had arrested in G1 phase. Control and antioxidant (tempol or DDC)-treated G1-synchronized T98G cells contained active mitogen-activated protein kinase (not shown), active cyclin D-Cdk4/6, active cyclin E-Cdk2, and similar p21 and p27 levels (Fig. 3A). Consistent with transition across the restriction point and the presence of active cyclin E-Cdk2 (21), both antioxidant-treated and control cells contained the slower-migrating inactive, hyperphosphorylated form of pRb (Fig. 3A). Control cells contained active cyclin A-Cdk2 complexes and progressed into S phase. In contrast, antioxidant-treated cells failed to activate cyclin A-Cdk2 (Fig. 3A). Similar results were observed in antioxidant-treated primary human fibroblasts (not shown). These observations suggest that antioxidant-treated cells transit across the growth factor restriction point from early G1 into late G1, but due to a failure to accumulate sufficient levels of intracellular ROS, arrest in late G1 phase.
Antioxidant-arrested cells fail to accumulate cyclin A protein.
Cyclin A protein accumulation and subsequent activation of Cdk2
or Cdk1 (
2) are critical for initiation of DNA synthesis (
14,
26,
54,
63,
80). Consequently, cyclin A-Cdk2 activity is tightly
regulated by transcription and proteolysis of the cyclin and
phosphorylation and dephosphorylation of the Cdk subunit (
70,
80). Antioxidant-treated cells contained Thr-160 phosphorylated
Cdk2, assayed for by mobility shift and phospho-specific antibody
immunoblotting (Fig.
3A and data not shown). Therefore, we focused
our attention on cyclin A regulation. Cyclin A is an E2F-responsive
gene (
30,
68) and, consistent with inactive pRb, both RT-PCR
and Northern blot analysis of antioxidant-treated and control
cells showed similar levels and kinetics of cyclin A mRNA induction
(Fig.
3B). DHFR, also an E2F responsive gene, showed a similar
pattern of mRNA induction to that of cyclin A in both control
and antioxidant-treated cells (Fig.
3B). Taken together, these
observations suggest that E2F-dependent transcription was not
altered in antioxidant-treated cells and that preventing the
accumulation of physiologic ROS results in a late G
1 cell cycle
arrest that regulates cyclin A by a posttranscriptional mechanism.
We next directly examined cyclin A protein levels. Antioxidant-treated cells failed to accumulate cyclin A protein, whereas untreated control cells contained cyclin A protein (Fig. 3B). Similar results of hyperphosphorylated pRB and absence of cyclin A protein were observed in primary human fibroblasts (see Fig. S1B in the supplemental material), indicating that these cells were arrested at the same point as the T98G cells. We next examined whether cyclin A translation was affected by preventing the increase in endogenous ROS. Sucrose density gradient polyribosome profiles revealed that cyclin A mRNA was present in the highly translated polysomal fractions in both antioxidant-treated and control cells (B. Maedge and S. F. Dowdy, unpublished data). Moreover, 35S incorporation experiments demonstrated that cyclin A was translated at a similar rate in both antioxidant-treated and control cells (see Fig. S1C in the supplemental material). These observations demonstrate that cyclin A was transcribed and translated in antioxidant-treated cells, yet cyclin A protein failed to accumulate.
Expression and phosphorylation of proteins involved in the pRb pathway occur normally in antioxidant-treated cells.
To further examine the antioxidant induced arrest, a detailed time course was conducted from 0 to 24 h (Fig. 4A). Proteins previously implicated in ROS or stress-sensing pathways such as Bcl2, c-Myc, p38, and AMP-activated protein kinase had the same expression patterns, with the same levels of phosphorylation for the latter two (15, 18, 35, 75 and data not shown). At 4 and 8 h after the addition of serum, both control and antioxidant-treated cells were in early G1, characterized by high levels of p27, low levels of cyclin E, and active hypophosphorylated pRb and p130 (Fig. 4B). Equivalent kinetics of pRb phosphorylation were also observed as both populations contained inactive hyperphosphorylated pRb (and p130) by 12 h, the same time when E2F-responsive genes were expressed. pRb inactivation, transition across the restriction point, and entry into late G1 resulted in expression of E2F responsive genes, such as cyclin E, E2F1, Cdc6, and p107, along with down-regulation of p27 in both antioxidant-treated and control cells. Conversely, cyclin A protein was absent and failed to accumulate in arrested cells, even in the presence of cyclin A transcript (Fig. 3B and 4B). Thus, preventing an increase in the steady-state level of physiologic ROS levels leads to a late G1 phase arrest where derepression of E2F-responsive genes occurs normally, but cyclin A protein fails to accumulate, suggesting that cyclin A protein stability may be affected.
Failure to accumulate intracellular ROS results in continued targeting of cyclin A for degradation by APCCdh1.
Cyclin A is ubiquitinated by APC and targeted for subsequent
degradation by the 26S proteasome in G
1 and mitosis (
56). In
late G
1 phase, cyclin A transcript levels increase after inactivation
of pRb, but the protein remains unstable due to APC
Cdh1 ubiquitination
until S phase, when APC
Cdh1 is inactivated by phosphorylation
and dissociation of Cdh1. To examine protein stability, T98G
cells were treated with cycloheximide to inhibit translation
in late G
1 (16 h) or S phase (20 h) and tempol (20 h). Cycloheximide
treatment resulted in rapid turnover of cyclin A protein in
late G
1 and antioxidant-treated cells (Fig.
5C). In contrast,
cyclin A was stable in control S phase cells (Fig.
5C).
35S
pulse-chase experiments demonstrated that cyclin A was translated
at similar rates in control and tempol-treated cells; however,
cyclin A was highly unstable in antioxidant-treated cells (see
Fig. S1C in the supplemental material). Consistent with cyclin
A instability in antioxidant-treated cells, inhibition of the
26S proteasome with MG-132 or MG-115 from 18 to 20 h post-serum
restimulation resulted in the accumulation of cyclin A protein
in antioxidant-treated cells (Fig.
5B and not shown). Cdc6 was
also stabilized by treatment with proteasome inhibitors. Furthermore,
similar results from cycloheximide and proteasome inhibitor
experiments were obtained using primary human fibroblasts (see
Fig. S1B in the supplemental material). These observations suggest
that inhibition of an increase in steady-state levels of physiologic
ROS by antioxidants results in continued degradation of cyclin
A protein.
In G
1 phase, APC activity is regulated by the presence of Cdh1,
an adapter protein that confers substrate binding specificity
(
22,
56). Dissociation of Cdh1 is necessary for APC
Cdh1 inactivation,
accumulation of cyclin A protein, and progression into S phase
(
42,
71,
72). Coimmunoprecipitation analysis of APC3 (Cdc27),
an APC subunit, confirmed that Cdh1 was associated with APC
in G
1 cells and dissociated in S phase cells (Fig.
5D). However,
antioxidant-treated cells showed continued association of Cdh1
with APC3, suggesting that APC
Cdh1 remained active in antioxidant-treated
cells. Moreover, APC ubiquitination assays showed that immunoprecipitated
APC from G
1 and antioxidant-treated samples was able to highly
ubiquitinate in vitro translated
35S-labeled cyclin A, compared
to S phase or control samples without APC (Fig.
5E). Consistent
with these observations and similar to cyclin A, Skp2, also
a G
1 target of APC
Cdh1 (
4,
79), was present at high levels in
control cells and at reduced levels in antioxidant-treated cells
(Fig.
6A). These observations demonstrate that preventing the
accumulation of endogenous ROS results in a late in G
1 phase
arrest characterized by continued APC
Cdh1 activity and degradation
of its substrates.
Antioxidant arrest is overcome by expression of Emi1.
We next sought to rescue the arrest caused by a failure to accumulate
intracellular ROS and drive cells into S phase. Ectopic expression
of wild-type cyclin A in antioxidant-treated cells by retroviral
infection or transfection failed to accumulate cyclin A protein
or drive cells into S phase (Fig.
5A and data not shown). Similarly,
cyclin A-containing mutations in (
13) or deletion of (
17) the
destruction box failed to accumulate or cause S phase entry
(not shown). These results are consistent with the literature,
as cyclin A has been shown to contain the conserved destruction
box as well as a complex extended destruction motif that can
also target it for degradation (
17,
25). Moreover, expressing
deletion constructs of the cyclin A N terminus, the portion
of cyclin A containing the destruction motifs (either

97 [
17]
or

174) resulted in very low expression levels, failure to cause
S phase progression, and frequent cell death (not shown). These
results are in agreement with the literature that overexpression
or constitutive expression of cyclin A is highly cytotoxic (
32,
50). These data show that ectopic expression of cyclin A or
various cyclin A mutants failed to rescue the antioxidant arrest.
A number of different mechanisms have been reported to inactivate or contribute to the inactivation of APCCdh1 at the late G1/S transition. Cyclin A-associated kinase has been shown to phosphorylate Cdh1, causing dissociation from and inactivation of APC (42, 71, 74). Yet, because cyclin A protein is extremely unstable in late G1 and in the antioxidant arrest, it cannot accumulate and phosphorylate Cdh1 as the initial Cdh1 inactivation mechanism. The ubiquitin conjugating enzyme UbcH10 was recently reported to be autoubiquitinated at the G1/S transition, allowing for accumulation of cyclin A and phosphorylation of Cdh1 (61). However, upon restimulation after serum deprivation, UbcH10 levels are absent and then increase at the G1/S transition (Fig. 6A) (81), demonstrating that UbcH10 levels do not correlate with APC activity or cyclin A levels.
Emi1, an E2F-responsive gene induced at the same time as cyclin A, binds to Cdh1 to prevent substrate binding, thereby inactivating APCCdh1 in late G1 phase. This initial inactivation is thought to allow accumulation of cyclin A protein, phosphorylation of Cdh1, and initiation of DNA synthesis (33). Consistent with Hsu et al. (33), Emi1 mRNA was absent in early G1 and present in both control and antioxidant-arrested cells at 16 and 20 h (see Fig. S1D in the supplemental material). However, Emi1 protein failed to accumulate in antioxidant-treated cells, mirroring the cyclin A results (Fig. 6A; see Fig. S1D in the supplemental material). Therefore, we examined Emi1 protein stability with cycloheximide treatment, as before, and found that Emi1 protein was highly unstable in antioxidant-treated cells (Fig. 6B). In agreement with Emi1 instability, inhibition of the proteasome with MG-115 or MG-132 showed accumulation of Emi1 protein in antioxidant-treated cells, as well as in late G1 and S phase cells (Fig. 6C and data not shown). Similar Emi1 results were obtained using primary human fibroblasts (see Fig. S1B in the supplemental material). Other APC substrates such as cyclin B, Cdc20, and Polo-like kinase (Plk1) also failed to accumulate in antioxidant-treated cells. Recently, Evi5 was shown to protect Emi1 from phosphorylation by Plk1 and ubiquitination by SCFßTrCP (19). Yet, even in the presence of Evi5 and absence of Plk1, Emi1 protein is rapidly degraded (Fig. 6D). These observations demonstrate that Emi1 protein is inherently unstable in antioxidant-treated, late G1 and S phase cells.
Overexpression of Emi1 has been found to inactivate APC, shorten G1, and increase the number of cells in S phase (33). To test if Emi1 could rescue the antioxidant-induced arrest, T98G cells were transfected with Myc-tagged Emi1. Unlike cyclin A, overexpression of Emi1 did not induce cytotoxicity. Ectopic expression of Myc-tagged Emi1 in antioxidant-treated cells rescued the late G1 arrest, driving cells into S and G2/M phases (Fig. 6E). Taken together, these observations suggest that accumulation of physiologic ROS levels plays a role in the accumulation or stabilization of Emi1 protein and/or inactivation of APCCdh1 at the late G1/S phase transition, allowing accumulation of APCCdh1 substrates necessary for S phase initiation, including cyclin A.

DISCUSSION
ROS is known to cause oxidative stress and DNA damage at high
levels; however, at low physiologic levels, ROS can stimulate
proliferation (
9,
66) and regulate protein function (
24). Here,
we show that endogenous physiologic ROS levels increase in a
cell cycle-dependent manner and oscillate with every cell division.
Preventing the accumulation in steady-state ROS levels by antioxidant
treatment results in activation of a novel late G
1 phase checkpoint
after transition across the restriction point that is characterized
by active cyclin E-Cdk2 complexes, inactive hyperphosphorylated
pRb, and induction of E2F target genes, including cyclin A and
Emi1. However, the cells arrest in late G
1 with continued APC
Cdh1 activity targeting cyclin A for degradation and preventing S
phase entry (Fig.
7). In addition to cyclin A, other proteins
necessary for DNA replication, such as Dbf4 (
23), thymidylate
kinase, and thymidine kinase (
37), have been identified as APC
substrates.
Emi1, an APC inhibitor, also failed to accumulate in antioxidant-arrested
cells. Upon closer examination, Emi1 protein accumulated after
Emi1 transcript in late G
1 and was stabilized by proteasome
inhibitors, similar to cyclin A. Emi1 is phosphorylated by Plk1
(
51), ubiquitinated by SCF
ßTrCP, and degraded by the
proteasome at the onset of mitosis (
27,
44). However, Plk1,
also an APC
Cdh1 substrate (
56), is not expressed in late G
1 or antioxidant-arrested cells; therefore, Emi1 degradation is
likely due to another mechanism. Furthermore, Evi5 was recently
shown to bind to and stabilize Emi1 by preventing SCF
ßTrCP association in S and G
2 phases, allowing accumulation of Emi1
and APC
Cdh1 inactivation (
19). However, even in the presence
of Evi5, Emi1 protein is unstable. Emi1 is a zinc binding protein
(
62) that contains many cysteine residues, and therefore, it
is plausible that Emi1 or the Emi1-Evi5 interaction could be
redox regulated. Alternatively, Emi1 also contains KEN and D-box
motifs, known to target substrates to APC (
57), suggesting that
Emi1 could function as a substrate or inhibitor of APC
Cdh1,
depending on redox modification. Yet it is also conceivable
that APC
Cdh1 itself could be redox sensitive. APC contains at
least 12 subunits with many phosphorylation sites (
38), and
it is plausible that ROS-mediated activation of a kinase, inactivation
of a phosphatase, or structural change could trigger a decrease
in APC
Cdh1 activity to initiate the feed-forward loop of APC
Cdh1 inactivation. Extensive studies into redox regulation of Emi1
and APC
Cdh1 will ultimately be required to dissect these pathways.
ROS can affect the activity of phosphatases, kinases, and transcription factors (46, 66), influencing protein activity of downstream pathways. SUMOylation, a posttranslational modification affecting protein activity, is also inhibited in the presence of low physiologic ROS levels (6). Direct redox modification of cysteine residues in proteins by the formation of disulfide bonds, cyclic sulfonamides, S-hydroxylation, S-nitrosylation, and S-glutathiolation can affect protein activity in a manner similar to the removal or addition of a phosphate group (24). However, it has not yet been defined how ROS affects APCCdh1 or Emi1.
Here, we demonstrate that an increase in endogenous ROS steady-state levels from late G1 to S phase affects APCCdh1 activity or Emi1 protein stability to allow initiation of DNA replication. There are several potential sources that generate endogenous ROS including mitochondria, peroxisomes, and NADPH oxidase (66). Interestingly, cells without functional mitochondria (
o [11, 12]) or cells treated with small interfering RNA against NADPH oxidase subunits still proliferate (7) but at a reduced rate. However, it remains unclear as to whether a single species or source or multiple species from multiple sources of ROS are involved in regulating APCCdh1 activity.
In summary, we find that a failure to achieve a critical level of intracellular ROS activates a previously uncharacterized late G1 phase arrest, and we propose that this is an intrinsic late G1 phase checkpoint that monitors the cellular metabolic state prior to replication of the genome. This arrest occurs after transition across the growth factor restriction point and either directly or indirectly (through Emi1) regulates APCCdh1 activity. APCCdh1 inactivation is necessary for accumulation of substrates essential for DNA replication, including cyclin A (72), Dbf4 (23), thymidylate kinase, thymidine kinase (37), Skp2, and Cks1 (4). We also found that an antioxidant-induced G1 arrest occurs in budding yeast (M.V. Wagner and S. F. Dowdy, unpublished observations), suggesting that this may be an intrinsic evolutionary conserved feedback mechanism to monitor the status of cellular metabolism prior to commitment of DNA synthesis. These observations reveal an intrinsic late G1 phase checkpoint that links cellular ROS production, and possibly metabolism, with cell cycle progression via APCCdh1-mediated protein degradation.

ACKNOWLEDGMENTS
We thank P. K. Jackson for pCS2-Emi1, Emi1 antibody, and Evi5
antibody; P. Kaldes and J. Pines for cyclin A plasmids; and
A. Wynshaw-Boris for critical input.
N.Y. was funded by JSPS Research Fellowships for Young Scientists. This work was supported by the Howard Hughes Medical Institute (S.F.D.).

FOOTNOTES
* Corresponding author. Mailing address: Howard Hughes Medical Institute, Department of Cellular and Molecular Medicine, University of CaliforniaSan Diego, School of Medicine, 9500 Gilman Dr., La Jolla, CA 92093-0686. Phone: (858) 534-7772. Fax: (858) 534-7797. E-mail:
sdowdy{at}ucsd.edu.

Supplemental material for this article may be found at http://mcb.asm.org/. 
Present addresses: Weill Medical College of Cornell, New York, N.Y. 

REFERENCES
1 - Akagi, T., T. Shishido, K. Murata, and H. Hanafusa. 2000. v-Crk activates the phosphoinositide 3-kinase/AKT pathway in transformation. Proc. Natl. Acad. Sci. USA 97:7290-7295.[Abstract/Free Full Text]
2 - Aleem, E., H. Kiyokawa, and P. Kaldis. 2005. Cdc2-cyclin E complexes regulate the G1/S phase transition. Nat. Cell Biol. 7:831-836.[CrossRef][Medline]
3 - Barnouin, K., M. L. Dubuisson, E. S. Child, S. Fernandez de Mattos, J. Glassford, R. H. Medema, D. J. Mann, and E. W. Lam. 2002. H2O2 induces a transient multi-phase cell cycle arrest in mouse fibroblasts through modulating cyclin D and p21Cip1 expression. J. Biol. Chem. 277:13761-13770.[Abstract/Free Full Text]
4 - Bashir, T., N. V. Dorrello, V. Amador, D. Guardavaccaro, and M. Pagano. 2004. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature 428:190-193.[CrossRef][Medline]
5 - Blaise, G. A., D. Gauvin, M. Gangal, and S. Authier. 2005. Nitric oxide, cell signaling and cell death. Toxicology 208:177-192.[CrossRef][Medline]
6 - Bossis, G., F. Melchior. 2006. Regulation of SUMOylation by reversible oxidation of SUMO conjugating enzymes. Mol. Cell 21:349-357.[CrossRef][Medline]
7 - Brar, S. S., T. P. Kennedy, A. B. Sturrock, T. P. Huecksteadt, M. T. Quinn, A. R. Whorton, and J. R. Hoidal. 2002. An NAD(P)H oxidase regulates growth and transcription in melanoma cells. Am. J. Physiol. Cell Physiol. 282:C1212-C1224.[Abstract/Free Full Text]
8 - Brunelle, J. K., E. L. Bell, N. M. Quesada, K. Vercauteren, V. Tiranti, M. Zeviani, R. C. Scarpulla, and N. S. Chandel. 2005. Oxygen sensing requires mitochondrial ROS but not oxidative phosphorylation. Cell Metab. 1:409-414.[CrossRef][Medline]
9 - Burdon, R. H. 1995. Superoxide and hydrogen peroxide in relation to mammalian cell proliferation. Free Radic. Biol. Med. 18:775-794.[CrossRef][Medline]
10 - Cam, H., E. Balciunaite, A. Blais, A. Spektor, R. C. Scarpulla, R. Young, Y. Kluger, and B. D. Dynlacht. 2004. A common set of gene regulatory networks links metabolism and growth inhibition. Mol. Cell. 16:399-411.[CrossRef][Medline]
11 - Chandel, N. S., E. Maltepe, E. Goldwasser, C. E. Mathieu, M. C. Simon, and P. T. Schumacker. 1998. Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc. Natl. Acad. Sci. USA 95:11715-11720.[Abstract/Free Full Text]
12 - Chandel, N. S., and P. T. Schumacker. 2000. Cellular oxygen sensing by mitochondria: old questions, new insight. J. Appl. Physiol. 88:1880-1889.[Abstract/Free Full Text]
13 - Chibazakura, T., S. G. McGrew, J. A. Cooper, H. Yoshikawa, and J. M. Roberts. 2004. Regulation of cyclin-dependent kinase activity during mitotic exit and maintenance of genome stability by p21, p27, and p107. Proc. Natl. Acad. Sci. USA 101:4465-4470.[Abstract/Free Full Text]
14 - Coverley, D., H. Laman, and R. A. Laskey. 2002. Distinct roles for cyclins E and A during DNA replication complex assembly and activation. Nat. Cell Biol. 4:523-528.[CrossRef][Medline]
15 - Dang, C. V., F. Li, and L. A. Lee. 2005. Could MYC induction of mitochondrial biogenesis be linked to ROS production and genomic instability? Cell Cycle 4:1465-1466.[Medline]
16 - del Bello, B., A. Paolicchi, M. Comporti, A. Pompella, and E. Maellaro. 1999. Hydrogen peroxide produced during gamma-glutamyl transpeptidase activity is involved in prevention of apoptosis and maintenance of proliferation in U937 cells. FASEB J. 13:69-79.[Abstract/Free Full Text]
17 - den Elzen, N., and J. Pines. 2001. Cyclin A is destroyed in prometaphase and can delay chromosome alignment and anaphase. J. Cell Biol. 153:121-136.[Abstract/Free Full Text]
18 - Deng, X., F. Gao, and W. S. May, Jr. 2003. Bcl2 retards G1/S cell cycle transition by regulating intracellular ROS. Blood 102:3179-3185.[Abstract/Free Full Text]
19 - Eldridge, A. G., A. V. Loktev, D. V. Hansen, E. W. Verschuren, J. D. R. Reimann, and P. K. Jackson. 2006. The evi5 oncogene regulates cyclin accumulation by stabilizing the anaphase-promoting complex inhibitor emi1. Cell 124:367-380.[CrossRef][Medline]
20 - Esteban, M. A., and P. H. Maxwell. 2005. HIF, a missing link between metabolism and cancer. Nat. Med. 11:1047-1048.[CrossRef][Medline]
21 - Ezhevsky, S. A., A. Ho, M. Becker-Hapak, P. K. Davis, and S. F. Dowdy. 2001. Differential regulation of retinoblastoma tumor suppressor protein by G1 cyclin-dependent kinase complexes in vivo. Mol. Cell. Biol. 21:4773-4784.[Abstract/Free Full Text]
22 - Fang, G., H. Yu, and M. W. Kirschner. 1998. Direct binding of CDC20 protein family members activates the anaphase-promoting complex in mitosis and G1. Mol. Cell 2:163-171.[CrossRef][Medline]
23 - Ferreira, M. F., C. Santocanale, L. S. Drury, and J. F. Diffley. 2000. Dbf4p, an essential S phase-promoting factor, is targeted for degradation by the anaphase-promoting complex. Mol. Cell. Biol. 20:242-248.[Abstract/Free Full Text]
24 - Filomeni, G., G. Rotilio, and M. R. Ciriolo. 2005. Disulfide relays and phosphorylative cascades: partners in redox-mediated signaling pathways. Cell Death Differ. 12:1555-1563.[CrossRef][Medline]
25 - Geley, S., E. Kramer, C. Gieffers, J. Gannon, J. M. Peters, and T. Hunt. 2001. Anaphase-promoting complex/cyclosome-dependent proteolysis of human cyclin A starts at the beginning of mitosis and is not subject to the spindle assembly checkpoint. J. Cell Biol. 153:137-148.[Abstract/Free Full Text]
26 - Girard, F., U. Strausfeld, A. Fernandez, and N. J. Lamb. 1991. Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell 67:1169-1179.[CrossRef][Medline]
27 - Guardavaccaro, D., Y. Kudo, J. Boulaire, M. Barchi, L. Busino, M. Donzelli, F. Margottin-Goguet, P. K. Jackson, L. Yamasaki, and M. Pagano. 2003. Control of meiotic and mitotic progression by the F box protein beta-Trcp1 in vivo. Dev. Cell 4:799-812.[CrossRef][Medline]
28 - Guzy, R. D., B. Hoyos, E. Robin, H. Chen, L. Liu, K. D. Mansfield, M. C. Simon, U. Hammerling, and P. T. Schumacker. 2005. Mitochondrial complex III is required for hypoxia-induced ROS production and cellular oxygen sensing. Cell Metab. 1:401-408.[CrossRef][Medline]
29 - Hatzivassiliou, G., F. Zhao, D. E. Bauer, C. Andreadis, A. N. Shaw, D. Dhanak, S. R. Hingorani, D. A. Tuveson, and C. B. Thompson. 2005. ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell 8:311-321.[CrossRef][Medline]
30 - Henglein, B., X. Chenivesse, J. Wang, D. Eick, and C. Brechot. 1994. Structure and cell cycle-regulated transcription of the human cyclin A gene. Proc. Natl. Acad. Sci. USA 91:5490-5494.[Abstract/Free Full Text]
31 - Ho, A., and S. F. Dowdy. 2002. Regulation of G1 cell-cycle progression by oncogenes and tumor suppressor genes. Curr. Opin. Genet. Dev. 12:47-52.[CrossRef][Medline]
32 - Hoang, A. T., K. J. Cohen, J. F. Barrett, D. A. Bergstrom, and C. V. Dang. 1994. Participation of cyclin A in Myc-induced apoptosis. Proc. Natl. Acad. Sci. USA 91:6875-6879.[Abstract/Free Full Text]
33 - Hsu, J. Y., J. D. Reimann, C. S. Sorensen, J. Lukas, and P. K. Jackson. 2002. E2F-dependent accumulation of hEmi1 regulates S phase entry by inhibiting APC(Cdh1). Nat. Cell Biol. 4:358-366.[CrossRef][Medline]
34 - Irani, K., Y. Xia, J. L. Zweier, S. J. Sollott, C. J. Der, E. R. Fearon, M. Sundaresan, T. Finkel, and P. J. Goldschmidt-Clermont. 1997. Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts. Science 275:1649-1652.[Abstract/Free Full Text]
35 - Jones, R. G., D. R. Plas, S. Kubek, M. Buzzai, J. Mu, Y. Xu, M. J. Birnbaum, and C. B. Thompson. 2005. AMP-activated protein kinase induces a p53-dependent metabolic checkpoint. Mol. Cell 18:283-293.[CrossRef][Medline]
36 - Jorgensen, P., and M. Tyers. 2004. How cells coordinate growth and division. Curr. Biol. 14:R1014-R1027.[CrossRef][Medline]
37 - Ke, P. Y., Y. Y. Kuo, C. M. Hu, and Z. F. Chang. 2005. Control of dTTP pool size by anaphase promoting complex/cyclosome is essential for the maintenance of genetic stability. Genes Dev. 19:1920-1933.[Abstract/Free Full Text]
38 - Kraft, C., F. Herzog, C. Gieffers, K. Mechtler, A. Hagting, J. Pines, and J. M. Peters. 2003. Mitotic regulation of the human anaphase-promoting complex by phosphorylation. EMBO J. 22:6598-6609.[CrossRef][Medline]
39 - Lambeth, J. D. 2004. NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4:181-189.[CrossRef][Medline]
40 - Lim, S. D., C. Sun, J. D. Lambeth, F. Marshall, M. Amin, L. Chung, J. A. Petros, and R. S. Arnold. 2005. Increased Nox1 and hydrogen peroxide in prostate cancer. Prostate 62:200-207.[CrossRef][Medline]
41 - Lissy, N. A., P. K. Davis, M. Irwin, W. G. Kaelin, and S. F. Dowdy. 2000. A common E2F-1 and p73 pathway mediates cell death induced by TCR activation. Nature 407:642-645.[CrossRef][Medline]
42 - Lukas, C., C. S. Sorensen, E. Kramer, E. Santoni-Rugiu, C. Lindeneg, J. M. Peters, J. Bartek, and J. Lukas. 1999. Accumulation of cyclin B1 requires E2F and cyclin-A-dependent rearrangement of the anaphase-promoting complex. Nature 401:815-818.[CrossRef][Medline]
43 - Mansfield, K. D., R. D. Guzy, Y. Pan, R. M. Young, T. P. Cash, P. T. Schumacker, and M. C. Simon. 2005. Mitochondrial dysfunction resulting from loss of cytochrome c impairs cellular oxygen sensing and hypoxic HIF-
activation. Cell Metab. 1:393-399.[CrossRef][Medline] 44 - Margottin-Goguet, F., J. Y. Hsu, A. Loktev, H. M. Hsieh, J. D. Reimann, and P. K. Jackson. 2003. Prophase destruction of Emi1 by the SCF(betaTrCP/Slimb) ubiquitin ligase activates the anaphase promoting complex to allow progression beyond prometaphase. Dev. Cell 4:813-826.[CrossRef][Medline]
45 - Mason, B., N. Ghanee, W. G. Haigh, S. P. Lee, and D. Oda. 1999. Effect of vitamins A, C and E on normal and HPV-immortalized human oral epithelial cells in culture. Anticancer Res. 19:5469-5474.[Medline]
46 - Meng, T. C., T. Fukada, and N. K. Tonks. 2002. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol. Cell 9:387-399.[CrossRef][Medline]
47 - Menon, S. G., E. H. Sarsour, D. R. Spitz, R. Higashikubo, M. Sturm, H. Zhang, and P. C. Goswami. 2003. Redox regulation of the G1 to S phase transition in the mouse embryo fibroblast cell cycle. Cancer Res. 63:2109-2117.[Abstract/Free Full Text]
48 - Mitchell, J. B., S. Xavier, A. M. DeLuca, A. L. Sowers, J. A. Cook, M. C. Krishna, S. M. Hahn, and A. Russo. 2003. A low molecular weight antioxidant decreases weight and lowers tumor incidence. Free Radic. Biol. Med. 34:93-102.[CrossRef][Medline]
49 - Mitsushita, J., J. D. Lambeth, T. Kamata. 2004. The superoxide-generating oxidase Nox1 is functionally required for Ras oncogene transformation. Cancer Res. 64:3580-3585.[Abstract/Free Full Text]
50 - Morgan, D. O. 1992. Cell cycle control in normal and neoplastic cells. Curr. Opin. Genet. Dev. 2:33-37.[CrossRef][Medline]
51 - Moshe, Y., J. Boulaire, M. Pagano, and A. Hershko. 2004. Role of Polo-like kinase in the degradation of early mitotic inhibitor 1, a regulator of the anaphase promoting complex/cyclosome. Proc. Natl. Acad. Sci. USA 101:7937-7942.[Abstract/Free Full Text]
52 - Murrell, G. A., M. J. Francis, and L. Bromley. 1990. Modulation of fibroblast proliferation by oxygen free radicals. Biochem. J. 265:659-665.[Medline]
53 - Oyama, Y., A. Hayashi, T. Ueha, and K. Maekawa. 1994. Characterization of 2',7'-dichlorofluorescin fluorescence in dissociated mammalian brain neurons: estimation on intracellular content of hydrogen peroxide. Brain Res. 635:113-117.[CrossRef][Medline]
54 - Pagano, M., R. Pepperkok, F. Verde, W. Ansorge, and G. Draetta. 1992. Cyclin A is required at two points in the human cell cycle. EMBO J. 11:961-971.[Medline]
55 - Pani, G., R. Colavitti, B. Bedogni, R. Anzevino, S. Borrello, and T. Galeotti. 2000. A redox signaling mechanism for density-dependent inhibition of cell growth. J. Biol. Chem. 275:38891-38899.[Abstract/Free Full Text]
56 - Peters, J. M. 2002. The anaphase-promoting complex: proteolysis in mitosis and beyond. Mol. Cell 9:931-943.[CrossRef][Medline]
57 - Pfleger, C. M., and M. W. Kirschner. 2000. The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev. 14:655-665.[Abstract/Free Full Text]
58 - Policastro, L., B. Molinari, F. Larcher, P. Blanco, O. L. Podhajcer, C. S. Costa, P. Rojas, and H. Duran. 2004. Imbalance of antioxidant enzymes in tumor cells and inhibition of proliferation and malignant features by scavenging hydrogen peroxide. Mol. Carcinog. 39:103-113.[CrossRef][Medline]
59 - Preston, T. J., W. J. Muller, and G. Singh. 2001. Scavenging of extracellular H2O2 by catalase inhibits the proliferation of HER-2/Neu-transformed rat-1 fibroblasts through the induction of a stress response. J. Biol. Chem. 276:9558-9564.[Abstract/Free Full Text]
60 - Rao, G. N., and B. C. Berk. 1992. Active oxygen species stimulate vascular smooth muscle cell growth and proto-oncogene expression. Circ. Res. 70:593-599.[Abstract/Free Full Text]
61 - Rape, M., and M. W. Kirschner. 2004. Autonomous regulation of the anaphase-promoting complex couples mitosis to S-phase entry. Nature 432:588-595.[CrossRef][Medline]
62 - Reimann, J. D., E. Freed, J. Y. Hsu, E. R. Kramer, J. M. Peters, and P. K. Jackson. 2001. Emi1 is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Cell 105:645-655.[CrossRef][Medline]
63 - Resnitzky, D., L. Hengst, and S. I. Reed. 1995. Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol. Cell. Biol. 15:4347-4352.[Abstract]
64 - Ruiz-Gines, J. A., S. Lopez-Ongil, M. Gonzalez-Rubio, L. Gonzalez-Santiago, M. Rodriguez-Puyol, and D. Rodriguez-Puyol. 2000. Reactive oxygen species induce proliferation of bovine aortic endothelial cells. J. Cardiovasc. Pharmacol. 35:109-113.[CrossRef][Medline]
65 - Sauer, H., B. Klimm, J. Hescheler, and M. Wartenberg. 2001. Activation of p90RSK and growth stimulation of multicellular tumor spheroids are dependent on reactive oxygen species generated after purinergic receptor stimulation by ATP. FASEB J. 15:2539-2541.[Abstract/Free Full Text]
66 - Sauer, H., M. Wartenberg, and J. Hescheler. 2001. Reactive oxygen species as intracellular messengers during cell growth and differentiation. Cell Physiol. Biochem. 11:173-186.[CrossRef][Medline]
67 - Schubert, R., L. Erker, C. Barlow, H. Yakushiji, D. Larson, A. Russo, J. B. Mitchell, and A. Wynshaw-Boris. 2004. Cancer chemoprevention by the antioxidant tempol in Atm-deficient mice. Hum. Mol. Genet. 13:1793-1802.[Abstract/Free Full Text]
68 - Schulze, A., K. Zerfass, D. Spitkovsky, S. Middendorp, J. Berges, K. Helin, P. Jansen-Durr, and B. Henglein. 1995. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc. Natl. Acad. Sci. USA 92:11264-11268.[Abstract/Free Full Text]
69 - Sen Gupta, R., E. Sen Gupta, B. K. Dhakal, A. R. Thakur, and J. Ahnn. 2004. Vitamin C and vitamin E protect the rat testes from cadmium-induced reactive oxygen species. Mol. Cell 17:132-139.
70 - Sherr, C. J., and J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13:1501-1512.[Free Full Text]
71 - Sorensen, C. S., C. Lukas, E. R. Kramer, J. M. Peters, J. Bartek, and J. Lukas. 2001. A conserved cyclin-binding domain determines functional interplay between anaphase-promoting complex-Cdh1 and cyclin A-Cdk2 during cell cycle progression. Mol. Cell. Biol. 21:3692-3703.[Abstract/Free Full Text]
72 - Sorensen, C. S., C. Lukas, E. R. Kramer, J. M. Peters, J. Bartek, and J. Lukas. 2000. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis. Mol. Cell. Biol. 20:7613-7623.[Abstract/Free Full Text]
73 - Sundaresan, M., Z. X. Yu, V. J. Ferrans, K. Irani, and T. Finkel. 1995. Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science 270:296-299.[Abstract/Free Full Text]
74 - Szatrowski, T. P., and C. F. Nathan. 1991. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. 51:794-798.[Abstract/Free Full Text]
75 - Torres, M., and H. J. Forman. 2003. Redox signaling and the MAP kinase pathways. Biofactors 17:287-296.[Medline]
76 - Turley, J. M., F. W. Ruscetti, S. J. Kim, T. Fu, F. V. Gou, and M. C. Birchenall-Roberts. 1997. Vitamin E succinate inhibits proliferation of BT-20 human breast cancer cells: increased binding of cyclin A negatively regulates E2F transactivation activity. Cancer Res. 57:2668-2675.[Abstract/Free Full Text]
77 - Vodermaier, H. C., C. Gieffers, S. Maurer-Stroh, F. Eisenhaber, and J. M. Peters. 2003. TPR subunits of the anaphase-promoting complex mediate binding to the activator protein CDH1. Curr. Biol. 13:1459-1468.[CrossRef][Medline]
78 - Wartenberg, M., H. Diedershagen, J. Hescheler, and H. Sauer. 1999. Growth stimulation versus induction of cell quiescence by hydrogen peroxide in prostate tumor spheroids is encoded by the duration of the Ca(2+) response. J. Biol. Chem. 274:27759-27767.[Abstract/Free Full Text]
79 - Wei, W., N. G. Ayad, Y. Wan, G. J. Zhang, M. W. Kirschner, and W. G. Kaelin, Jr. 2004. Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature 428:194-198.[CrossRef][Medline]
80 - Woo, R. A., and R. Y. Poon. 2003. Cyclin-dependent kinases and S phase control in mammalian cells. Cell Cycle 2:316-324.[Medline]
81 - Yamanaka, A., S. Hatakeyama, K. Kominami, M. Kitagawa, M. Matsumoto, and K. Nakayama. 2000. Cell cycle-dependent expression of mammalian E2-C regulated by the anaphase-promoting complex/cyclosome. Mol. Biol. Cell. 11:2821-2831.[Abstract/Free Full Text]
Molecular and Cellular Biology, June 2006, p. 4701-4711, Vol. 26, No. 12
0270-7306/06/$08.00+0 doi:10.1128/MCB.00303-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Jahnke, V. E., Sabido, O., Freyssenet, D.
(2009). Control of mitochondrial biogenesis, ROS level, and cytosolic Ca2+ concentration during the cell cycle and the onset of differentiation in L6E9 myoblasts. Am. J. Physiol. Cell Physiol.
296: C1185-C1194
[Abstract]
[Full Text]
-
Murapa, P., Gandhapudi, S., Skaggs, H. S., Sarge, K. D., Woodward, J. G.
(2007). Physiological Fever Temperature Induces a Protective Stress Response in T Lymphocytes Mediated by Heat Shock Factor-1 (HSF1). J. Immunol.
179: 8305-8312
[Abstract]
[Full Text]
-
Heiss, E. H., Schilder, Y. D. C., Dirsch, V. M.
(2007). Chronic Treatment with Resveratrol Induces Redox Stress- and Ataxia Telangiectasia-mutated (ATM)-dependent Senescence in p53-positive Cancer Cells. J. Biol. Chem.
282: 26759-26766
[Abstract]
[Full Text]