MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nitta, R. T.
Right arrow Articles by Kennedy, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nitta, R. T.
Right arrow Articles by Kennedy, B. K.
Molecular and Cellular Biology, July 2006, p. 5360-5372, Vol. 26, No. 14
0270-7306/06/$08.00+0     doi:10.1128/MCB.02464-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Stabilization of the Retinoblastoma Protein by A-Type Nuclear Lamins Is Required for INK4A-Mediated Cell Cycle Arrest{dagger}

Ryan T. Nitta,1 Samantha A. Jameson,1 Brian A. Kudlow,1,2 Lindus A. Conlan,1 and Brian K. Kennedy1*

Department of Biochemistry,1 Molecular and Cellular Biology Program, University of Washington, Seattle, Washington 981952

Received 23 December 2005/ Returned for modification 24 January 2006/ Accepted 14 April 2006


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutations in the LMNA gene, which encodes all A-type lamins, including lamin A and lamin C, cause a variety of tissue-specific degenerative diseases termed laminopathies. Little is known about the pathogenesis of these disorders. Previous studies have indicated that A-type lamins interact with the retinoblastoma protein (pRB). Here we probe the functional consequences of this association and further examine links between nuclear structure and cell cycle control. Since pRB is required for cell cycle arrest by p16ink4a, we tested the responsiveness of multiple lamin A/C-depleted cell lines to overexpression of this CDK inhibitor and tumor suppressor. We find that the loss of A-type lamin expression results in marked destabilization of pRB. This reduction in pRB renders cells resistant to p16ink4a-mediated G1 arrest. Reintroduction of lamin A, lamin C, or pRB restores p16ink4a-responsiveness to Lmna–/– cells. An array of lamin A mutants, representing a variety of pathologies as well as lamin A processing mutants, was introduced into Lmna–/– cells. Of these, a mutant associated with mandibuloacral dysplasia (MAD R527H), as well as two lamin A processing mutants, but not other disease-associated mutants, failed to restore p16ink4a responsiveness. Although our findings do not rule out links between altered pRB function and laminopathies, they fail to support such an assertion. These findings do link lamin A/C to the functional activation of a critical tumor suppressor pathway and further the possibility that somatic mutations in LMNA contribute to tumor progression.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A-type lamins are intermediate filament proteins that have been linked to the organization and maintenance of nuclear structure. In most differentiated tissues, A-type lamins (predominantly lamins A and C), along with lamin B, comprise the meshwork underlying the inner nuclear membrane known as the nuclear lamina (63). Unlike lamin C, lamin A contains a carboxy-terminal CaaX motif and must undergo a series of posttranslational modifications to form the mature lamin A (77). In particular, the cysteine of the CaaX motif in lamin A is isoprenylated, followed by cleavage of the aaX and carboxymethylation of the C-terminal cysteine (72). Lastly, a second cleavage event by Zmpste24 removes the last 15 amino acids to yield the mature lamin A (3, 13, 74).

Mutations within the LMNA gene cause a variety of human disorders collectively known as laminopathies. These include progeria syndromes and dystrophies associated with skeletal muscle and adipose tissue (5, 10, 15, 19, 45, 58). Mice lacking A-type lamins or deficient in processing lamin A develop skeletal and cardiac muscular dystrophies, thus confirming the importance of A-type lamins for muscle differentiation and/or maintenance (52, 65). The mechanism by which mutations in A-type lamins generate tissue-specific disorders is unknown. However, one model posits that lamin A/C regulates gene expression in differentiated tissue by coordinating the activity of key transcription factors.

A-type lamins localize to peripheral regions underlying the nuclear envelope and also concentrate at perinucleolar foci (7, 31). They are hypothesized to affect gene expression at both peripheral and perinucleolar sites due to interactions with transcription factors involved in differentiation, such as the retinoblastoma protein (pRB) (26, 41, 42, 44, 51, 59, 67). Previously, it has been shown that pRB is tethered to the nuclear substructure through the action of lamin A/C (66). Further, A-type lamins protect pRB, and the related protein p107, from proteasomal degradation (27). pRB regulates cell cycle progression by inhibiting the activity of the transcriptional activator E2F and through establishment of repressive chromatin structures at genes necessary for S-phase entry and progression (2, 4, 16, 22). Entry into and maintenance of cell cycle arrest is essential for cellular differentiation. In addition, pRB is important for muscle and fat cell differentiation (34), as well as cellular senescence (50), suggesting that deregulated pRB activity could play a role in the pathology associated with laminopathies (14, 36, 57, 61, 75, 78, 79).

Overexpression of p16ink4a inhibits cyclin D-dependent kinase activity leading to hypophosphorylated pRB, reduced E2F activity, and arrest in the G1 phase of the cell cycle (60). Cells lacking pRB are refractory to arrest by p16ink4a (8, 33, 38, 43). To determine whether lamin A/C is necessary for pRB-mediated cell cycle regulation, we examined cell cycle arrest in cells lacking lamin A/C. We found that cells lacking A-type lamin function do not arrest in the presence of p16ink4a. p16ink4a-mediated cell cycle arrest was restored by reintroduction of either lamin A or lamin C or increased expression of pRB. Lamin A mutants defective for processing could not restore p16ink4A-mediated arrest or stabilize pRB, suggesting that appropriate modification of lamin A is important for maintaining normal levels of pRB. A mandibuloacral dysplasia (MAD)-associated mutant LMNA allele (R527H) also failed to restore signaling through the p16ink4a/pRB pathway (49, 62). Surprisingly, however, other laminopathy alleles, including another MAD mutant, adequately restored p16ink4a-mediated cell cycle arrest.

Our findings serve as a model for the regulation of transcription factor activity by A-type nuclear lamins. Further, they indicate that A-type lamin-mediated stabilization of pRB is necessary for G1 cell cycle arrest in response to increased CDK inhibitor activity.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmid construction of laminopathy mutants. The cDNA encoding wild-type lamin A was cloned into BamHI/EcoRI restriction sites of pBlueScript II KS(+) (Stratagene). Point mutations were created by site-directed mutagenesis according to the QuikChange site-directed mutagenesis kit protocol (Stratagene). Oligonucleotide primer sequences are available upon request. The Hutchinson-Gilford Syndrome mutation G608G* was constructed by creating oligonucleotides flanking exon 11 deletion (GCGGCTCAGGAGCCCAGAGCCCCCAGAACTGCAGC and GCTGCAGTTCTGGGGGCTCTGGGCTCCTGAGCCGC). The deletion in exon 11 was created to mimic the aberrant splicing mutant which removes the 50 amino acids in the C terminus that includes the second processing cleavage site (35). The lamin inserts were then subcloned into BamHI/XhoI restriction sites of pcDNA3.1/Hygro+ (Invitrogen).

Cell culture and plasmid transfection. Immortalized knockout fibroblast cell lines, as well as litter-matched controls, have been described (12). All cell lines were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 10 U of penicillin/ml, and 10 µg of streptomycin/ml. Cells grown to 30% confluence were transfected using Lipofectamine Plus (Invitrogen). The following constructs were used: pcDNA3.1 green fluorescent protein (GFP), pcDNA3.1-GFP-p16ink4a, pcDNA3.1-GFP-p21cip1, pcDNA3.1-3xFlag, pcDNA3.1-3xFlag pRB, pcDNA3.1-3xFlag lamin B, pcDNA3.1-HA, and pcDNA3.1-HA-tagged-Ub. To determine the percentage of S-phase cells, cells were grown on coverslips for 36 h, pulsed with bromodeoxyuridine (BrdU) for 6 h, and then fixed with 4% paraformaldehyde and detected by immunofluorescence as previously described (8). The results were recorded from triplicate samples, and 150 cells were scored per sample. Each experiment was repeated three times, and the data presented are a representative sample.

Retroviral infections. The retroviruses pMXIH and pMXIH-lamin A were created as previously described (35). At 36 h after infection, infected cells were selected by culturing in selective media containing 500 µg of hygromycin B/ml for 2 days. The retroviruses pBabe and pBabe-p16ink4a (kindly provided by the Marie Classon Cancer Center, Massachusetts General Hospital) were infected into cells and selected in 6 µg of puromycin/ml for 2 days, while pLXSN and pLXSN-p16ink4a (kindly provided by Denise Galloway, Fred Hutchinson Cancer Research Center) were selected for 5 days using 1 mg of G418/ml. At 24 h before additional transfection, the selective media were removed from the infected cells, and supplemented Dulbecco modified Eagle medium (described above) was added. Infection of retroviral small inhibitory RNA (siRNA) constructs to mouse lamin A was previously described (35). Ecotropic retroviruses of pSuper.retro-Puro (Oligoengine) and pSuper.retro-Puro siLamin A plasmids was prepared as described above. At 24 h after NIH 3T3 cells were infected, cells were selected by using 5 µg of puromycin/ml for 3 days. These cells were used not for experiments more than six passages after selection.

Fluorescence-activated cell sorting (FACS) analysis. At 36 h after transfection, flow cytometry analysis was conducted on the transfected cells in the Rabinovitch Laboratory (Department Pathology, University of Washington). The cells were washed in a solution of 10 µg of DAPI (4',6'-diamidino-2-phenylindole)/ml and 0.1% Nonidet P-40 detergent in a Tris-buffered saline and then triturated with a 26-gauge needle and analyzed by using a Coulter ELITE cytometer (Coulter Corp., Miami, FL) with UV excitation and DAPI emission collected at >450 nm (55). DNA content and cell cycle were analyzed by using the software program WinCycle software (Phoenix Flow Systems, San Diego, CA) as previously described (54). At least 25,000 cells were counted per experiment. The data are presented as histograms in which the cell number is plotted against the DNA content. To determine GFP-positive cells, untransfected cells were used as a control. For each sample, 40,000 GFP-positive cells were collected and analyzed by using Western analysis.

Indirect immunofluorescence. Immunofluorescence was performed on formaldehyde fixed cells except for those stained for lamin A/C (SC-20681), which were methanol fixed as previously described (31). The following antibodies were used: mouse anti-pRB (Pharmingen, [catalog no.] G3-245), rabbit anti-pRB (Neomarkers, Ab-6), rabbit anti-lamin A/C (Santa Cruz, SC-20681), mouse anti-lamin A/C (Santa Cruz, SC-7292), rabbit anti-p16 (Chemicon, Ab3004), and mouse anti-BrdU (Becton Dickinson, 347580). Images were taken by using Zeiss Axiovert 200 (Obserkochen, Germany). Images that compared protein levels were collected using equal exposure times and processed similarly.

Protein analysis and immunoprecipitation. Protein extracts from total cells were harvested in radioimmunoprecipitation assay buffer (0.15 M NaCl, 0.05 mM Tris-HCl (pH 7.2), 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]). A total of 40 to 50 µg of total protein was separated by denaturing electrophoresis. The following antibodies were used for immunoblotting: mouse anti-pRB (Pharmingen, G3-245), rabbit anti-pRB Ser807/811 (Cell Signaling, 9308), mouse anti-actin (Chemicon MAB1501R), mouse anti-Flag (Sigma, F3165), mouse anti-HA (Convance, MMS-101R), rabbit anti-pan lamin A/C (Cell Signaling, 2032), mouse anti-lamin A/C (Santa Cruz, SC-7292), mouse anti-p21/Cip1/WAF1 (Upstate, 05-345), and rabbit anti-p16 (Chemicon, Ab3004). Immunoprecipitations for 3xFlag constructs were conducted in radioimmunoprecipitation assay buffer using 1 µg of mouse anti-Flag (Sigma, F3165) bound to protein G beads (Roche). Proteasomal studies were conducted by incubating the transfected cells in 25 µM MG132 (Sigma, C2211) and/or 50 µg of cycloheximide/ml (Sigma, R750107). The protein extracts were harvested and immunoblotted as described above. Protein levels were determined by counting pixels using NIH Image (National Institutes of Health).


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
pRB levels are reduced in mouse cells lacking lamin A/C. Previous studies have shown that lamin A/C and pRB interact in vitro, leading to speculation that the nuclear structural component regulates pRB activity (41, 42, 51). We have reported that immortalized mouse Lmna–/– fibroblasts have fivefold reduced pRB levels (27). To test the generality of this observation, we used siRNA methodology to reduce the expression of lamin A/C in NIH 3T3 cells (siLmna cells, see Materials and Methods). Western analysis indicated that siLmna cells exhibit threefold-reduced pRB levels compared to the siGFP controls, suggesting that lamin A/C is directly involved in regulating pRB levels (Fig. 1A). Further, by indirect immunofluorescence, the intensity of pRB nuclear foci in siLmna cells is also dramatically reduced (Fig. 1B). Consistently, it has recently been reported that pRB levels are reduced in myoblasts lacking lamin A/C and in mice lacking the lamin A processing enzyme, ZMPSTE24 (21, 70).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1. Enforced reduction of lamin A/C results in reduced pRB levels in NIH 3T3 fibroblasts. Retroviral infection of siRNAs targeted to Lmna lowered levels of lamin A/C in NIH 3T3 (siLmna) after 2 days of puromycin selection. siRNAs targeted to GFP were used as a control (siGFP). (A) Protein samples from immortalized Lmna–/– fibroblasts, littermate control cells (Lmna+/+), and siLmna and siGFP cells were separated by using SDS-8% PAGE and detected by immunoblotting with mouse anti-pRB and rabbit anti-lamin A/C. Actin levels were determined as a loading control. (B) siLmna cells and siGFP cells were fixed and subjected to immunofluorescence. Endogenous pRB (green) or lamin A/C (red) is depicted. Images comparing siGFP and siLmna cells were collected using equal exposure times and image processing.

 
We have demonstrated that pRB stability, but not proper subnuclear localization, could be restored to Lmna–/– fibroblasts by prolonged treatment with the proteasome inhibitor MG132 (27). Here, we extend these studies by testing the kinetics of pRB degradation in the absence of A-type lamins. 3xFlag-pRB was transfected into Lmna–/– and littermate Lmna+/+ control cells and 3xFlag-pRB levels were monitored at time points after addition of the translation inhibitor, cycloheximide (Fig. 2A). In the Lmna–/– cells 70% of the 3xFlag-pRB was degraded by 2 h, whereas only 10% was degraded in the Lmna+/+ fibroblasts after 6 h. Addition of MG132 blocked the degradation of pRB levels in the presence of cycloheximide, confirming that pRB degradation in the absence of A-type lamins is proteasome dependent (27).


Figure 2
View larger version (34K):
[in this window]
[in a new window]
  		FIG. 2. Lamin A/C protects pRB from ubiquitination and proteasomal degradation. (A) 3xFlag pRB and 3xFlag-GFP were cotransfected into Lmna–/– cells and treated with MG132 and/or 50 µg of cycloheximide (CHX)/ml for the specified times. Protein samples were separated by SDS-8% PAGE and detected by immunoblotting with mouse anti-Flag antibody. The percentage of 3xFlag-pRB (vertical axis) was determined by counting pixel levels using NIH Image and normalizing each time point to time zero hour. 3xFlag-GFP was used as a loading control and to monitor transfection efficiency. (B) 3xFlag-pRB and HA-ubiquitin (HA-Ub) were cotransfected in Lmna–/– and littermate control cells (Lmna+/+). At 36 h after transfection, the immunoprecipitates obtained with anti-Flag were separated by SDS-8% PAGE and detected by immunoblotting with mouse anti-HA or mouse anti-Flag. The arrow indicates the approximate size of 3xFlag pRB.

 
Since Lmna–/– fibroblasts have lower steady-state pRB levels, we speculated that the extent of pRB ubiquitination may be increased in these cells (27). Therefore, we cotransfected 3xFlag-pRB and HA-Ub into Lmna–/– fibroblasts and Lmna+/+ littermate control cells and performed coimmunoprecipitation experiments (Fig. 2B). When lysates from transfected cells were immunoprecipitated and probed with Flag antibodies to detect exogenous pRB levels, we consistently found that the levels of transfected pRB were reduced in Lmna–/– cells compared to Lmna+/+ cells. This finding suggests that levels of exogenous pRB expressed from a constitutive promoter are regulated in a manner similar to that for endogenous pRB. We detect increased HA-antibody reactive species in the cotransfected Lmna–/– cells, a finding consistent with our assertion that lamin A/C protects pRB from ubiquitin-mediated proteolysis. We speculate the presence of protein bands smaller than 3xFlag-pRB is due to partially degraded, ubiquitinated pRB fragments.

A recent report has suggested that pRB levels are not reduced in cells lacking lamin A/C and that pRB instead exhibits increased phosphorylation in serum-deprived, G1-arrested cells (69). We show in the present study that two cell lines with reduced A-type lamins (Lmna–/– fibroblasts and siLmna-treated NIH 3T3 cells) exhibit increased ubiquitination and degradation of pRB. Nevertheless, we examined the phosphorylation state of pRB in Lmna–/– fibroblasts and siLmna-treated NIH 3T3 cells arrested by serum deprivation. We conducted a time course in which Lmna–/– and siLmna cells were grown in 0.1% serum for 24 and 48 h. FACS analysis showed that Lmna–/– and siLmna require 48 h to become G1-phase arrested, whereas the control cells, Lmna+/+ and siGFP, are largely arrested at 24 h, indicating that cells with reduced lamin A/C have impaired cell cycle withdrawal kinetics (Fig. 3A). Lmna–/– myoblasts also exhibit delayed G1-phase cell cycle arrest when induced to differentiate (21). After serum deprivation for 48 h, we examined pRB phosphorylation using a pRB antibody that recognizes pRB phosphorylated at Ser807/Ser811. This same phospho-specific antibody was used in the study by Van Berlo et al. (69). Western analysis indicated that quiescent Lmna–/– and Lmna+/+ cells both possessed little to no Ser807/811 phosphorylated pRB (Fig. 3B). Similar findings were observed in serum-deprived siLmna-treated NIH 3T3 cells and in Lmna–/– and Lmna+/+ cells arrested by contact inhibition, indicating that G1 arrested cells lacking lamin A/C do not possess higher amounts of phosphorylated pRB (see Fig. S1 in the supplemental material). From our studies, we conclude that pRB is maintained in a highly stable state in the nucleus through the action of lamin A/C.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
  		FIG. 3. Reduced lamin A/C expression leads to delayed cell cycle withdrawal during serum deprivation. (A) Cells lacking lamin A/C (Lmna–/– and siLmna) and their control cells (Lmna+/+ and siGFP) were cultured in 0.1% serum for 24 and 48 h cells, stained with DAPI, and analyzed by flow cytometry. The data are presented as histograms in which the cell number is plotted against the DNA content. (B) Western analysis of Lmna–/– and Lmna+/+ fibroblasts cultured in 0.1% serum for 48 h and asynchronously grown fibroblasts probed with mouse anti-pRB, rabbit anti-pRB phospho-Ser-807/811, and anti-actin (loading control).

 
Mouse fibroblasts lacking lamin A/C do not arrest in the presence of p16ink4a. The functional consequences of reduced pRB levels in cells lacking lamin A/C remain to be fully elaborated. Previously, we reported that proliferating Lmna–/– cells possess similar properties to Rb–/– cells, including small cell size and altered cell cycle distributions (27). These findings suggest that Lmna–/– cells have insufficient pRB function to maintain proper cell cycle regulation. To test this directly, we determined whether Lmna–/– fibroblasts or siLmna cells were able to undergo cell cycle arrest in response to elevated p16ink4a activity. Rb–/– fibroblasts (as well as p107–/–/p130–/– fibroblasts) are resistant to cell cycle arrest by p16ink4a (8, 33, 38, 43). Indicative of the importance of this regulatory circuit in tumor suppression, the pathway connecting p16ink4a, cyclin/CDK, and pRB is dysregulated in most tumors.

We introduced GFP-p16ink4a into Lmna–/– and Lmna+/+ fibroblasts, as well as fibroblasts lacking pRB family members, and examined the proliferative state of cells 36 h posttransfection. Cells were labeled for 6 h with BrdU and fixed, and the percentage of cells positive for both GFP and BrdU was determined (Fig. 4A, B, and D). Similar to a previous report using mouse embryo fibroblasts lacking pRB family members (8), GFP-p16ink4a reduced the percentage of S-phase cells in Rb+/+ immortalized fibroblasts dramatically, whereas Rb–/– or p107–/–/p130–/– fibroblasts had no significant reduction. Importantly, Lmna–/– cells were also unresponsive to p16ink4a overexpression, suggesting that lamin A/C is necessary for pRB-dependent cell cycle arrest. To verify that p16ink4a-unresponsiveness was a direct consequence of loss of lamin A/C, we determined the response of siLmna cells to elevated p16ink4a expression (Fig. 4C and D). Consistently, we found that siLmna cells also fail to undergo cell cycle arrest in response to transient p16ink4a expression. Levels of p16ink4a overexpression were comparable in transfected Lmna+/+ and Lmna–/– cells and in siLmna cells, relative to loading controls (Fig. 4D).


Figure 4
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4. Cells lacking Lmna–/– fail to undergo cell cycle arrest in response to p16ink4a expression. S-phase cells were identified by BrdU incorporation after transient transfection of GFP-p16ink4a or GFP-p21cip1. Transfection with pcDNA3.1-GFP was used as a control. (A) Percentage of cells positive for GFP and BrdU incorporation 36 h after transfection in immortalized fibroblast knockout cells. (B) Immunofluorescence of cells expressing GFP-p16ink4a. Arrows indicate cells that incorporated both BrdU and GFP-p16ink4a. (C) Percentage of GFP-positive cells incorporating BrdU in Lmna–/– cells and NIH 3T3 cells treated with siRNAs to Lmna (siLmna). The results for panels A and C are shown with standard deviations from triplicate samples; 150 cells were counted per sample. (D) At 36 h after transfection, protein samples were separated by SDS-12% PAGE and detected by immunoblotting with mouse anti-p21 and rabbit anti-p16.

 
Another CDK inhibitor, p21cip1, arrests cells in an RB-independent fashion (17). If Lmna–/– cell cycle dysregulation is attributable to a loss of pRB function, then these cells should undergo p21cip1-mediated cell cycle arrest. Consistently, we find that cells lacking A-type lamins arrest normally in response to p21cip1 overexpression, illustrating that Lmna–/– cells behave similarly to Rb–/– cells and are not resistant to all G1 arrest signals (Fig. 4C and D).

To confirm that the loss of lamin A/C compromises cell cycle regulation by pRB and to measure the cell cycle position of p16ink4a-expressing cells, we introduced p16ink4a into Lmna–/– cells through retroviral infection. The infected cells were selected with puromycin for 2 days, and the percentage of cells in S phase was determined by quantifying BrdU incorporation, as described above. In all cases, we found that greater than 90% of the puromycin-resistant cells expressed p16ink4a (Fig. 5A). When the percentage of S-phase cells were determined, we found that p16ink4a-infected Lmna–/– cells did not have a significant reduction of S-phase cells compared to the vector control, whereas p16ink4a-infected Lmna+/+ cells demonstrated a sharp reduction (Fig. 5B). The expression levels of p16ink4a were similar in Lmna+/+ and Lmna–/– cells (Fig. 5C). Flow cytometric analysis was performed to measure more specifically the cell cycle positions of these cells. As expected, we found that p16ink4a confers G1-phase arrest in Lmna+/+ cells but not in cells lacking A-type lamins (Fig. 5D). Similar results were obtained when p16ink4a was transduced into siLmna cells (see Fig. S2 in the supplemental material).


Figure 5
View larger version (23K):
[in this window]
[in a new window]
  		FIG. 5. Lamna–/– cells fail to arrest in G1 phase in response to retrovirus-induced expression of p16ink4a. S-phase cells were identified by BrdU incorporation after infection of p16ink4a or control virus (pBabe). Cells were selected for 2 days in puromycin. (A) Immunofluorescence of selected cells for rabbit anti-p16ink4a and mouse anti-BrdU. (B) Percentage of cells incorporating BrdU after 2 days of puromycin selection. The results are shown with standard deviations from triplicate samples; 150 cells were counted per sample. (C) Protein samples were separated by SDS-12% PAGE and detected by immunoblotting with anti-p16. C, control vector (pBabe); p16, pBabe-p16ink4a. Detection by mouse anti-actin was used as a loading control. (D) After selection, cells were stained with DAPI and analyzed by flow cytometry. The data are presented as histograms in which the cell number is plotted against the DNA content.

 
Reintroduction of lamin A or lamin C renders Lmna–/– cells susceptible to p16ink4a-induced G1 arrest. To attribute pRB instability specifically loss on lamin A/C in Lmna–/– fibrobasts, we stably transduced human lamin A and monitored pRB protein levels. Stable lamin A expression was sufficient to restore near-normal pRB protein levels and cell cycle arrest in response to p16ink4a expression (Fig. 6A, B, and C). We attribute the observation that a slightly increased percentage of stable lamin A-expressing cells did not arrest in response to p16ink4a to the slight reduction in pRB levels compared to Lmna+/+ cells.


Figure 6
View larger version (51K):
[in this window]
[in a new window]
  		FIG. 6. Reintroduction of human lamin A or lamin C restores pRB stability. Lmna–/– cells were infected with pMXIH-lamin A and selected with hygromycin for 2 days. S-phase cells were identified by BrdU incorporation after transient transfection of GFP-p16ink4a or GFP-p21cip1. Transfection with pcDNA3.1-GFP was used as a control. (A) Immunofluorescence of infected Lmna–/– cells with rabbit anti-lamin A/C (red) and mouse anti-pRB (green). (B) Percentage of infected cells positive for GFP and BrdU incorporation 36 h after transfection in pMXIH infected cells. (C) Protein samples were separated by SDS-8% PAGE and detected by immunoblotting with mouse anti-pRB and rabbit anti-lamin A/C. In the blot "–/–" represents the Lmna–/– genotype, while "+/+" represents the littermate control (Lmna+/+) genotype. Detection by anti-actin was used as a loading control. (D) S-phase Lmna–/– cells were identified by BrdU incorporation after cotransfection of GFP-p16ink4a or GFP-p21cip1 and the indicated form of lamin. The results are shown with the standard deviations from triplicate samples; 150 cells were counted per sample. (E) Lmna–/– cells transfected with GFP-pRB and the indicated lamin protein were sorted for GFP-positive cells. Protein samples of the GFP-positive cells were separated by SDS-8% PAGE and detected by immunoblotting with mouse anti-pRB, rabbit anti-lamin A/C, and mouse anti-Flag. In the blot "controls" represents transfection with the empty vectors and "GFP-pRB" represents transfection with just GFP-pRB.

 
Lamin A has been reported to be required for normal lamin C localization (56, 71). Surprisingly, however, a mouse expressing only lamin C has no phenotype, indicating that lamin C is largely sufficient to perform the functions of A-type lamins (20). We determined whether the expression of lamin C alone would restore pRB stability and p16ink4a-mediated cell cycle arrest by cotransfecting human lamin C, or lamin A as a control, into the Lmna–/– cells. Expression of either lamin A or C rescued p16ink4a sensitivity in this assay (Fig. 6D). To verify that the reintroduction of lamin C rescued pRB levels, GFP-pRB was cotransfected with lamin C into Lmna–/– cells, and the GFP-positive cells were sorted by using FACS analysis. Western analysis of the GFP-positive cells showed that both lamin A and lamin C increased pRB levels fivefold compared to Lmna–/– cells transfected with the vector control or 3xFlag lamin B, which had no effect (Fig. 6E). These findings together with those described above in multiple cell lines with reduced lamin A/C expression, demonstrate that A-type lamins are required for cell cycle arrest through the p16ink4a-pRB pathway.

Reintroduction of pRB induces arrest in cells lacking lamin A/C. We have reported previously that lamin A/C is required for both the stability of pRB and its localization to perinucleolar foci (27). Since proper localization might be required for normal pRB activity, it was not clear whether increased expression of pRB in Lmna–/– fibroblasts would be sufficient to restore p16ink4a responsiveness. To test the consequences of increased pRB expression on cell cycle progression in cells with reduced lamin A/C expression, we transfected a variety of cell lines with either GFP alone, GFP and pRB, or GFP-p16ink4a and pRB (Fig. 7A). At 36 h after transfection only 8% of the GFP-pRB-positive Lmna–/– cells were also positive for BrdU compared to 33% of the GFP-positive control Lmna–/– cells. Similar results were found when GFP-pRB was expressed in littermate Lmna+/+ cells, as well as the siLmna and siGFP cells. This finding is consistent with experiments in NIH 3T3 cells, where enforced pRB expression confers reduced cell proliferation (24, 53, 64), and indicates that increased expression of pRB in cells with reduced lamin A/C expression can still confer G1 arrest. Cotransfection of GFP-p16ink4a and pRB led to a further reduction in the percentage of S-phase cells relative to controls. This finding indicates that the loss of pRB is sufficient to explain the lack of responsiveness of Lmna–/– cells to elevated p16ink4a expression.


Figure 7
View larger version (25K):
[in this window]
[in a new window]
  		FIG. 7. Overexpression of pRB induces arrest in cells lacking A-type lamins. S-phase cells were identified by BrdU incorporation after transient transfection of GFP-p16ink4a and pcDNA3.1-pRB. Transfection with pcDNA3.1-GFP was used as a control. (A) Percentage of cells positive for GFP and BrdU incorporation 36 h after transfection in the cell lines stated previously. The results are shown with the standard deviations from triplicate samples; 150 cells were counted per sample. (B) Immunofluorescence detecting mouse anti-pRB in Rb–/–, Lmna–/–, Lmna+/+, siLmna, and siGFP cells transfected with pcDNA3.1-pRB. Arrows indicate a transfected cell.

 
We also examined the localization of transfected RB in these cells by immunofluorescence (Fig. 7B). Unlike endogenous pRB in Lmna–/– cells (27), transfected pRB exhibited a more distributed nuclear pattern in both Lmna+/+ and Lmna–/– cells. These findings indicate that either localization to perinucleolar foci was not required for pRB-mediated cell cycle arrest or overexpression of pRB permits a subset of the protein to localize correctly in the absence of lamin A/C.

Expression of laminopathy-associated and processing-defective lamin A mutants. Given the known roles of pRB in cell cycle control, cell senescence, and muscle and fat cell differentiation, we speculated that reduced pRB activity might underlie some of the pathologies in one or more of the laminopathies (14, 36, 57, 78). To test this, we examined the ability of a number of lamin A mutant alleles, corresponding to missense mutations associated with disease, to restore p16ink4a responsiveness to the Lmna–/– fibroblasts. We chose lamin A mutants from mandibuloacral dysplasia (MAD; R527H and A529V), atypical Werner syndrome (AWS; A57P and R133L), Charcot-Marie-Tooth disorder type II (CMT2B1; R298C), Dunnigan-type familial partial lipodystrophy (FPLD; R28W, R62G, and V440M), dilated cardiomyopathy (CMD1A; L85R, N195K, and S573L), limb girdle muscular dystrophy (LGMD; R377H), Emery-Dreifuss muscular dystrophy (EDMD2/3; R453W and R527P), and Hutchinson-Gilford Progeria Syndrome (HGPS; G608G* and R527C). The G608G* allele was engineered to express the lamin A mutant protein corresponding to the allele produced by activation of a cryptic splice site in the G608G HGPS mutant (35). Many if not all of these mutations are linked to a defect in nuclear shape. We suspected that expression of many of these alleles in Lmna–/– fibroblasts would be insufficient to restore proper pRB expression and/or p16ink4a-mediated cell cycle arrest. However, with the exception of the R527H MAD allele, expression of all other laminopathy mutants restored responsiveness to p16ink4a (Fig. 8A). Interestingly, the MAD A529V mutant also restored p16ink4a sensitivity, suggesting that loss of pRB function is not disease associated and instead is specific to the mutation of arginine at residue 527. To help us understand the importance of R527, we tested two laminopathy mutants that derive from different mutations of R527 (EDMD2/3 R527P and HPGS R527C). We found that both mutations restored p16ink4a responsiveness, suggesting that the loss of pRB function and levels is specific to the R527H mutation. As a control we expressed 21cip1, observing normal cell cycle arrest in the presence of all laminopathy mutants.


Figure 8
View larger version (62K):
[in this window]
[in a new window]
  		FIG. 8. Transfection of laminopathy mutants into Lmna–/– cells. The following forms of human lamin A were transfected into Lmna–/– cells: WT, wild type; -prenyl, inhibition of prenylation and methylation; –2nd cleavage, loss of second cleavage; MAD, mandibuloacral dysplasia; AWS, atypical Werner syndrome; CMT2B1, Charcot-Marie-Tooth disorder type II; FPLD, Dunnigan type familial lipodystrophy; CMD1A, dilated cardiomyopathy; LGMD, limb girdle muscular dystrophy; EDMD, Emery Dreifuss muscular dystrophy; HGPS, Hutchison-Gilford progeria. The cDNA for HGPS G608G* mimics the aberrant splicing mutant which removes the 50 amino acids in the C terminus that includes the second processing cleavage site (35). S-phase cells were identified by BrdU incorporation after transfection of GFP-p16ink4a or GFP-p21cip1 and the indicated form of human lamin A. (A) Percentage of cells positive for GFP and BrdU incorporation 36 h after transfection. Lanes labeled Rb–/–, Lmna+/+, and Lmna–/– were not transfected (UnTxn) with human lamin A. The results are shown with the standard deviations from triplicate samples; 150 cells were counted per sample. (B) Lmna–/– fibroblasts cotransfected with GFP-pRB and the indicated form of human lamin A were sorted for GFP-positive cells by using FACS analysis. Protein samples from GFP-positive cells were separated by using SDS-8% PAGE and detected by immunoblotting with rabbit anti-lamin A/C and mouse anti-pRB. In the blot "controls" represents transfection with the empty vectors, and "GFP-pRB" represents transfection with just GFP-pRB. Note that wild-type human lamin A migrates at a higher molecular weight than mouse lamin A. Due to the presence of part of the C-terminal trail, both processing mutants migrate at higher molecular weight than wild-type human lamin A. The detection of mouse anti-actin controlled for protein load. (C) Immunofluorescence detecting mouse anti-lamin A/C and rabbit anti-pRB in Lmna–/– cells transfected with human lamin A mutant allele. Arrows indicate a nuclear abnormality known as blebbing (77).

 
To verify that expression of laminopathy alleles, except MAD R527H, resulted in the restoration of pRB levels, we cotransfected GFP-pRB with the indicated laminopathy allele and using FACS analysis to collect GFP-positive cells (Fig. 8B). Western analysis of the GFP-positive cells indicated that three laminopathy alleles (HGPS R527C, HGPS G608G*, and MAD A529V) increased pRB levels three- to fourfold, whereas pRB levels in MAD R527H-expressing cells remained low (Fig. 8B). Consistently, as determined by indirect immunofluorescence, pRB focus intensity was restored in all laminopathies except MAD R527H (Fig. 8C; see Table S1 in the supplemental material). The expression of laminopathy alleles or wild-type lamin A was also verified through Western analysis (Fig. 8B). Note that the MAD R527H allele migrates similarly to wild-type lamin A, whereas HGPS G608G* migrates faster due to the loss of 50 amino acids. Although our findings do not rule out links between altered pRB function and the laminopathies, they fail to support such an assertion. Also worth noting is that altered nuclear shape is insufficient as a proxy to make conclusions about A-type lamin function, since many of these mutants fail to restore proper nuclear shape to Lmna–/– cells. Indeed, we find that expression of some of these alleles exacerbate nuclear shape abnormalities relative to control transfected Lmna–/– fibroblasts (Fig. 8C and results not shown).

We also introduced two processing defective alleles of lamin A and determined their affects on p16ink4a-mediated cell cycle arrest. These include C661S, which blocks prenylation, and L647R, which blocks the second proteolytic event leading to mature lamin A. Neither expression of C661S or L647R was sufficient to restore sensitivity to p16ink4a to the Lmna–/– cells, indicating that complete processing of lamin A is required to confer pRB stability and function (Fig. 8). The expression and protein levels of the two processing mutants for lamin A/C and pRB were determined in the same manner as for the laminopathy mutants described above (Fig. 8B and C). pRB levels remained low in the presence of both lamin A mutants. Our data correspond to a recent study showing decreased pRB levels in liver cells deficient in lamin A processing (70). It is somewhat surprising that the L647R and G608G* HGPS mutant behaved differently in this assay. G608G activates a cryptic splice site leading to altered LMNA splicing, which ultimately produces a lamin A protein that lacks the second proteolytic cleavage site and is therefore expected to remain stably prenylated (see Discussion) (18).

To better understand the role that lamin A processing has in maintaining pRB stability, we cotransfected GFP-p16ink4a and mutant alleles of human lamin A into fibroblasts possessing endogenous lamin A (Lmna+/+ cells). Cells transfected with two lamin A processing mutants (C661S and L647R) became refractory to p16ink4a, whereas the introduction of wild-type lamin A or MAD R527H did not interfere with p16ink4a responsiveness (Fig. 9A). Thus, processing mutants, but not R527H, act in a dominant fashion to interfere with pRB function. Our data correspond with recent findings suggesting that unprocessed lamin A acts dominantly in laminopathy-based premature aging and that MAD is an autosomal-recessive disorder (37, 40, 48).


Figure 9
View larger version (41K):
[in this window]
[in a new window]
  		FIG. 9. Transfection of laminopathy mutants into Lmna+/+ cells. The following forms of human lamin A were transfected into Lmna+/+ cells: WT, full-length wild type; -prenyl, inhibition of prenylation and methylation; –2nd cleavage, loss of CaaX cleavage; and MAD, mandibuloacral dysplasia. S-phase cells were identified by BrdU incorporation after transfection of GFP-p16ink4a and the indicated form of human lamin A. (A) Percentage of cells positive for GFP and BrdU incorporation 36 h after transfection into Lmna+/+ cells. The results are shown with the standard deviations from triplicate samples; 150 cells were counted per sample. (B) Lmna+/+ cells cotransfected with GFP-pRB and the indicated lamin A mutant were sorted for GFP-positive cells by using FACS analysis. Protein samples from GFP-positive cells were separated by using SDS-8% PAGE and detected by immunoblotting with mouse anti-lamin A/C and mouse anti-pRB. Note the mouse anti-lamin A/C only detects human lamin A/C. In the blot "GFP-pRB" represents transfection with just GFP-pRB. Detection for mouse anti-actin controlled for protein load. (C) Immunofluorescence detecting mouse anti-lamin A and rabbit anti-pRB in Lmna+/+ cells cotransfected with pcDNA3.1-GFP and human lamin A mutant allele.

 
To verify that pRB levels are decreased with the introduction of the processing mutants, we cotransfected GFP-pRB with MAD R527H, C661S, or L647R into Lmna+/+ cells and sorted the GFP-positive cells by FACS analysis. Western analysis of the GFP positive cells showed that expression of C661S and L647R led to a fivefold reduction in pRB levels, whereas MAD R527H possessed pRB levels similar to those for Lmna+/+ cells transfected with lamin A (Fig. 9B). Indirect immunofluorescence of Lmna+/+ cells cotransfected with GFP and a mutant allele of lamin A also showed that both C661S or L647R alleles resulted in loss of endogenous pRB, whereas wild-type lamin A and the R527H allele retained pRB wild-type levels (Fig. 9C; see Table S2 in the supplemental material). Our findings suggest that unprocessed lamin A acts in a dominant-negative manner resulting in pRB instability, while R527H, a recessive mutation in MAD, does not interfere with pRB function in the presence of endogenous wild-type lamin A/C.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have examined links between nuclear structure and proper cell cycle control, finding that A-type nuclear lamins are required for proper cell cycle exit in response to p16ink4a. Multiple cell lines depleted for lamin A/C expression remain in a proliferative state in the presence of this CDK inhibitor. Several lines of evidence lead us to conclude that the inability of these cells to withdraw from the cell cycle in response to p16ink4a results from reduced stability of the retinoblastoma protein. First, following up on earlier data (27), we show that in Lmna–/– fibroblasts and in NIH 3T3 cells with siRNA-enforced reduction in lamin A/C levels, pRB undergoes increased ubiquitination and more rapid proteasome-mediated turnover. Second, overexpression of p21cip1, another CDK inhibitor known to confer cell cycle arrest in a pRB-independent fashion, arrests Lmna–/– cells normally (17). Third, reintroduction of lamin A and lamin C restores pRB stability and confers p16ink4a responsiveness. Finally, we find that reintroduction of pRB also restores p16ink4a responsiveness. These findings link lamin A/C activity to the activation of a critical tumor suppressor pathway and raise the possibility that somatic mutations in LMNA might contribute to tumor progression.

Proteasome-dependent degradation of pRB. In mammalian cells, pRB is a highly stable protein, regulated in large part through phosphorylation by cell cycle kinases. The first example of proteasome-dependent pRB degradation was reported for cells expressing the human papillomavirus oncoprotein E7 (6, 28, 46). Recent findings have linked other viral oncoproteins to pRB-mediated degradation including EBNA3C, human T-cell leukemia virus type 1 Tax, and the human cytomegalovirus pp71 protein (29, 30, 32). It is possible that these viral oncoproteins could act at least in part by interfering with pRB access to nuclear lamins or the nuclear matrix. Another recent report found that cells with reduced lamin A/C expression exhibit altered pRB phosphorylation patterns but not reduced stability (69). Previous studies have linked increased pRB phosphorylation to its degradation (25, 39, 73). A-type lamins may be altering phosphorylation of a specific site, leading to pRB instability.

Lamin C rescues pRB levels and function. Prior reports postulated that lamin A is especially important relative to lamin C since lamin A targets lamin C and emerin to the nuclear envelope (56, 71). However, a recent study showed that mice expressing only lamin C were entirely healthy, suggesting that lamin A is a dispensable nuclear component (20). Fong et al. (20) did not investigate the mechanism by which lamin C compensated for the loss of lamin A, but one could hypothesize that lamin A and lamin C possess overlapping functions that are not dependent on each other. Supporting this assertion, we find that reintroduction of either lamin A or lamin C into Lmna–/– cells restored p16ink4a sensitivity and pRB protein levels.

LMNA disease mutants. Why missense mutations in LMNA lead to at least 13 different human diseases with several nonoverlapping pathologies remains largely a mystery. Also unresolved is why missense mutations in the same gene can lead to so many sometimes nonoverlapping diseases. We and others have considered the possibility that deregulated pRB function might underlie some of the pathologies associated with LMNA mutation (26, 79). By this reasoning, reintroduction of lamin A disease mutants into Lmna–/– cells might not restore pRB protein levels and p16ink4a responsiveness. We chose representative Lamin A mutant alleles from a variety of diseases and transfected them in Lmna–/– fibroblasts. All but one of the mutants (see below) restored p16ink4a responsiveness. With regard to these mutants (representing AWS, CMD1A, CMT2B1, EDMD2/3, FPLD, and HGPS), we found no evidence to support the assertion that decreased or altered pRB function is a factor in disease progression.

Surprisingly, only one of the disease-associated mutants, R527H, failed to restore p16ink4a responsiveness. The arginine at residue 527 is particularly interesting since mutation to histidine is associated with MAD, mutation to proline is associated with EDMD2/3, and mutation to cysteine has been linked to HGPS (5, 9, 49). Of note, the patient with MAD was found to be homozygous for R527P, whereas the EDMD2/3 and HGPS patients, like most other affected individuals, carried only one copy of the mutant allele. We tested all three mutants for their ability to restore p16ink4a responsiveness, finding that R527P and R527C complemented lamin A/C deficiency and not R527H. Structural analysis of the C-terminal immunoglobulin region of lamin A suggests that all three mutations should lead to an abrogation of a salt bridge with a glutamate at residue 537 (23). Consequently, the reason for the divergent behavior of these three mutant alleles is unknown. Although the MAD R527H mutant cannot confer pRB stability, we think it unlikely that destabilization of pRB underlies mandibuloacral dysplasia since another MAD mutant (A529V) retains the capacity to stabilize pRB.

Lamin A processing and pRB stability. Mutation of ZMPSTE24 is also known to cause MAD, HGPS, and restrictive dermopathy (another disease linked to LMNA mutation) (1, 40, 47, 49, 68). This zinc metalloprotease is responsible for C-terminal processing of lamin A (13). We have tested the ability of two lamin A mutants that interfere with C-terminal processing (C661S or L647R), finding that neither of them restore pRB stability and cell cycle arrest in response to p16ink4a expression. The C661S mutant blocks processing prior to prenylation, whereas the L647R mutant interferes with the second cleavage event, presumably leading to permanent prenylation. Interestingly, these mutants not only fail restore pRB stability in Lmna–/– cells but also interfere with the stabilizing ability of wild-type lamin A/C when expressed in Lmna+/+ cells, indicating that proper maturation of lamin A is required to stabilize pRB and sensitize cells to p16ink4a expression.

The HGPS mutant G608G* results in an aberrant splicing event, removing 50 amino acids in the C terminus of lamin A, including the second processing site. As such, it is expected that this lamin A mutant will remain permanently prenylated. Therefore, we predicted that the HGPS mutant would behave identically to L647R, which removes the second Zmpste24 cleavage site. However, Lmna–/– cells expressing L647R had low levels of pRB and were refractory to p16ink4a arrest, whereas Lmna–/– cells expressing G608G* exhibited a normal response to p16ink4a overexpression. Thus, the protein that results from the G608G* mutant does not always phenocopy deficient lamin A processing. A recent study supports our finding concerning the L647R mutant since liver cells from a Zmpste24–/– mouse possessed decreased pRB levels (70). Although regulation of pRB may be unrelated to HGPS, this finding, along with the fact that other lamin A mutants linked to HGPS have no obvious link to C-terminal processing, should serve as a cautionary note that the pathologies associated with lamin mutations causing HGPS may not be entirely explained by lamin A processing defects.

Summary. A-type lamins are thought to regulate the activity of a number of transcription factors, although the precise mechanism(s) by which this intermediate filament protein regulates transcription remains unknown. We show that lamin A/C controls the stability of pRB and is required for its function in cell cycle control. Although lamin A/C is reported to interact with pRB, the relevance of this interaction to the maintenance of pRB stability remains to be determined. We speculate that lamin A/C binds to pRB and either promotes proper localization of pRB, interferes directly with pRB ubiquitination, or both. Association with the nuclear substructure is a characteristic of many transcription factors, including pRB, and continued studies of lamin A and pRB will likely shed light on the relationship between nuclear structure and proper transcriptional control.

. . . . . .


   ACKNOWLEDGMENTS
 
We thank Marie Classon and Denise Galloway for supplying reagents and Richard Frock and Erica Smith for thoughtful discussion.

R.T.N. is supported by NIH training grant AG013280. B.A.K. is supported in part by PHS NRSA T32 GM07270 from the NIGMS. This research was supported by National Institutes of Health grant R01AG024287 to B.K.K. B.K.K. is a Searle Scholar.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, University of Washington, Seattle, WA 98195. Phone: (206) 685-0111. Fax: (206) 685-1792. E-mail: bkenn{at}u.washington.edu. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Agarwal, A. K., J. P. Fryns, R. J. Auchus, and A. Garg. 2003. Zinc metalloproteinase, ZMPSTE24, is mutated in mandibuloacral dysplasia. Hum. Mol. Genet. 12:1995-2001.[Abstract/Free Full Text]

2. Attwooll, C., E. Lazzerini-Denchi, and K. Helin. 2004. The E2F family: specific functions and overlapping interests. EMBO J. 23:4709-4716.[CrossRef][Medline]

3. Bergo, M. O., B. Gavino, J. Ross, W. K. Schmidt, C. Hong, L. V. Kendall, A. Mohr, M. Meta, H. Genant, Y. Jiang, E. R. Wisner, N. Van Bruggen, R. A. Carano, S. Michaelis, S. M. Griffey, and S. G. Young. 2002. Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect. Proc. Natl. Acad. Sci. USA 99:13049-13054.[Abstract/Free Full Text]

4. Blais, A., and B. D. Dynlacht. 2004. Hitting their targets: an emerging picture of E2F and cell cycle control. Curr. Opin. Genet. Dev. 14:527-532.[CrossRef][Medline]

5. Bonne, G., M. R. Di Barletta, S. Varnous, H. M. Becane, E. H. Hammouda, L. Merlini, F. Muntoni, C. R. Greenberg, F. Gary, J. A. Urtizberea, D. Duboc, M. Fardeau, D. Toniolo, and K. Schwartz. 1999. Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat. Genet. 21:285-288.[CrossRef][Medline]

6. Boyer, S., D. Wazer, and V. Band. 1996. E7 protein of human papillomavirus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway. Cancer Res. 56:4620-4624.[Abstract/Free Full Text]

7. Bridger, J. M., I. R. Kill, M. O'Farrell, and C. J. Hutchison. 1993. Internal lamin structures within G1 nuclei of human dermal fibroblasts. J. Cell Sci. 104:297-306.[Abstract]

8. Bruce, J. L., R. K. J. Hurford, M. Classon, J. Koh, and N. Dyson. 2000. Requirements for cell cycle arrest by p16INK4a. Mol. Cell 6:737-742.[CrossRef][Medline]

9. Cao, H., and R. A. Hegele. 2003. LMNA is mutated in Hutchinson-Gilford progeria (MIM 176670) but not in Wiedemann-Rautenstrauch progeroid syndrome (MIM 264090). J. Hum. Genet. 48:271-274.[CrossRef][Medline]

10. Cao, H., and R. A. Hegele. 2000. Nuclear lamin A/C R482Q mutation in Canadian kindreds with Dunnigan-type familial partial lipodystrophy. Hum. Mol. Genet. 9:109-112.[Abstract/Free Full Text]

11. Reference deleted.

12. Classon, M., S. Salama, C. Gorka, R. Mulloy, P. Braun, and E. Harlow. 2000. Combinatorial roles for pRB, p107, and p130 in E2F-mediated cell cycle control. Proc. Natl. Acad. Sci. USA 97:10820-10825.[Abstract/Free Full Text]

13. Corrigan, D. P., D. Kuszczak, A. E. Rusinol, D. P. Thewke, C. A. Hrycyna, S. Michaelis, and M. S. Sinensky. 2005. Prelamin A endoproteolytic processing in vitro by recombinant Zmpste24. Biochem. J. 387:129-138.[CrossRef][Medline]

14. de Bruin, A., L. Wu, H. I. Saavedra, P. Wilson, Y. Yang, T. J. Rosol, M. Weinstein, M. L. Robinson, and G. Leone. 2003. Rb function in extraembryonic lineages suppresses apoptosis in the CNA of Rb-deficient mice. Proc. Natl. Acad. Sci. USA 100:6546-6551.[Abstract/Free Full Text]

15. De Sandre-Giovannoli, A., R. Bernard, P. Cau, C. Navarro, J. Amiel, I. Boccaccio, S. Lyonnet, C. L. Stewart, A. Munnich, M. Le Merrer, and N. Levy. 2003. Lamin A truncation in Hutchison-Gilford progeria. Science 300:2055.[Free Full Text]

16. Dimova, D. K., and N. J. Dyson. 2005. The E2F transcriptional network: old acquaintances with new faces. Oncogene 24:2810-2826.[CrossRef][Medline]

17. Dimri, G. P., M. Nakanishi, P. Y. Desprez, J. R. Smith, and J. Campisi. 1996. Inhibition of E2F activity by the cyclin-dependent protein kinase inhibitor p21 in cells expressing or lacking a functional retinoblastoma protein. Mol. Cell. Biol. 16:2987-2997.[Abstract]

18. Eriksson, M., W. T. Brown, L. B. Gordon, M. W. Glynn, J. Singer, L. Scott, M. R. Erdos, C. M. Robbins, T. Y. Moses, P. Berglund, A. Dutra, E. Pak, S. Durkin, A. B. Csoka, M. Boehnke, T. W. Glover, and F. S. Collins. 2003. Recurrent de novo point mutations in lamin A cause Hutchison-Gilford progeria syndrome. Nature 423:293-298.[CrossRef][Medline]

19. Fatkin, D., C. MacRae, T. Sasaki, M. R. Wolff, M. Porcu, M. Frenneaux, J. Atherton, H. J. J. Vidaillet, S. Spudich, U. De Girolami, J. G. Seidman, C. Seidman, F. Muntoni, G. Muehle, W. Johnson, and B. McDonough. 1999. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N. Engl. J. Med. 341:1715-1724.[Abstract/Free Full Text]

20. Fong, L. G., J. K. Ng, J. Lammerding, T. A. Vickers, M. Meta, N. Cote, B. Gavino, X. Qiao, S. Y. Chang, S. R. Young, S. H. Yang, C. L. Stewart, R. T. Lee, C. F. Bennett, M. O. Bergo, and S. G. Young. 2006. Prelamin A and lamin A appear to be dispensable in the nuclear lamina. J. Clin. Investig. 116:743-752.[CrossRef][Medline]

21. Frock, R. L., B. A. Kudlow, A. M. Evans, S. A. Jameson, S. D. Hauschka, and B. K. Kennedy. 2006. Lamin A/C and emerin are critical for skeletal muscle satellite cell differentiation. Genes Dev. 20:486-500.[Abstract/Free Full Text]

22. Frolov, M. V., and N. J. Dyson. 2004. Molecular mechanisms of E2F-dependent activation and pRB-mediated repression. J. Cell Sci. 117:2173-2181.[Abstract/Free Full Text]

23. Garg, A., O. Cogulu, F. Ozkinay, H. Onay, and A. K. Agarwal. 2005. A novel homozygous Ala529Val LMNA mutation in Turkish patients with mandibuloacral dysplasia. J. Clin. Endocrinol. Metab. 90:5259-5264.[Abstract/Free Full Text]

24. Goodrich, D. W., N. P. Wang, Y.-W. Qian, E. Y.-H. P. Lee, and W.-H. Lee. 1991. The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell 67:293-302.[CrossRef][Medline]

25. Higashitsuji, H., Y. Liu, R. J. Mayer, and J. Fujita. 2005. The oncoprotein gankyrin negatively regulates both p53 and RB by enhancing proteasomal degradation. Cell Cycle. 4:1335-1337.[Medline]

26. Hubner, S., J. E. Eam, A. Hubner, and D. A. Jans. 2006. Laminopathy-inducing lamin A mutants can induce redistribution of lamin binding proteins into nuclear aggregates. Exp. Cell Res. 312:171-183.[CrossRef][Medline]

27. Johnson, B. R., R. T. Nitta, R. L. Frock, L. Mounkes, D. A. Barbie, C. L. Stewart, E. Harlow, and B. K. Kennedy. 2004. A-type lamins regulate retinoblastoma protein function by promoting subnuclear localization and preventing proteasomal degradation. Proc. Natl. Acad. Sci. USA 101:9677-9682.[Abstract/Free Full Text]

28. Jones, D., D. Thompson, and K. Munger. 1997. Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239:97-107.[CrossRef][Medline]

29. Kalejta, R. F., and T. Shenk. 2003. Proteasome-dependent, ubiquitin-independent degradation of the pRB family of tumor suppressors by the human cytomegalovirus pp71 protein. Proc. Natl. Acad. Sci. USA 100:3263-3268.[Abstract/Free Full Text]

30. Kehn, K., L. Fuente Cde, K. Strouss, R. Berro, H. Jiang, J. Brady, R. Mahieux, A. Pumfery, M. E. Bottazzi, and F. Kashanchi. 2005. The HTLV-1 Tax oncoprotein targets the retinoblastoma protein for proteasomal degradation. Oncogene 24:525-540.[CrossRef][Medline]

31. Kennedy, B. K., D. A. Barbie, M. Classon, N. Dyson, and E. Harlow. 2000. Nuclear organization of DNA replication in primary mammalian cells. Genes Dev. 14:2855-2868.[Abstract/Free Full Text]

32. Knight, J. S., N. Sharma, and E. S. Robertson. 2005. Epstein-Barr virus latent antigen 3C can mediate the degradation of the retinoblastoma protein through an SCF cellular ubiquitin ligase. Proc. Natl. Acad. Sci. USA 102:18562-18566.[Abstract/Free Full Text]

33. Koh, J., G. H. Enders, B. D. Dynlacht, and E. Harlow. 1995. Tumor-derived p16 alleles encoding proteins defective in cell cycle inhibition. Nature 375:506-510.[CrossRef][Medline]

34. Korenjak, M., and A. Brehm. 2005. E2F-Rb complexes regulating transcription of genes important for differentiation and development. Curr. Opin. Genet. Dev. 15:520-527.[CrossRef][Medline]

35. Kudlow, B. A., S. A. Jameson, and B. K. Kennedy. 2005. HIV protease inhibitors block adipocyte differentiation independently of lamin A/C. Aids 19:1565-1573.[Medline]

36. Lasorella, A., R. Boldrini, C. Dominici, A. Donfrancesco, Y. Yokota, A. Inserra, and A. Iavarone. 2002. Id2 is critical for cellular proliferation and is the oncogenic effector of N-myc in human neuroblastoma. Cancer Res. 62:301-306.[Abstract/Free Full Text]

37. Liu, B., J. Wang, K. M. Chan, W. M. Tjia, W. Deng, X. Guan, J. D. Huang, K. M. Li, P. Y. Chau, D. J. Chen, D. Pei, A. M. Pendas, J. Cadinanos, C. Lopez-Otin, H. F. Tse, C. Hutchison, J. Chen, Y. Cao, K. S. Cheah, K. Tryggvason, and Z. Zhou. 2005. Genomic instability in laminopathy-based premature aging. Nat. Med. 11:780-785.[CrossRef][Medline]

38. Lukas, J., D. Parry, L. Aagarrd, D. J. Mann, J. Bartkova, M. Strauss, G. Peters, and J. Bartek. 1995. Retinoblastoma-protein-dependent inhibition by the tumor-suppressor p16. Nature 375:503-506.[CrossRef][Medline]

39. Lund, J., P. Tedesco, K. Duke, J. Wang, S. K. Kim, and T. E. Johnson. 2002. Transcriptional profile of aging in C. elegans. Curr. Biol. 12:1566-1573.[CrossRef][Medline]

40. Mallampalli, M. P., G. Huyer, P. Bendale, M. H. Gelb, and S. Michaelis. 2005. Inhibiting farnesylation reverses the nuclear morphology defect in a HeLa cell model for Hutchinson-Gilford progeria syndrome. Proc. Natl. Acad. Sci. USA 102:14416-14421.[Abstract/Free Full Text]

41. Mancini, M. A., B. Shan, J. A. Nickerson, S. Penman, and W. H. Lee. 1994. The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein. Proc. Natl. Acad. Sci. USA 91:418-422.[Abstract/Free Full Text]

42. Markiewicz, E., T. Dechat, R. Foisner, R. A. Quinlan, and C. J. Hutchison. 2002. Lamin A/C binding protein LAP2{alpha} is required for nuclear anchorage of retinoblastoma protein. Mol. Biol. Cell 13:4401-4413.[Abstract/Free Full Text]

43. Medema, R. H., R. E. Herrera, F. Lam, and R. A. Weinberg. 1995. Growth suppression by p16ink4 requires functional retinoblastoma protein. Proc. Natl. Acad. Sci. USA 92:6289-6293.[Abstract/Free Full Text]

44. Mittnacht, S., P. W. Hinds, S. F. Dowdy, and R. A. Weinberg. 1991. Modulation of retinoblastoma protein activity during the cell cycle. Cold Spring Harbor Symp. Quant. Biol. 56:197-209.[Medline]

45. Muchir, A., G. Bonne, A. J. van der Kooi, M. van Meegan, F. Baas, P. A. Bolhuis, M. de Visser, and K. Schwartz. 2000. Identification of mutations in the gene encoding lamin A/C in autosomal dominant limb girdle muscular dystrophy with atrioventricular conduction disturbances (LGMD1B). Hum. Mol. Genet. 9:1453-1459.[Abstract/Free Full Text]

46. Munger, K., B. A. Werness, N. Dyson, W. C. Phelps, E. Harlow, and P. M. Howley. 1989. Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 8:4099-4105.[Medline]

47. Navarro, C. L., J. Cadinanos, A. De Sandre-Giovannoli, R. Bernard, S. Courrier, I. Boccaccio, A. Boyer, W. J. Kleijer, A. Wagner, F. Giuliano, F. A. Beemer, J. M. Freije, P. Cau, R. C. Hennekam, C. Lopez-Otin, C. Badens, and N. Levy. 2005. Loss of ZMPSTE24 (FACE-1) causes autosomal recessive restrictive dermopathy and accumulation of Lamin A precursors. Hum. Mol. Genet. 14:1503-1513.[Abstract/Free Full Text]

48. Novelli, G., and M. R. D'Apice. 2003. The strange case of the "lumper" lamin A/C gene and human premature ageing. Trends Mol. Med. 9:370-375.[CrossRef][Medline]

49. Novelli, G., A. Muchir, F. Sangiuolo, A. Helbling-Leclerc, M. R. D'Apice, C. Massart, F. Capon, P. Sbraccia, M. Federici, R. Lauro, C. Tudisco, R. Pallotta, G. Scarano, B. Dallapiccola, L. Merlini, and G. Bonne. 2002. Mandibuloacral dysplasia is caused by a mutation in LMNA-encoding lamin A/C. Am. J. Hum. Genet. 7:426-431.

50. Ohtani, N., K. Yamakoshi, A. Takahashi, and E. Hara. 2004. The p16INK4a-RB pathway: molecular link between cellular senescence and tumor suppression. J. Med. Investig. 51:146-153.[CrossRef][Medline]

51. Ozaki, T., M. Saijo, K. Murakami, H. Enomoto, Y. Taya, and S. Sakiyama. 1994. Complex formation between Lamin A and the retinoblastoma gene product: identification of the domain on lamin A required for its interaction. Oncogene 9:2649-2653.[Medline]

52. Pendas, A. M., Z. Zhou, J. Cadinanos, J. M. Freije, J. Wang, K. Hultenby, A. Astudillo, A. Wernerson, F. Rodriguez, K. Tryggvason, and C. Lopez-Otin. 2002. Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinase-deficient mice. Nat. Genet. 31:94-99.[CrossRef][Medline]

53. Phelps, W. C., C. L. Yee, K. Munger, and P. M. Howley. 1988. The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53:539-547.[CrossRef][Medline]

54. Rabinovitch, P. S. 1994. DNA content histogram and cell cycle analysis. Methods Cell Biol. 41:263-296.[Medline]

55. Rabinovitch, P. S., B. J. Reid, R. C. Haggitt, T. H. Norwood, and C. E. Rubin. 1989. Progression to cancer in Barrett's esophagus is associated with genomic instability. Lab. Investig. 60:65-71.

56. Raharjo, W. H., P. Enarson, T. Sullivan, C. L. Stewart, and B. Burke. 2001. Nuclear envelope defects associated with LMNA mutations cause dilated cardiomyopathy and Emery-Dreifuss muscular dystrophy. J. Cell Sci. 114:4447-4457.[Medline]

57. Riley, D., C. Liu, and W. Lee. 1997. Mutations of N-terminal regions render the retinoblastoma protein insufficient for functions in development and tumor suppression. Mol. Cell. Biol. 17:7342-7352.[Abstract]

58. Shackleton, S., D. J. Lloyd, S. N. Jackson, R. Evans, M. F. Niermeijer, B. M. Singh, H. Schmidt, G. Brabant, S. Kumar, P. N. Durrington, S. Gregory, S. O'Rahilly, and R. C. Trembath. 2000. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat. Genet. 24:153-156.[CrossRef][Medline]

59. Shan, B., X. Zhu, P.-L. Chen, T. Durfee, Y. Yang, D. Sharp, and W.-H. Lee. 1992. Molecular cloning of cellular genes encoding retinoblastoma-associated proteins: identification of a gene with properties of the transcription factor E2F. Mol. Cell. Biol. 12:5620-5631.[Abstract/Free Full Text]

60. Sharpless, N. E. 2005. INK4a/ARF: a multifunctional tumor suppressor locus. Mutat. Res. 576:22-38.[Medline]

61. Shay, J. W., O. M. Pereira-Smith, and W. E. Wright. 1991. A role for both RB and p53 in the regulation of human cellular senescence. Exp. Cell Res. 196:33-39.[CrossRef][Medline]

62. Shen, J. J., C. A. Brown, J. R. Lupski, and L. Potocki. 2003. Mandibuloacral dysplasia caused by homozygosity for the R527H mutation in lamin A/C. J. Med. Genet. 40:854-857.[Free Full Text]

63. Smith, E. D., B. A. Kudlow, R. L. Frock, and B. K. Kennedy. 2005. A-type nuclear lamins, progerias and other degenerative disorders. Mech. Ageing Dev. 126:447-460.[CrossRef][Medline]

64. Stirdivant, S. M., H. E. Huber, D. R. Patrick, D. Defeo-Jones, E. M. McAvoy, V. M. Garsky, A. Oliff, and D. C. Heimbrook. 1992. Human papillomavirus type 16 E7 protein inhibits DNA binding by the retinoblastoma gene product. Mol. Cell. Biol. 12:1905-1914.[Abstract/Free Full Text]

65. Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, C. L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147:913-920.[Abstract/Free Full Text]

66. Templeton, D. J. 1992. Nuclear binding of purified retinoblastoma gene product is determined by cell cycle regulated phosphorylation. Mol. Cell. Biol. 12:435-443.[Abstract/Free Full Text]

67. Templeton, D. J., S. H. Park, L. Lanier, and R. A. Weinberg. 1991. Nonfunctional mutants of the retinoblastoma protein are characterized by defects in phosphorylation, viral oncoprotein association, and nuclear tethering. Proc. Natl. Acad. Sci. USA 88:3033-3037.[Abstract/Free Full Text]

68. Toth, J. I., S. H. Yang, X. Qiao, A. P. Beigneux, M. H. Gelb, C. L. Moulson, J. H. Miner, S. G. Young, and L. G. Fong. 2005. Blocking protein farnesyltransferase improves nuclear shape in fibroblasts from humans with progeroid syndromes. Proc. Natl. Acad. Sci. USA 102:12873-12878.[Abstract/Free Full Text]

69. Van Berlo, J. H., J. W. Voncken, N. Kubben, J. L. Broers, R. Duisters, R. E. van Leeuwen, H. J. Crijns, F. C. Ramaekers, C. J. Hutchison, and Y. M. Pinto. 2005. A-type lamins are essential for TGF-ß1 induced PP2A to dephosphorylate transcription factors. Hum. Mol. Genet. 14:2839-2849.