MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vermeulen, M.
Right arrow Articles by Stunnenberg, H. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vermeulen, M.
Right arrow Articles by Stunnenberg, H. G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, July 2006, p. 5226-5236, Vol. 26, No. 14
0270-7306/06/$08.00+0     doi:10.1128/MCB.00440-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

A Feed-Forward Repression Mechanism Anchors the Sin3/Histone Deacetylase and N-CoR/SMRT Corepressors on Chromatin

Michiel Vermeulen,1 Wendy Walter,2 Xavier Le Guezennec,1 Jaehoon Kim,3 Rajeswari S. Edayathumangalam,4 Edwin Lasonder,5 Karolin Luger,4 Robert G. Roeder,3 Colin Logie,1 Shelley L. Berger,2 and Hendrik G. Stunnenberg1*

Department of Molecular Biology, Nijmegen Center for Molecular Life Sciences, Radboud University, 6500 HB Nijmegen, The Netherlands,1 Gene Expression and Regulation Program, The Wistar Institute, Philadelphia, Pennsylvania 19024,2 Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, New York 10021,3 Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870,4 Center for Molecular and Biomolecular Informatics, University Medical Centre St. Radboud, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands5

Received 13 March 2006/ Returned for modification 17 April 2006/ Accepted 28 April 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transcription in eukaryotes is governed in part by histone acetyltransferase (HAT)- and histone deacetylase (HDAC)-containing complexes that are recruited via activators and repressors, respectively. Here, we show that the Sin3/HDAC and N-CoR/SMRT corepressor complexes repress transcription from histone H3- and/or H4-acetylated nucleosomal templates in vitro. Repression of histone H3-acetylated templates was completely dependent on the histone deacetylase activity of the corepressor complexes, whereas this activity was not required to repress H4-acetylated templates. Following deacetylation, both complexes become stably anchored in a repressor-independent manner to nucleosomal templates containing hypoacetylated histone H3, but not H4, resulting in dominance of repression over activation. The observed stable anchoring of corepressor complexes casts doubt on the view of a dynamic balance between readily exchangeable HAT and HDAC activities regulating transcription and implies that pathways need to be in place to actively remove HDAC complexes from hypoacetylated promoters to switch on silent genes.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The assembly of eukaryotic genomes into nucleosomes and further into higher-order chromatin poses a physical barrier for the transcription machinery. The accessibility of chromatin is governed partly by posttranslational modifications of particular amino acids, e.g., acetylation and methylation of lysines, in the core histones that make up the nucleosome. These histone marks provide spatial and functional information and serve as a scaffold for binding of regulatory proteins (10, 22). To gain insights into the mechanisms regulating (in)accessibility, it is important to characterize the complexes that write, read, and translate these histone marks and to study their interplay.

Histone lysine (de)acetylation is one of the regulatory posttranslational modifications that is catalyzed by histone acetyltransferases (HATs) and histone deacetylases (HDACs). Recruitment of HATs to and subsequent acetylation of nucleosomes at promoters are associated with gene activation, whereas recruitment of HDACs and deacetylation are linked to transcriptional repression. Histone deacetylation of nucleosomes in promoter regions mediated by HDAC-containing corepressor complexes is thought to be a primary means of shutting down active loci (13, 18, 20). The order and hierarchy of events and the mechanisms underlying the conversion from an active to an inactive gene or vice versa have, however, remained largely elusive.

The prevalent view is that HATs and HDACs are in a dynamic equilibrium and readily exchangeable. If this scenario holds true, then disturbing the balance between acetylation and deacetylation by the addition of inhibitors like trichostatin A (TSA) should cause a global increase of transcription. However, global expression analyses have revealed that the addition of TSA to culture cells causes upregulation of only a few percent of the genes present in the genome, arguing that the vast majority of repressed genes in the cell cannot be derepressed simply by inhibiting HDAC activity (15, 25).

In vitro experiments using purified HATs and reconstituted nucleosomal templates have revealed that specific targeting of HATs to promoters facilitates subsequent transcription reactions in an acetyl coenzyme A (acetyl-CoA)-dependent manner (12, 21, 24). Functional data assessing the ability of HDACs to counteract HAT-mediated activation of transcription have so far been lacking. Recently, we established an in vitro system that allows sequential targeting of HATs and HDACs to immobilized reconstituted nucleosomal templates. Using this approach, we were able to show that the Sin3/HDAC and N-CoR/SMRT corepressor complexes and their histone deacetylase activities can be recruited to nucleosomal templates by using chimeric repressor molecules (26). Here, we complement these recruitment assays to include transcription, allowing us to dissect the mechanism underlying the ability of corepressor complexes to repress transcription in vitro. Upon recruitment to immobilized nucleosomal templates, both the Sin3/HDAC and N-CoR/SMRT complexes were able to repress transcription from templates that were poised for transcription in vitro by SAGA- and NuA4-mediated acetylation of histone H3 and/or H4 tails. Repression of histone H3-acetylated templates was completely dependent on the histone deacetylase activity of the corepressor complexes, whereas this activity was not required to repress H4-acetylated templates. Further analyses revealed that histone H3 acetylation prevents a stable repressor-independent anchoring of the corepressor complexes to the immobilized nucleosomal templates. These experiments indicate that following an initial repressor-dependent recruitment of corepressor complexes to promoters, deacetylation of histone H3, but not H4, results in a repressor-independent stable anchoring of corepressors to H3-hypoacetylated nucleosomes, culminating in dominance of repression over activation.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein purifications. Saccharomyces cerevisiae histone acetyltransferases were purified as described previously on Ni-nitrilotriacetic acid agarose (QIAGEN), MonoQ, and Superose 6 columns (Amersham) (3). LexA-Mad(5-24), LexA-TR(DE), the Sin3/HDAC and N-CoR/SMRT complexes, and competitor chicken oligonucleosomes were purified as described previously (26). Enrichments (n-fold) for the Sin3/HDAC and N-CoR/SMRT complexes were ~1,000-fold and ~500-fold, respectively. HeLa nuclear extract was prepared as described by Dignam et al. (2). Nuclear extracts were precipitated by adding 0.33 g of ammonium sulfate per milliliter of extract, after which the resulting protein pellets were resuspended and dialyzed against 100 mM KCl, 20 mM HEPES, pH 7.8, 20% glycerol, 0.2 mM EDTA, 1 mM dithiothreitol, and 0.2 mM phenylmethylsulfonyl fluoride. Dialyzed extracts were clarified by centrifugation, aliquoted, and stored at –80°C.

In vitro transcription reactions. Plasmid L8G5E4T was obtained by cloning eight LexA sites in the PstI and HindIII sites of vector G5E4T (7). This vector was digested with EcoRI, filled in with Klenow polymerase by using biotinylated ATP (Invitrogen), and subsequently cleaved with Asp718 (Roche) to obtain an ~3,500-bp fragment which is biotinylated on one end. The DNA was gel purified and reconstituted with recombinant Xenopus octamers as described previously (14). The reconstituted nucleosomal template (30 ng) was acetylated using purified yeast SAGA or NuA4 complex for 30 min at 30°C in buffer F (50 mM KCl, 10 mM HEPES, pH 7.8, 5% glycerol, 2 mM MgCl2, 0.25 mg/ml bovine serum albumin, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride) containing 10 mM sodium butyrate and 5 µM acetyl-CoA. Nucleosomal templates were then immobilized on streptavidin-conjugated Dynabeads (Dynal) and washed extensively with buffer F containing 300 mM KCl and 0.5% Triton X-100 to strip the HATs of the templates. Next, beads were incubated with targeting molecule LexA-Mad, a mutated LexA-Mad molecule, or LexA-TR(DE) (with or without T3 ligand) for 15 min at 30°C in buffer B containing 75 mM KCl, 0.05% NP-40, and complete protease inhibitors (Roche). Beads were then washed with buffer F containing 200 mM KCl, 0.25% Triton X-100, and complete protease inhibitors and subsequently incubated with purified Sin3/HDAC or N-CoR/SMRT complex in the presence of a large excess of nonimmobilized native chicken erythrocyte nucleosomal arrays (5) in buffer F containing 75 mM KCl, 0.05% NP-40, and complete protease inhibitors for 1 hour at 37°C. After being washed extensively with buffer F containing 200 mM KCl and 0.25% Triton X-100, templates were resuspended in 20 µl buffer F, after which 25 µl transcription buffer [60 mM KCl, 30 mM HEPES, pH 7.8, 12 mM MgCl2, 4% polyvinyl alcohol, 10 mM sodium butyrate, 12 ng/µl poly(dIdC), 2 ng/µl pBluescript, 20 mM creatine phosphate, 2 mM ATP, and 1 unit of RNA guard (Amersham)] was added, followed by 10 µl HeLa nuclear extract and 50 nM Gal4-VP16. Templates were incubated for 10 min at room temperature to allow preinitiation complexes to form, after which templates were transcribed for 30 min at 30°C upon the addition of ribonucleotides (1 mM) in a thermoshaker. The amount of transcription was determined by primer (GCGGCAGCCTAACAGTCAGCCTTACCAGTA) extension analysis.

In vitro chromatin immunoprecipitations. After the Sin3/HDAC and N-CoR/SMRT complexes were recruited as described above, immobilized templates were washed (200 mM KCl, 0.25% Triton X-100) and subsequently cross-linked for 15 min at room temperature in buffer F containing 0.1% NP-40 and 1% (vol/vol) of formaldehyde. Templates were washed with buffer F to remove the formaldehyde and subsequently incubated for 3 h at 37°C with a cocktail of restriction enzymes (BanI, DraI, HaeII, and PvuII) in 50 µl buffer F. The digest was diluted with 450 µl chromatin immunoprecipitation (ChIP) dilution buffer (0.1% sodium dodecyl sulfate [SDS], 1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.0, 167 mM NaCl, and complete protease inhibitors) and precleared for 1 h with 10 µl protein A beads (Amersham) at 4°C in a rotation wheel. A precleared sample was saved as input (50 µl), and 400 µl was subjected to immunoprecipitation overnight using an HDAC2 (Santa Cruz) or HDAC3 (Upstate) antibody. Protein A beads (10 µl) were then added to the immunoprecipitates, and samples were incubated for one more hour, after which beads were washed as follows: two times with 400 µl 150 mM NaCl, 10 mM Tris-HCl, pH 8.0, 0.1% SDS, 0.1% deoxycholate, 1% Triton X-100, 1 mM EDTA, pH 8.0, and 0.5 mM EGTA, pH 8.0; one time with 400 µl of the same buffer but also containing 500 mM NaCl; one time with 400 µl 0.25 M LiCl, 10 mM Tris-HCl, pH 8.0, 0.5% deoxycholate, 0.5% NP-40, 1 mM EDTA, and 1 mM EGTA; and two times with 400 µl 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 0.5 mM EGTA. The immunoprecipitates were eluted from the beads by the addition of 400 µl of elution buffer (1% SDS, 0.1 M NaHCO3) and incubation for 20 min at room temperature in a rotation wheel. Elution buffer (350 µl) was also added to the input samples. NaCl was then added to a final concentration of 200 mM, after which samples were de-cross-linked for 4 h at 65°C in a thermoshaker. DNA was extracted using phenol-chloroform (50/50) and then chloroform and precipitated overnight with ethanol. The precipitated DNA was redissolved in 200 µl H2O, and real-time PCR analysis was performed to quantify the amount of input and immunoprecipitated DNA. The primer sets that were used are as follows: promoter primer forward, AACGGCGTTACCAGAAACTCA; promoter primer reverse, GTCAGAGTCGGTTTGGTTGGA; upstream region primer forward, GGGTCTGACGCTCAGTGGAA; and upstream region primer reverse, ACCAAAATCCCTTAACGTGAGTTT.

Mass spectrometry. Acetylated immobilized nucleosomal templates were washed extensively (300 mM KCl, 0.5% Triton X-100), after which histones were eluted from the beads by adding 8 M urea. Proteins were subsequently reduced, alkylated, and then digested with LysC and trypsin. Peptide identification experiments were performed using a nano high-pressure liquid chromatography Agilent 1100 nanoflow system connected online to a 7-tesla linear quadrupole ion trap-Fourier transform (LTQ-FT) mass spectrometer (Thermo Electron, Bremen, Germany) essentially as described previously (16).

Histone peptide pulldowns. H3 and H4 tail peptides (ARTKQTARKSTGGKAPRKQLASKAAR-C and SGRGKGGKGLGKGGAKRHR-C, respectively) were coupled to SulfoLink resin (Pierce) at a concentration of 1 mg/ml according to the manufacturer's protocol. HeLa or H1299 nuclear extract was diluted to a final protein concentration of 4 mg/ml in IPH-150 buffer (50 mM Tris, pH 8, 150 mM NaCl, 0.5% Igepal CA-630 [vol/vol]) and precleared with an equal volume of cysteine-blocked SulfoLink resin. Binding was performed for 1.5 h on a rotator at 4°C, using 10 µg of peptide and 600 to 800 µg of nuclear extract. The resin was washed five times with 0.5 ml IPH-300 (50 mM Tris, pH 8, 300 mM NaCl, 0.5% Igepal CA-630 [vol/vol]) and two times with 0.5 ml IPH-150. The resin was boiled, and the bound proteins were resolved on an 8% Tris-glycine gel (Novex; Invitrogen) and visualized by silver staining. Proteins were detected by Western blot analysis, using antibodies against mSin3A (Santa Cruz), HDAC1 (Cell Signaling Technology), and HDAC2 (Zymed Laboratories, Inc.).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HAT-dependent in vitro transcriptions from nucleosomal templates. To assess whether a dynamic equilibrium between HAT and HDAC activities dictates the transcriptional competence of nucleosomal templates, we set up transcription reactions under conditions favoring either HAT or HDAC activity. Incubation of the nucleosomal templates with nuclear extract in the presence of the potent transcriptional activator Gal4-VP16 and sodium butyrate but in the absence of acetyl-CoA did not give rise to transcription (Fig. 1B, lane 1). This indicates that in the absence of any HAT or HDAC activity, the hypoacetylated nucleosomal templates are transcriptionally inert. Shifting the enzymatic balance towards acetylation by the addition of acetyl-CoA during the transcription reaction did not result in a potentiation of transcription (Fig. 1B, lane 2), indicating that HAT activity that is present in the nuclear extract does not stimulate transcription. Next, we preincubated the template with the SAGA complex and acetyl-CoA prior to the transcription reaction, which resulted in a potent stimulation of transcription (Fig. 1B, lane 3). The presence or absence of sodium butyrate had no effect on these transcription levels, indicating that HDAC activity present in the nuclear extract cannot repress transcription once the template is acetylated (Fig. 1B, compare lanes 3 and 4). Finally, transcription could not be observed if acetyl-CoA was omitted during the preincubation of the template with SAGA and instead was added during the transcription reaction (Fig. 1B, lanes 5 and 6).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. (A) Schematic representation of the transcription template used for all the experiments in this study. The primer pairs used for the in vitro ChIPs that were performed in this study are also indicated with arrows. (B) Gal4-VP16-dependent in vitro transcription reactions from nucleosomal templates under conditions favoring either HAT or HDAC activity as indicated. prom., promoter; NE, nuclear extract; rNTPs, ribonucleoside triphosphates; AcCoA, acetyl-CoA; but., butyrate; TXN, transcription.

 
Collectively, these data suggest that the acetylation status of the templates determines the transcriptional competence of the template and that shifting the equilibrium towards acetylation during the transcription reaction is insufficient to boost transcription.

In vitro repression of transcription by the Sin3/HDAC and N-CoR/SMRT complexes upon targeting to acetylated nucleosomal templates. To gain insight into the underlying mechanisms, we performed in vitro transcription reactions on immobilized nucleosomal templates (Fig. 1A). The use of immobilized templates with binding sites for chimeric repressors and activators allows us to study the interplay between purified HATs and HDACs prior to the transcription reaction. Immobilized templates were acetylated by preincubation with purified SAGA or NuA4 complex. The nucleosomal acetylation specificities of the purified SAGA and NuA4 HAT complexes were monitored throughout this study by Western blotting as well as by liquid chromatography-tandem mass spectrometry analyses. These experiments revealed that the purified native SAGA acetylated lysine residues only in the histone H3 tail, whereas the NuA4 complex acetylated lysines exclusively in the N terminus of histone H4 (data not shown). Following extensive washing to remove the HATs from the templates, the H3- or H4-acetylated templates were incubated with a recombinant chimeric repressor molecule containing the LexA DNA binding domain fused either to the N terminus of the Mad repressor to recruit Sin3a or to a mutant LexA-Mad molecule that is unable to recruit Sin3a (26). Templates were then washed and subsequently incubated with or without the purified Sin3/HDAC complex in the presence or absence of TSA. In all reactions, an excess of nonimmobilized competitor oligonucleosomes was added to prevent nontargeted association of repressor complexes with the immobilized nucleosomal templates. Finally, beads were washed to remove competitor nucleosomes and free Sin3/HDAC complex, and transcription reactions were performed in the absence of acetyl-CoA and in the presence of sodium butyrate.

In the presence of an excess of competitor nucleosomes, templates loaded with wild-type LexA-Mad and incubated with the Sin3/HDAC complex displayed strongly reduced transcription (Fig. 2B, compare lanes 2 and 3). In the presence of the mutant LexA-Mad molecule, however, transcription from the histone H3-preacetylated templates was only marginally inhibited (Fig. 2B, compare lanes 1 and 2). Under these conditions, the Sin3/HDAC complex is diverted away from the immobilized templates by the excess of nonimmobilized oligonucleosomes and targeted deacetylation of the immobilized transcription templates does not occur (see Fig. 4). The addition of TSA during the Sin3/HDAC recruitment step completely abolished repression, indicating that the enzymatic activity of the Sin3/HDAC complex is necessary to repress transcription from the H3-acetylated template in vitro (Fig. 2B, compare lanes 3 and 4). Thus, the Sin3/HDAC complex, when specifically recruited to the template, efficiently represses transcriptional activation from histone H3-acetylated templates.


Figure 2
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. In vitro transcriptional repression by the Sin3/HDAC complex. (A) Timeline describing the order of events of the experiment. (C) Following recruitment of the Sin3/HDAC complex to histone H3- or H4-acetylated templates in the presence of TSA, templates were washed and subsequently incubated with Gal4-VP16. Templates were washed again, and the amount of Gal4-VP16 retained on the templates was determined by Western blotting using a Gal4 antibody. As a loading control, the blot was probed with an antibody against the globular part of histone H3. (B) Nucleosomal templates reconstituted with recombinant Xenopus octamers were acetylated (Ac) on histone H3 (lanes 1 to 4), histone H4 (lanes 5 to 8), or histones H3 and H4 (lanes 9 to 12), incubated with LexA-Mad or a LexA-Mad mutant, and subsequently incubated in a large excess of competitor oligonucleosomes in the presence or absence of Sin3/HDAC complex and TSA. Templates were then washed and incubated with Gal4-VP16 and HeLa nuclear extract (NE) for 20 min to allow the formation of preinitiation complexes. Ribonucleotides were then added, and templates were transcribed for 20 min. The amount of transcription was visualized by primer extension analysis.

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Results of in vitro ChIP to assess nucleosomal histone H3 deacetylation by the Sin3/HDAC (A) and N-CoR/SMRT (B) complexes. Corepressor recruitment reactions were performed as described for Fig. 2 and 3, but instead of proceeding with the transcription reactions, templates were cross-linked, digested with a cocktail of restriction enzymes, and subjected to immunoprecipitation using an antibody that recognizes diacetyl histone H3. Real-time PCR analyses were performed using promoter (Prom) and upstream region (Up) primer sets. Error bars represent standard deviations between at least three independent experiments. Ac, acetylated.

 
On templates that had been acetylated on histone H4 with the yeast NuA4 complex, recruitment of the Sin3/HDAC complex by LexA-Mad also resulted in transcriptional repression (Fig. 2B, compare lanes 6 and 7). Binding of Gal4-VP16 under these conditions was similar to that obtained with templates acetylated on histone H3 (Fig. 2C). Strikingly, the addition of TSA during the Sin3/HDAC recruitment step did not relieve transcriptional repression (Fig. 2B, compare lanes 7 and 8). The enzymatic activity of the Sin3/HDAC complex is therefore not essential for repression of transcription from the H4-acetylated templates. Given the fact that in vivo active promoters are rarely, if at all, acetylated exclusively on histone H3 or H4, transcription reactions were also performed on templates containing acetylated histones H3 and H4. As with templates acetylated on histone H3 only, repression of transcription upon recruitment of the Sin3/HDAC complex could be observed and this was dependent on its histone deacetylase activity (Fig. 2B, lanes 9 to 12).

Next, we addressed to what extent the histone deacetylase activity of the N-CoR/SMRT complex is essential for its repressive effect on transcription (Fig. 3A). A chimeric repressor molecule containing the LexA DNA binding domain fused to the ligand binding domain of the thyroid hormone receptor (TR) was used to recruit the N-CoR/SMRT complex to the nucleosomal templates. In the absence of hormone, the TR ligand binding domain can recruit the N-CoR/SMRT complex (4, 17). Recruitment of the N-CoR/SMRT complex to templates acetylated on histone H3 resulted in a strong repression of transcription (Fig. 3B, compare lanes 2 and 3). As was observed for the Sin3/HDAC complex, this repression was abolished when TSA was added during the recruitment step (Fig. 3B, compare lanes 3 and 4). Upon the addition of T3 ligand, the N-CoR/SMRT complex cannot be recruited to the immobilized templates, and in agreement with this, inhibition of transcription could not be achieved (Fig. 3B, lane 5). Thus, the N-CoR/SMRT complex is able to repress activation of transcription mediated by histone H3 acetylation and this repression requires deacetylase activity.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. In vitro transcriptional repression by the N-CoR/SMRT complex. (A) Timeline describing the order of events of the experiment. (B) Nucleosomal templates were acetylated (Ac) and washed as described for Fig. 2 and subsequently incubated with or without LexA-TR(DE) in the presence or absence of 5 µM T3. Templates were then washed and incubated in a large excess of competitor oligonucleosomes in the presence or absence of the N-CoR/SMRT complex, TSA, and T3. After another washing step, transcription reactions were performed as described for Fig. 2. rNTPs, ribonucleoside triphosphates.

 
We also recruited the N-CoR/SMRT complex to histone H4-acetylated templates, which resulted in repression of transcription (Fig. 3B, compare lane 7 and 8). This was rather unexpected since we have previously shown that the N-CoR/SMRT complex displays no detectable deacetylation activity towards histone H4 (26). In line with this and as observed for the Sin3/HDAC complex, transcriptional repression could not be abolished by TSA (Fig. 3B, lane 9), arguing that repression of transcription by the N-CoR/SMRT complex by H4 acetylation does not require deacetylase activity. Thyroid hormone addition, however, did relieve transcriptional repression, indicating that the physical recruitment of the N-CoR/SMRT complex to the promoter is necessary to repress transcriptional activation. Finally, as for the Sin3/HDAC complex (Fig. 2), repression of transcription mediated by N-CoR/SMRT on nucleosomal templates acetylated on histones H3 and H4 was completely dependent on histone deacetylase activity (Fig. 3B, compare lanes 13 and 14).

Targeted promoter-proximal histone H3 deacetylation by the Sin3/HDAC and N-CoR/SMRT complexes. Given the fact that the Sin3/HDAC and N-CoR/SMRT complexes are able to repress transcriptional activation from histone H3-acetylated templates in a TSA-sensitive manner, we assessed their abilities to deacetylate histone H3 at the promoter by using in vitro chromatin immunoprecipitation experiments. Recruitment experiments were performed as described in the legends to Fig. 2 and 3, but instead of proceeding with the transcription reactions, templates were subjected to ChIP using an antibody that recognizes acetylated histone H3. As shown in Fig. 4A and B, both the Sin3/HDAC and the N-CoR/SMRT complexes were able to deacetylate promoter-proximal histone H3 molecules in a TSA-sensitive manner (Fig. 4A and B, lanes 4 to 6). In contrast, deacetylation of histone H3 in the upstream region could not be observed (Fig. 4A and B, lanes 1 to 3). These results indicate that the Sin3/HDAC and N-CoR/SMRT complexes deacetylate histone H3 locally in the region of their recruitment. Thus, deacetylation of promoter-proximal histone H3 molecules by the Sin3/HDAC and N-CoR/SMRT complexes correlates with their ability to repress transcription from histone H3-acetylated templates.

Promoter occupancy by the Sin3/HDAC and N-CoR/SMRT complexes following recruitment. Our surprising observation that both the Sin3/HDAC and N-CoR/SMRT complexes repress transcription from a histone H4-acetylated template in the presence of TSA, i.e., independent of their histone deacetylase activity, implies that mere physical association with the promoter may suffice to repress transcription. To directly determine the association of Sin3/HDAC and N-CoR/SMRT, we performed in vitro ChIPs using antibodies against HDAC2 to probe for the Sin3/HDAC complex or against HDAC3 for the N-CoR/SMRT complex. In the presence of competitor oligonucleosomes, HDAC2 binding could not be observed either at the promoter or at the upstream region in the absence of recruitment by LexA-Mad, which is in agreement with the results obtained for the transcription assays (Fig. 5A, lanes 1 and 4). However, HDAC2 was retained on the promoter when recruited by LexA-Mad, whereas binding to the upstream region could not be observed (Fig. 5A, lanes 2 and 5 [both panels]). Recruitment of Sin3/HDAC by LexA-Mad was not dependent on the acetylation state of the template, since the addition of TSA during the recruitment step had little effect on the extent of complex recruitment to the promoter (Fig. 5A). Similarly, the N-CoR/SMRT complex could be specifically recruited to and remained associated with the promoter by LexA-TR(DE) on templates acetylated on histone H3 or histone H4 (Fig. 5B). These results show that the Sin3/HDAC and N-CoR/SMRT complexes remain physically associated with the promoter following recruitment and stringent washing.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5. Results of in vitro ChIP to assess promoter occupancy by the Sin3/HDAC and N-CoR/SMRT complexes after recruitment by LexA-Mad and LexA-TR(DE), respectively. Following recruitment reactions, templates were subjected to immunoprecipatation using antibodies specific for the Sin3/HDAC complex (HDAC2) (A) or for the N-CoR/SMRT complex (HDAC3) (B). Error bars represent standard deviations between at least three independent experiments. Up, upstream region. Prom, promoter.

 
Anchoring of the Sin3/HDAC and N-CoR/SMRT complexes to nucleosomal templates containing hypoacetylated histone H3. The in vitro ChIP experiments described above indicate that the Sin3/HDAC and N-CoR/SMRT complexes bind to and remain associated with the promoter following recruitment and subsequent stringent washes. Furthermore, as shown in Fig. 2 and 3, the corepressors are able to repress transcription from templates acetylated on histone H4 independently of their enzymatic activity but due strictly to their physical presence on the promoter, resulting in dominance of repression over activation. Collectively, these observations suggest that the corepressors are differentially bound to the nucleosomal templates depending on their acetylation state.

To assess this assumption, we first compared the amount of HDAC1 that remained on histone H3- or histone H4-acetylated templates following Sin3/HDAC recruitment in the presence of TSA by LexA-Mad and after the addition of nuclear extract and Gal4-VP16. We observed that significantly more HDAC1 was stably retained on histone H4- than on histone H3-acetylated templates (data not shown). This observation suggests that the acetylation state of the nucleosomes does indeed impinge on corepressor binding. To gain insight into the molecular determinants of corepressor retention, we performed LexA binding site competition experiments (Fig. 6A). We first assessed the retention of the LexA fusion protein itself to the nucleosomal templates following competition with control DNA or LexA operators. Western blot analysis showed that the LexA fusion protein could be readily dissociated from the nucleosomal template under these conditions. The efficiency of dissociation was independent of whether the templates were acetylated on histone H3 or H4 (data not shown).


Figure 6
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 6. Results of LexA binding site competition experiments to study promoter anchoring of the Sin3/HDAC and N-CoR/SMRT complexes. (A) Timeline describing the order of events of the experiment. After recruitment of the Sin3/HDAC complex (B) or the N-CoR/SMRT complex (C) to the E4 promoter, templates were washed (200 mM KCl, 0.25% Triton X-100) and then incubated with control DNA (gray bars) or DNA containing LexA binding sites (black bars). Templates were then cross-linked, digested with restriction enzymes, and subsequently subjected to ChIP using an antibody against HDAC2 (B) or HDAC3 (C). Real-time PCR analyses were then performed to assess promoter occupancy of the Sin3/HDAC and N-CoR/SMRT complexes following LexA binding site competition. Error bars represent standard deviations between at least three independent experiments. (D) Schematic representation of the results obtained in the LexA binding site competition experiments. Ac, acetylated.

 
We next assessed the association of the corepressor complexes in the presence of TSA to prevent deacetylation. The corepressor complexes recruited to templates harboring acetylated histone H3 or acetylated H3 and H4 were efficiently displaced by competition with LexA operators but not by control DNA (Fig. 6B and C, lanes 5 to 8). In contrast, the Sin3/HDAC and N-CoR/SMRT complexes could not be competed off templates containing unacetylated histones (Fig. 6B and C, lanes 1 to 2) or templates that had been acetylated on histone H4 only (Fig. 6B and C, lanes 3 to 4). These results suggest a mechanistic model whereby the hypoacetylated histone H3 tail provides an anchor for targeting factor-independent retention of corepressor complexes on nucleosomal templates (Fig. 6D). The data further imply that acetylation of histone H4 does not prevent this anchoring.

To investigate the importance of the hypoacetylated histone H3 tail for repressor-independent anchoring of corepressors, binding site competition experiments were performed with nucleosomal templates lacking the histone H3 or H4 N-terminal tail. In line with our hypothesis, the histone H4 tail was dispensable for stable anchoring of the Sin3/HDAC and N-CoR/SMRT complexes to templates containing hypoacetylated histone H3 (Fig. 7A, lanes 1, 2, 5, and 6). In contrast, the corepressor complexes were efficiently displaced by LexA operators from nucleosomes lacking the histone H4 tail when histone H3 had been preacetylated by the SAGA complex (Fig. 7A, lanes 3, 4, 7, and 8). Finally, the complexes were equally displaced from nucleosomes lacking the histone H3 tail irrespective of whether the templates were preacetylated with SAGA or NuA4 (Fig. 7B). Taken together, these data strongly suggest that hypoacetylation of the N-terminal tail of histone H3 is necessary to anchor the Sin3/HDAC and N-CoR/SMRT complexes to nucleosomal templates following their initial recruitment to chromatin by the repressor. These experiments thus provide a likely explanation for the results depicted in Fig. 2 and 3 in which templates containing hypoacetylated histone H3 were repressed irrespective of whether histone H4 tails were hyperacetylated. Repressor-independent anchoring of corepressors also provides an explanation for the result in Fig. 1 showing that hypoacetylated templates are inert to transcriptional activation by HATs present in crude nuclear extracts: corepressor complexes present in the crude nuclear extract bind to the hypoacetylated nucleosomes with a high affinity and "shield" them from acetylation and hence prevent transcription.


Figure 7
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. Results of LexA binding site competition experiments with octamers lacking the H3 or H4 N terminus and histone peptide pulldowns in nuclear extracts. After recruitment of the Sin3/HDAC (HDAC2 ChIPs) and N-CoR (HDAC3 ChIPs) complexes to templates lacking the H4 (A) or H3 (B) N terminus, binding site competition experiments and ChIP analyses were performed as described for Fig. 6. Error bars represent standard deviations between at least three independent experiments. (C) H3 and H4 histone peptide tail pulldowns in HeLa nuclear extract were performed, and silver staining (left) as well as Western blotting (right) against Sin3a, HDAC1, and HDAC2 was performed to determine binding of these corepressors to the unmodified histone H3 and histone H4 N termini.

 
Corepressors preferentially bind to hypoacetylated histone H3 compared to hypoacetylated histone H4. The data presented thus far strongly suggest that corepressor complexes have a higher affinity for the hypoacetylated histone H3 tail than for the hypoacetylated histone H4 tail of nucleosomes. It has previously been reported, however, that corepressors specifically bind to the hypoacetylated histone H4 tail (6). To compare the binding affinities of corepressors to the hypoacetylated histone H3 and H4 tails directly, we performed histone peptide pulldowns in HeLa nuclear extracts. As shown in Fig. 7C, a peptide column of hypoacetylated histone H3 tails efficiently retained Sin3a and other components of the complex while they were much less or not efficiently retained by a hypoacetylated H4 tail column.

Collectively, the data presented in this study demonstrate that following recruitment, histone H3 deacetylation by the Sin3/HDAC and N-CoR/SMRT complexes can result in repressor-independent nucleosomal anchoring of corepressors and, consequently, maintenance of transcriptional repression.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A feed-forward mechanism of repression. In this study, we have shown that both the Sin3/HDAC and N-CoR/SMRT complexes are able to specifically repress transcription from histone H3- and H4-acetylated nucleosomal templates following recruitment by using chimeric repressor molecules. Repression of transcription from histone H3-acetylated templates required histone deacetylase activity. In contrast, repression of transcription from histone H4-acetylated templates did not require histone deacetylase activity, indicating that in this case, the presence of the corepressor complexes on the promoter sufficed to repress transcription. This conclusion was corroborated and extended by binding site competition experiments revealing that recruitment of the Sin3/HDAC and N-CoR/SMRT complexes to templates harboring hypoacetylated histone H3 results in a stable anchoring of the corepressor complexes. Recruitment of the Sin3/HDAC or N-CoR/SMRT complex to nucleosomal templates containing hyperacetylated histone H3 or H3/H4 prevented this repressor-independent anchoring. Furthermore, binding site competition experiments using nucleosomal templates reconstituted with H3 and/or H4 tailless histones revealed that anchoring was dependent on the histone H3 but not the histone H4 tail. Although anchoring of corepressors on the hypoacetylated histone H3 tail is dominant over the effect of histone H4 deacetylation in our assays, it should be noted that deacetylation of histone H4 in the absence of anchoring on the hypoacetylated histone H3 tail should also result in repression or transcription.

Our results strongly suggest a three-step feed-forward mechanism leading to transcriptional repression (Fig. 6D). First, DNA sequence-specific repressor molecules bind at or near hyperacetylated, transcriptionally active promoters and recruit corepressor complexes. Subsequently, deacetylation of nucleosomes surrounding the targeting site creates a localized hypoacetylated pocket which provides a binding anchor for the corepressor complexes. The corepressor complexes remain stably associated with the promoter, resulting in maintenance of repression even in the absence of the initial tethering repressor. This feed-forward repression mechanism is reminiscent of the epigenetic and stable repression of homeotic genes by Polycomb group complexes (19). Both the Sin3/HDAC and N-CoR/SMRT complexes have been reported to interact with proteins involved in long-term epigenetic silencing, such as KAP-1, REST, and the H3K9 methyltransferase ESET (11, 23, 27). Thus, in addition to "short-term" repression via transient recruitment by transcription factors, the Sin3/HDAC and N-CoR/SMRT complexes may in addition play a role in long-term repression pathways and cellular memory.

Dominance of repression. Our observations provide a possible explanation for the lack of transcription observed in in vitro transcription experiments performed by us (Fig. 1) and others (12, 21), using crude nuclear extracts and reconstituted, hypoacetylated nucleosomal templates. Upon the addition of nuclear extract, corepressor complexes, which have a high affinity for the hypoacetylated templates, anchor on the hypoacetylated template and shield the H3 tails from acetylation mediated by HAT complexes present in the extract. Repression appears to be dominant over activation, as a surplus of HAT activity added during the transcription reaction cannot alleviate the repressive effect of corepressor complexes and, consequently, the template remains transcriptionally inert. In addition to feed-forward interactions between corepressors and hypoacetylated histones, several transcriptional activators have an opposite binding affinity for acetylated versus nonacetylated nucleosomal substrates by virtue of their acetyl-lysine binding bromodomains (8). Thus, while hypoacetylation increases the retention of corepressors on the template, this in addition decreases the recruitment of activators and coactivators to the same template. These two effects therefore can be additive and result in an "all-or-nothing" situation when it comes to transcription rates from nucleosomal templates.

One interesting question raised by our study is which Sin3/HDAC and N-CoR/SMRT subunits anchor the complex on hypoacetylated promoters. The Sin3/HDAC complex as well as the N-CoR/SMRT complex has been reported to interact with hypoacetylated histones H3 and H4 through RbAp48/46 and TBL1/TBLR1, respectively (6, 28). Hartman and coworkers have also reported a preferential association between the N-CoR and SMRT proteins with hypo- versus hyperacetylated histone H4 (6). A caveat of that study is that the binding experiments were performed on free histones rather than nucleosomes. Our data do not exclude preferential binding of corepressor complexes to hypoacetylated histone H4 compared to hyperacetylated histone H4. However, our experiments show that the presence of a hypoacetylated histone H4 tail alone retained corepressor complexes much less efficiently than hypoacetylated histone H3 tails. Furthermore, the histone H4 tail was dispensable for the anchoring of corepressors to nucleosomes containing hypoacetylated histone H3. Finally, pulldowns in HeLa nuclear extracts, using hypoacetylated histone H3 and H4 peptides, revealed a clear preference of corepressors for the hypoacetylated histone H3 peptide. Our experiments therefore clearly point to the acetylation state of the N terminus of histone H3 as a critical determinant for repressor-independent anchoring, presumably through RbAp48/46 and TBL1/TBLR1, of corepressor complexes to promoters and thus for the establishment and maintenance of transcriptional repression. These observations present a paradox: given the overall deacetylated state of histone tails in the nucleus and given that corepressors have a high affinity for hypoacetylated nucleosomes as shown here, how are the corepressor complexes made available for specific recruitment by, e.g., nuclear hormone receptors? One explanation could be that following the instigation of repression by specific recruitment of corepressor complexes such as Sin3/HDAC and N-CoR/SMRT to a locus, other complexes such as Polycomb group proteins may take over long-term repression. Exchange of repressive complexes may take place during replication and might occur simultaneously with a replacement of histone variants.

Another interesting question that emerges from our experiments is how hypoacetylated promoters occupied with corepressor complexes can be reactivated since the anchored corepressor complexes are highly stable (resistant to washes with up to 600 mM KCl) (data not shown). There is some evidence in recent literature that sheds light on this question. Hoberg and coworkers showed that I{kappa}B kinase {alpha}-mediated phosphorylation of SMRT is required for NF-{kappa}B-dependent transactivation (9). SMRT phosphorylation occurs on chromatin and results in the release of SMRT and HDAC3 from chromatin and nuclear export of SMRT. Failure of I{kappa}B kinase {alpha} to phosphorylate SMRT resulted in constitutive association of SMRT to target promoters, inhibited the recruitment of NF-{kappa}B, blocked transcription, and sensitized cells to apoptosis. Our study strongly suggests a general need for "activating" signals that facilitate the release of corepressors from hypoacetylated promoters and imply signaling pathways that result in the phosphorylation of corepressors triggering their release. Another way to abrogate stable repression by corepressors could be the replacement of histone H3 with histone H3.3. Recent studies have revealed that histone H3.3 is highly enriched at chromosomal sites that are being actively transcribed (1). Histone exchange of H3 for H3.3 may therefore also serve to remove corepressors bound to hypoacetylated nucleosomes upon activation of a gene. ChIP-on-ChIP approaches can be applied to obtain a genomewide picture of corepressor target sites, and such studies may help to further decipher the mechanisms underlying their central role in the functioning of the eukaryotic genome.


    ACKNOWLEDGMENTS
 
We thank Lee Kraus and Gert-Jan Veenstra for advice on in vitro transcriptions and members of the Stunnenberg lab for discussions. We acknowledge Coen Campsteijn for purifying recombinant Xenopus octamers. Furthermore, we thank Mike Carrozza and Jerry Workman for reagents.

The research of M. Vermeulen is supported by The Netherlands Organization for Scientific Research (NWO) and by The Netherlands Proteomics Centre (NPC). Work in the lab of K.L. was supported by NIH grant NIGMS R01GM061909. Work in the lab of R.G.R. was supported by NIH grant DK071900.


    FOOTNOTES
 
* Corresponding author. Mailing address: NCMLS, Radboud University Nijmegen, Department of Molecular Biology, Geert Grooteplein Zuid 30, Nijmegen, The Netherlands. Phone: 31-3610524. Fax: 31-3610520. E-mail: h.stunnenberg{at}ncmls.ru.nl. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Ahmad, K., and S. Henikoff. 2002. The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Mol. Cell 9:1191-1200.[CrossRef][Medline]

2. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.[Abstract/Free Full Text]

3. Eberharter, A., S. John, P. A. Grant, R. T. Utley, and J. L. Workman. 1998. Identification and analysis of yeast nucleosomal histone acetyltransferase complexes. Methods 15:315-321.[CrossRef][Medline]

4. Glass, C. K., and M. G. Rosenfeld. 2000. The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev. 14:121-141.[Free Full Text]

5. Hansen, J. C., J. Ausio, V. H. Stanik, and K. E. van Holde. 1989. Homogeneous reconstituted oligonucleosomes, evidence for salt-dependent folding in the absence of histone H1. Biochemistry 28:9129-9136.[CrossRef][Medline]

6. Hartman, H. B., J. Yu, T. Alenghat, T. Ishizuka, and M. A. Lazar. 2005. The histone-binding code of nuclear receptor co-repressors matches the substrate specificity of histone deacetylase 3. EMBO Rep. 6:445-451.[CrossRef][Medline]

7. Hassan, A. H., K. E. Neely, and J. L. Workman. 2001. Histone acetyltransferase complexes stabilize SWI/SNF binding to promoter nucleosomes. Cell 104:817-827.[CrossRef][Medline]

8. Hassan, A. H., P. Prochasson, K. E. Neely, S. C. Galasinski, M. Chandy, M. J. Carrozza, and J. L. Workman. 2002. Function and selectivity of bromodomains in anchoring chromatin-modifying complexes to promoter nucleosomes. Cell 111:369-379.[CrossRef][Medline]

9. Hoberg, J. E., F. Yeung, and M. W. Mayo. 2004. SMRT derepression by the IkappaB kinase alpha: a prerequisite to NF-kappaB transcription and survival. Mol. Cell 16:245-255.[CrossRef][Medline]

10. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293:1074-1080.[Abstract/Free Full Text]

11. Jepsen, K., O. Hermanson, T. M. Onami, A. S. Gleiberman, V. Lunyak, R. J. McEvilly, R. Kurokawa, V. Kumar, F. Liu, E. Seto, S. M. Hedrick, G. Mandel, C. K. Glass, D. W. Rose, and M. G. Rosenfeld. 2000. Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753-763.[CrossRef][Medline]

12. Kundu, T. K., V. B. Palhan, Z. Wang, W. An, P. A. Cole, and R. G. Roeder. 2000. Activator-dependent transcription from chromatin in vitro involving targeted histone acetylation by p300. Mol. Cell 6:551-561.[CrossRef][Medline]

13. Li, J., Q. Lin, W. Wang, P. Wade, and J. Wong. 2002. Specific targeting and constitutive association of histone deacetylase complexes during transcriptional repression. Genes Dev. 16:687-692.[Abstract/Free Full Text]

14. Luger, K., A. W. Mader, R. K. Richmond, D. F. Sargent, and T. J. Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389:251-260.[CrossRef][Medline]

15. Moore, P. S., S. Barbi, M. Donadelli, C. Costanzo, C. Bassi, M. Palmieri, and A. Scarpa. 2004. Gene expression profiling after treatment with the histone deacetylase inhibitor trichostatin A reveals altered expression of both pro- and anti-apoptotic genes in pancreatic adenocarcinoma cells. Biochim. Biophys. Acta 1693:167-176.[Medline]

16. Olsen, J. V., S. E. Ong, and M. Mann. 2004. Trypsin cleaves exclusively C-terminal to arginine and lysine residues. Mol. Cell. Proteomics 3:608-614.[Abstract/Free Full Text]

17. Perissi, V., and M. G. Rosenfeld. 2005. Controlling nuclear receptors: the circular logic of cofactor cycles. Nat. Rev. Mol. Cell Biol. 6:542-554.[CrossRef][Medline]

18. Rayman, J. B., Y. Takahashi, V. B. Indjeian, J. H. Dannenberg, S. Catchpole, R. J. Watson, H. te Riele, and B. D. Dynlacht. 2002. E2F mediates cell cycle-dependent transcriptional repression in vivo by recruitment of an HDAC1/mSin3B corepressor complex. Genes Dev. 16:933-947.[Abstract/Free Full Text]

19. Ringrose, L., and R. Paro. 2004. Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu. Rev. Genet. 38:413-443.[CrossRef][Medline]

20. Rundlett, S. E., A. A. Carmen, N. Suka, B. M. Turner, and M. Grunstein. 1998. Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392:831-835.[CrossRef][Medline]

21. Steger, D. J., A. Eberharter, S. John, P. A. Grant, and J. L. Workman. 1998. Purified histone acetyltransferase complexes stimulate HIV-1 transcription from preassembled nucleosomal arrays. Proc. Natl. Acad. Sci. USA 95:12924-12929.[Abstract/Free Full Text]

22. Turner, B. M. 2002. Cellular memory and the histone code. Cell 111:285-291.[CrossRef][Medline]

23. Underhill, C., M. S. Qutob, S. P. Yee, and J. Torchia. 2000. A novel nuclear receptor corepressor complex, N-CoR, contains components of the mammalian SWI/SNF complex and the corepressor KAP-1. J. Biol. Chem. 275:40463-40470.[Abstract/Free Full Text]

24. Utley, R. T., K. Ikeda, P. A. Grant, J. Cote, D. J. Steger, A. Eberharter, S. John, and J. L. Workman. 1998. Transcriptional activators direct histone acetyltransferase complexes to nucleosomes. Nature 394:498-502.[CrossRef][Medline]

25. Van Lint, C., S. Emiliani, and E. Verdin. 1996. The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr. 5:245-253.[Medline]

26. Vermeulen, M., M. J. Carrozza, E. Lasonder, J. L. Workman, C. Logie, and H. G. Stunnenberg. 2004. In vitro targeting reveals intrinsic histone tail specificity of the Sin3/histone deacetylase and N-CoR/SMRT corepressor complexes. Mol. Cell. Biol. 24:2364-2372.[Abstract/Free Full Text]

27. Yang, L., Q. Mei, A. Zielinska-Kwiatkowska, Y. Matsui, M. L. Blackburn, D. Benedetti, A. A. Krumm, G. J. Taborsky, Jr., and H. A. Chansky. 2003. An ERG (ets-related gene)-associated histone methyltransferase interacts with histone deacetylases 1/2 and transcription co-repressors mSin3A/B. Biochem. J. 369:651-657.[CrossRef][Medline]

28. Yoon, H. G., Y. Choi, P. A. Cole, and J. Wong. 2005. Reading and function of a histone code involved in targeting corepressor complexes for repression. Mol. Cell. Biol. 25:324-335.[Abstract/Free Full Text]


Molecular and Cellular Biology, July 2006, p. 5226-5236, Vol. 26, No. 14
0270-7306/06/$08.00+0     doi:10.1128/MCB.00440-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vermeulen, M.
Right arrow Articles by Stunnenberg, H. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vermeulen, M.
Right arrow Articles by Stunnenberg, H. G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals