![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3800, Australia,1 Gene and Stem Cell Therapy Program, Centenary Institute of Cancer Medicine and Cell Biology, University of Sydney, Newtown 2042, Australia,2 Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201,3 Joint Proteomics Research Laboratory, The Ludwig Institute for Cancer Research, Royal Melbourne Hospital, Parkville, Victoria 3050, Australia,4 Cell and Molecular Therapies, Sydney Cancer Centre, Royal Prince Alfred Hospital, Camperdown, New South Wales 2050, Australia5
Received 5 February 2006/ Returned for modification 8 March 2006/ Accepted 11 May 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, the insulin-stimulated generation of PtdIns(3)P at the PM has been demonstrated in adipocytes (41). Intracellular delivery of exogenous carrier-linked-PtdIns(3)P into adipocytes, in the absence of insulin stimulation, promotes the movement of GLUT4-containing vesicles to the PM, but not glucose transport, in insulin-responsive cells (41). Furthermore, studies using exogenously added carrier linked-PtdIns(3,4,5)P3 versus PtdIns(3)P suggests that PtdIns(3,4,5)P3 and PtdIns(3)P are required for distinct steps in the pathway of GLUT4 fusion and insertion into the PM (27). This model predicts PtdIns(3,4,5)P3 facilitates GLUT4 translocation and insertion into the PM, whereas exogenously added PtdIns(3)P stimulates translocation and unmasking of the C-terminal domain of GLUT4 but not insertion. However, recently it has been shown that in the absence of Munc18, exogenously added PtdIns(3)P can promote GLUT4 insertion into the PM (30). All of these studies by necessity were undertaken using exogenously added carrier-linked-phosphoinositides, which may not precisely reflect the activities of the endogenous lipids. In addition, whether these carrier-linked phosphoinositides localize to the same compartment as insulin-stimulated phosphoinositides has not been addressed. Delineation of the discrete roles of the endogenous PtdIns(3)P in intact adipocytes has not been possible given insulin stimulates the concomitant synthesis of both PtdIns(3,4,5)P3 and PtdIns(3)P (27).
The inositol polyphosphate 5-phosphatases (5-phosphatases)hydrolyze PtdIns(3,4,5)P3 and/or PtdIns(4,5)P2 forming PtdIns(3,4)P2 and PtdIns (4)P, respectively (42). The 5-phosphatases SHIP2 and SKIP, by hydrolyzing PtdIns(3,4,5)P3, are implicated in negatively regulating insulin-stimulated GLUT4 trafficking (17, 26). We and others have cloned and characterized a 72-kDa 5-phosphatase (72-5ptase) (mouse), also called pharbin (rat), or the type IV 5-phosphatase (human) (4, 37, 38) that share 74% amino acid sequence identity. This 72-5ptase contains an N-terminal proline-rich region, a central 5-phosphatase catalytic domain, and a C-terminal CAAX motif. In the study presented here we demonstrate the 72-5ptase hydrolyzes PtdIns(3,5)P2, generating PtdIns(3)P, and its overexpression in adipocytes generates PtdIns(3)P at the PM of unstimulated 3T3-L1 adipocytes. Therefore, ectopic overexpression of this enzyme was used in adipocytes as an experimental tool to generate PtdIns(3)P, in the absence of PtdIns(3,4,5)P3, to dissect the functional role of endogenous PtdIns(3)P in regulating GLUT4 trafficking and insertion into the PM. In the absence of insulin stimulation and PtdIns(3,4,5)P3 generation, the wild-type 72-5ptase, but not catalytically inactive 5-phosphatase, stimulated GLUT4 translocation and insertion into the PM, an effect blocked upon sequestration of PtdIns(3)P and/or actin monomers. Therefore, endogenous PtdIns(3)P can promote GLUT4 PM translocation and insertion under conditions of actin remodeling.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture and differentiation of 3T3-L1 preadipocytes. 3T3-L1 fibroblasts were cultured in Dulbecco modified Eagle medium (DMEM) (Gibco-BRL) containing 4.5 mg of glucose/ml and 10% fetal bovine serum (FBS) (CSL). Confluent 3T3-L1 preadipocytes were differentiated with DMEM containing 10% FBS, 4 µg of insulin/ml, 500 µM isobutyl 1-methylxanthine (IBMX), and 250 nM dexamethasone. Growth media was replaced with DMEM plus 10% FBS 4 days after the addition of differentiation media and incubated for a further 4 days.
Northern blot analysis. Poly(A) RNA from undifferentiated 3T3-L1 preadipocytes and differentiated adipocytes was size fractionated in an agarose gel and transferred to nitrocellulose. The membrane was incubated with a 32P-labeled 2.0-kb 72-5ptase cDNA. The membrane was subsequently probed for GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Hybridization and washing conditions were as previously described (38).
Detection of 72-5ptase in 3T3-L1 adipocytes by immunoblot analysis. Detergent-soluble and -insoluble cellular fractions for immunoblotting with 72-5ptase-specific antibodies were prepared by harvesting adipocytes in cold lysis buffer (50 mM Tris [pH 7], 450 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate supplemented with Complete Mini [with EDTA] protease inhibitor cocktail tablets [Roche]), followed by centrifugation (13,000 x g, 10 min, 4°C). Cytosolic fractions were prepared after homogenization in HES buffer (255 mM sucrose, 1 mM EDTA, 20 mM HEPES [pH 7.2]) and centrifugation at 100,000 x g for 60 min at 4°C. Immunoblots were developed by using enhanced chemiluminescence (NEN).
Generation of catalytic inactive 72-D480N5ptase mutant. Sequential PCR-based site-directed mutagenesis was carried out to generate a catalytically inactive mutant of the 72-5ptase in which a catalytic Asp residue was substituted with Asn. cDNA sequences flanking the site to be mutated were amplified using the primers GCTCTAGAATGCCATCCAAGTCAGCT and CTGGTTTGGGAACTTCAACTTCCGC or CGTCTAGATCAGGACACGGTGCAAAC and GCGGAAGTTGAAGTTCCCAAACCAG (with nucleotide substitutions underlined). Purified PCR products were used as a template in a subsequent PCR using the end primers to amplify the full-length cDNA containing the desired mutation and XbaI sites at the ends. The resulting product was subcloned into pCR-Blunt and sequenced before ligation into the XbaI site of the pCGN expression vector.
Generation of FLAG-2xFYVE/Hrs construct. cDNA sequence coding for 2xFYVE/Hrs was amplified and ligated into the MluI site of pEFBOS vector in-frame with the N-terminal FLAG tag.
Transfection of 3T3-L1 adipocytes and indirect immunofluorescence. Adipocytes were transiently transfected 8 days after differentiation by electroporation as described previously (31). Electroporation cuvettes containing 107 cells and 50 µg of each plasmid DNA were pulsed at 0.17 kV and 975 µF. Cells were plated onto 0.01% poly-L-lysine-coated glass coverslips and incubated for 24 or 48 h. Cells on coverslips were washed twice with cold phosphate-buffered saline (PBS) supplemented with 1 mM CaCl2 and 0.5 mM MgCl2 and then fixed with 3% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 in PBS (5 min), incubated with blocking buffer (5% goat serum in PBS) (30 min), overlaid with primary antibody diluted in blocking buffer (1 h), washed, and incubated with secondary antibody-Alexa Fluor conjugate (Molecular Probes) diluted in blocking buffer (1 h). Coverslips were washed and mounted onto glass slides using Fluoromount-G mounting medium (Southern Biotech) and imaged by laser scanning confocal microscopy (Monash Micro Imaging Facility).
GLUT4 translocation assay. At 24 or 48 h after adipocyte cotransfection with GFP-GLUT4 (50 µg) and pCGN constructs (50 µg), cells were serum starved (2 h at 37°C), treated with 100 nM insulin (30 min, 37°C) fixed and stained with HA antibodies, and scored for PM GFP-GLUT4 by fluorescence microscopy. Pharmacological agents, including 100 nM wortmannin (45 min, 37°C) and brefeldin A (10 µg/ml, 30 min, 37°C) were used after serum starvation and prior to insulin stimulation.
Subcellular fractionation of transfected 3T3-L1 adipocytes. Cells cotransfected with GFP-GLUT4 and HA-vector or HA-72-5ptase were washed and homogenized in cold resuspension buffer (255 mM sucrose, 1 mM EDTA, 20 mM HEPES [pH 7.2], 2 µg of aprotinin/ml, 2 µg of leupeptin/ml, 1 mM phenylmethylsulfonyl fluoride, 3 µg of pepstatin A/ml) before differential centrifugation (49). A 25-µg portion of each fraction was subjected to immunoblot analysis using monoclonal GFP antibodies (Roche).
PM sheets. PM sheets were prepared by hypotonic swelling and sonication (54). Sheets were fixed in 3% paraformaldehyde for 20 min, incubated with quench buffer (70 mM KCl, 30 mM HEPES [pH 7.5], 5 mM MgCl2, 3 mM EGTA, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride) for 15 min, followed by blocking buffer (5% goat serum in PBS, 30 min), and labeled for indirect immunofluorescence.
Adenoviral constructs and transduction of 3T3-L1 adipocytes. HA-72-5ptase (GenBank accession no. AF226683) or HA-72-D480N5ptase cDNA were ligated into pAdTrack-CMV, which contains a cDNA encoding green fluorescent protein (GFP). Recombinant adenoviral plasmids were generated by homologous recombination with pAdEasy-1 in BJ5183 Escherichia coli according to the manufacturer's instructions (Stratagene) (23). PacI-linearized plasmids were transfected into HEK293T packaging cells, and lysates were collected. 3T3-L1 adipocytes in DMEM containing 2% FBS were transduced with adenovirus at a multiplicity of infection of 40 PFU/cell (16 h) and cultured for a further 24 h prior to analysis.
2-Deoxy-D-glucose (2-DOG) uptake assays. At 48 h after transduction with empty vector, HA-72-5ptase, or HA-72-D480N5ptase adenovirus, adipocytes were assayed for 2-deoxy-D-[2,6-3H]glucose uptake (49). Serum-starved cells were treated with or without 100 nM insulin in 125 mM NaCl, 5 mM KCl, 1.8 mM CaCl2, 2.6 mM MgSO4, 25 mM HEPES (pH 7.4) containing 2 mM Na pyruvate, and 1% (wt/vol) bovine serum albumin (10 min, 37°C) prior to the addition of 100 µM 2-[3H]DOG (7.5 µCi/ml, 20 min, 37°C; Amersham). Cells were washed, and scintillation was counted for 3H and assayed in replicates of four per experiment.
PtdIns(3,4,5)P3 and PtdIns(3,5)P2 5-phosphatase assays. PtdIns(3,4,5)P3 and PtdIns(3,5)P2 5-phosphatase assays were performed as previously described (38). 3T3-L1 adipocytes expressing HA-vector, HA-72-5ptase, or HA-72-D480N5ptase were immunoprecipitated with HA antibody and immunoprecipitates washed twice with lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1% NP-40, 0.5% Na deoxycholate), twice in assay buffer (20 mM HEPES [pH 7.5], 5 mM MgCl2, 1 mM EGTA), and assayed for 5-phosphatase activity as described previously (38).
Transferrin uptake. Untransfected adipocytes were serum starved and incubated with serum-free DMEM containing Texas Red-transferrin conjugate (Molecular Probes) at 20 µg/ml for 20 min at 37°C prior to fixation for indirect immunofluorescence. For transferrin uptake in transfected adipocytes, serum-starved cells were cooled (16°C, 20 min) and incubated with serum-free DMEM containing Texas Red-transferrin (20 µg/ml, 1 h, 16°C) and washed once with cold acid wash buffer (150 mM NaCl, 1 mM CaCl2, 20 mM Na acetate [pH 4.6]), followed by a PBS wash. Cells were incubated with chase medium containing holotransferrin (200 µg/ml, 5 min, 37°C) before fixation for indirect immunofluorescence (63, 83).
Image analysis. Analysis was performed using the public domain Image J program (version 1.34 NIH) (1). The fluorescence intensity was measured in cells as the average pixel fluorescence intensity within an area of defined size drawn over three distinct areas of the plasma membrane (5 x 10 pixels) or the average of three boxes in the cytosol (10 x 10 pixels). Ratios of plasma membrane to cytosolic pixel fluorescence intensity were determined and subjected to statistical analysis.
Statistical analysis. Statistical analyses of cell counts and fluorescence intensity measurements were all performed using unpaired Student t Test.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
The 72-5ptase regulates insulin-stimulated PtdIns(3,4,5)P3 levels. PtdIns(3,4,5)P3 is a critical signaling molecule facilitating GLUT4 exocytosis to the PM (11, 61). Previous studies have demonstrated the 72-5ptase shows the greatest catalytic activity toward PtdIns(3,4,5)P3 of any 5-phosphatase (37). We generated a catalytically inactive 72-5ptase that contains a point mutation of a critical catalytic aspartic acid residue (HA-72-D480N5ptase), based on the active site identified by crystallization studies of an archetypal 5-phosphatase (74). To demonstrate the wild-type HA-72-5ptase, but not HA-72-D480N5ptase, hydrolyzed the 5-position phosphate from PtdIns(3,4,5)P3, lysates derived from cells transiently transfected with these constructs were immunoprecipitated and PtdIns(32P-3,4,5)P3 5-phosphatase assays performed as described previously (38). Wild-type HA-72-5ptase, but not HA-72-D480N5ptase, hydrolyzed PtdIns(32P-3,4,5)P3 forming PtdIns(32P-3,4)P2 (Fig. 2A). Immunoblot analysis of parallel immunoprecipitates indicated equivalent immunoreactive levels of wild-type HA-72-5ptase and inactive HA-72-D480N5ptase (Fig. 2A, lower panel). To evaluate insulin-stimulated PtdIns(3,4,5)P3 accumulation at the PM in adipocytes expressing the 72-5ptase, we used the pleckstrin homology (PH) domain of the Arf-nucleotide binding site opener (ARNO) fused to GFP, which has been used extensively as a marker of PM PtdIns(3,4,5)P3 (6). In nonstimulated cells, cotransfected with HA-vector and GFP-PH/ARNO, GFP-PH/ARNO PM fluorescence was not detected, a finding consistent with many studies reporting that this phosphoinositide is undetectable in quiescent cells (Fig. 2B) (6, 18, 43, 77). Upon insulin treatment, GFP-PH/ARNO translocated rapidly to the PM in >85% of cells (200 cells scored for three transfections), maximally 2 to 5 min after stimulation. In contrast, <20% of the cells expressing the 72-5ptase demonstrated PtdIns(3,4,5)P3 at the PM after insulin stimulation or in unstimulated cells (200 cells scored for three transfections) (not shown). Adipocytes expressing the catalytically inactive 72-5ptase demonstrated GFP-PH/ARNO PM fluorescence similar to vector-transfected cells (Fig. 2B). In individual cells expressing GFP-PH/ARNO, we determined the ratio of PM to cytosolic GFP-PH/ARNO fluorescence as described previously (45). By this analysis after insulin stimulation a 1.6-fold increase in this ratio was noted in insulin-stimulated vector-expressing adipocytes at 2 and 5 min of stimulation, which was reduced significantly in cells expressing the wild type but not the inactive 72-5ptase (Fig. 2C). In unstimulated cells the GFP-PH/ARNO PM/cytosolic fluorescence ratio was similar for all constructs. Thus, the 72-5ptase hydrolyzes PtdIns(3,4,5)P3 at the PM in insulin-stimulated adipocytes. To further evaluate the regulation of the PI3-kinase-dependent signaling pathway, phosphorylation of Akt at Ser473 was assessed by using phosphorylation-specific antibodies; however, no change in the ratio of insulin-stimulated pSer473Akt to total Akt protein was noted upon the overexpression of the wild type versus the empty vector or inactive 72-5ptase (Fig. 2D). The failure of the 72-5ptase to regulate Akt Ser473 phosphorylation in 3T3-L1 adipocytes, in contrast to studies in fibroblasts (36), may relate to the observation that this enzyme only reduced PM PtdIns(3,4,5)P3 levels by ca. 50% in insulin-stimulated cells, perhaps as a consequence of its perinuclear localization in adipocytes.
|
Immunoprecipitated HA-72-5ptase, but not inactive HA-72-D480N5ptase, from adipocyte lysates, hydrolyzed PtdIns(32P-3,5)P2, forming PtdIns(32P-3)P (Fig. 3A). To detect in vivo PtdIns(3)P production, the FYVE domain of early endosomal antigen 1 (EEA1) fused to GFP (6), was coexpressed with the 72-5ptase. In quiescent adipocytes cotransfected with vector, GFP-FYVE/EEA1 was restricted to discrete vesicles, a finding consistent with PtdIns(3)P on early endosomes (Fig. 3B). After insulin stimulation, in cells coexpressing vector and GFP-FYVE/EEA1, PM fluorescence was detected, indicating PtdIns(3)P production at this site as previously reported using the biosensor GFP-2xFYVE/Hrs (41). Notably, in unstimulated cells expressing HA-72-5ptase GFP-FYVE/EEA1 was detected at the PM, as well as decorating cytosolic vesicles (Fig. 3B, see arrows) and after insulin stimulation no change in the distribution of this phosphoinositide biosensor was detected. GFP-FYVE/EEA1 distribution in cells expressing the inactive 72-5ptase resembled that detected in vector-expressing cells. PM GFP-FYVE/EEA1 fluorescence was quantified relative to that detected in the cytosol (excluding vesicular staining) in transfected adipocytes. By this analysis in nonstimulated adipocytes, expression of the wild-type 72-5ptase resulted in a >2.5-fold increase in PM/cytosol GFP-FYVE/EEA1 fluorescence that was significantly greater than that detected in insulin-stimulated vector-expressing cells, which demonstrated a 1.5-fold increase in this ratio relative to nonstimulated cells (Fig. 3C).
|
To evaluate the specificity of GFP-FYVE/EEA1-PtdIns(3)P binding, adipocytes were treated with wortmannin (100 nM), which inhibits class III PI3-kinase Vps34-mediated generation of PtdIns(3)P on early endosomes, resulting in endosomal dilation and partial or complete displacement of EEA1 from endosomes depending on the cell type (28, 67). Insulin-dependent PM PtdIns(3)P production is resistant to such wortmannin treatment (41). In unstimulated and insulin-treated vector-, 72-5ptase-, and 72-D480N5ptase-containing adipocytes, GFP-FYVE/EEA1 labeling of vesicles was decreased upon wortmannin treatment, correlating with enhanced cytosolic GFP fluorescence, a finding consistent with the loss of PtdIns(3)P on endosomes (Fig. 3B). However, in the presence of wortmannin, GFP-FYVE/EEA1 PM fluorescence was still evident in unstimulated HA-72-5ptase-expressing cells and after insulin stimulation GFP-FYVE/EEA1 PM fluorescence persisted despite wortmannin treatment regardless of the construct expressed. These studies indicate that the wild type, but not inactive 72-5ptase, generates PtdIns(3)P at the PM in nonstimulated adipocytes.
The 5-phosphatase domain of the Lowe's protein (OCRL) has been shown by using in vitro purified component enzyme assays to hydrolyze PtdIns(3,5)P2, forming PtdIns(3)P, and the isolated SHIP-2 catalytic domain has also been demonstrated to hydrolyze PtdIns(3,5)P2 in vitro. However, to our knowledge this has not been examined in intact cells (12, 59). We evaluated whether OCRL, SHIP-2, or SKIP, a 5-phosphatase that also functions in adipocytes, could generate PtdIns(3)P at the plasma membrane of unstimulated adipocytes. To this end, adipocytes were transfected with constructs encoding these 5-phosphatases, and the distribution of GFP-2xFVVE/Hrs (Fig. 3E), or GFP-FYVE/EEA1 (Fig. 3F) was examined in unstimulated adipocytes. Only the 72-5-ptase stimulated the association of both PtdIns(3)P-binding biosensors with the plasma membrane. Occasionally, in less than 20% of cells expressing OCRL, we noted faint plasma membrane localization of GFP-FYVE/EEA1, but this was never detected using GFP-2xFYVE/Hrs.
The 72-5ptase hydrolyzes PtdIns(4,5)P2.
PtdIns(4,5)P2 regulates
GLUT4 endocytosis from the PM and exocytosis from intracellular sites,
via the regulation of actin dynamics
(31). Since
PtdIns(4,5)P2 is a predicted 72-5ptase substrate
(4,
37), the effect of
phosphatase expression on PtdIns(4,5)P2 levels was
determined in intact adipocytes. The GFP-tagged pleckstrin homology
(PH) domain of phospholipase C
(GFP-PH/PLC) acts as a
sensitive in vivo marker of PM PtdIns(4,5)P2
(6). To enhance the
visualization of GFP-PH/PLC in adipocytes, we imaged through
the cell center and at the base. In vector- and
HA-72-D480N5ptase-containing 3T3-L1 adipocytes, GFP-PH/PLC was
expressed exclusively at the PM (Fig.
4A). At the cell base, which reflects the PM adherent to the substratum,
GFP-PH/PLC was accentuated in tubulo-vesicle-like structures
as described previously
(9,
46).
Adipocytes overexpressing HA-72-5ptase showed faint cytosolic and
nuclear GFP-PH/PLC staining. At 46 kDa, the
GFP-PH/PLC fusion protein can passively diffuse between the
cytosol and nucleus, if not bound to PM PtdIns(4,5)P2
(6). The
GFP-PH/PLC fluorescence intensity at the cell base was
decreased upon expression of HA-72-5ptase, indicating decreased PM
PtdIns(4,5)P2. To quantitate the PtdIns(4,5)P2
plasma membrane levels, the ratio of GFP-PH/PLC plasma
membrane/cytosol fluorescence was examined in individual cells as
described previously (45)
(Fig. 4B). By this
analysis, a >40% reduction in plasma membrane
GFP-PH/PLC fluorescence was noted relative to the cytosolic
fluorescence, in cells expressing the 72-5ptase consistent with the
contention that ectopic expression of the 72-5ptase results in
PtdIns(4,5)P2 hydrolysis in intact
adipocytes.
|
|
activity is stimulated
by insulin but is wortmannin insensitive
(10,
14,
70,
76). This latter
PI3-kinase synthesizes both PtdIns(3)P and PtdIns(3,4)P2,
and the PtdIns(3)P pool generated by this kinase may serve as a
substrate for PIKfyve to generate PtdIns(3,5)P2. To
determine whether 72-5ptase-stimulated PtdIns(3)P production, and
thereby GLUT4 translocation, was in the same pathway as
insulin-stimulated PtdIns(3)P production, adipocytes were treated with
wortmannin, which inhibited insulin-stimulated GLUT4 translocation in
cells expressing empty vector or inactive 72-D480N5ptase (Fig.
5C) but had no effect on
GLUT4 translocation in cells expressing 72-5ptase under resting or
insulin-stimulated conditions. We also characterized GLUT4 translocation under conditions of low-dose insulin stimulation, revealing an insulin dose-dependent increase in GFP-GLUT4 PM rim fluorescence in empty vector- or inactive HA-72-D480N5ptase-expressing adipocytes. In contrast, upon 72-5ptase overexpression, >60% of cells showed PM GFP-GLUT4 in both unstimulated cells and at all of the insulin concentrations tested (Fig. 5D). To further verify that the 72-5ptase promotes insulin-independent GLUT4 translocation, we analyzed the distribution of GFP-GLUT4 in adipocyte subcellular fractions. In unstimulated cells coexpressing GFP-GLUT4 and HA-vector, GFP-GLUT4 was detected faintly in the PM fraction and intensely in the low-density microsome fraction (Fig. 5E). After insulin treatment the level of GFP-GLUT4 was increased in the PM fraction and reduced in the LDM fraction with no change in the high-density microsome fraction. However, in HA-72-5ptase-expressing adipocytes, GFP-GLUT4 was detected in equal amounts in the PM fraction of unstimulated and insulin-stimulated cells, a finding consistent with the contention that the 72-5ptase promotes insulin-independent GLUT4 translocation. The effect of the 72-5ptase on GLUT4 translocation in the nonstimulated adipocyte was not a general property of all 5-ptases. Expression of the Lowe's protein (OCRL), a PtdIns(4,5)P2 specific 5-ptase (82); SKIP, which hydrolyzes PtdIns(4,5)P2 and PtdIns(3,4,5)P3 (25); or SHIP-2, which hydrolyzes PtdIns(3,4,5)P3 (48) did not promote GLUT4 trafficking in nonstimulated adipocytes (not shown). After insulin stimulation, both SKIP and SHIP-2 inhibited insulin-stimulated GLUT4 translocation, as previously reported (26, 78), whereas the expression of the Lowe's protein had no effect on insulin-stimulated GLUT4 translocation (not shown).
To determine whether the
72-5ptase-induced GLUT4 translocation was a consequence of PtdIns(3)P
production, we coexpressed FLAG-2xFYVE/Hrs at high levels with
GFP-GLUT4 and analyzed cotransfected cells for GLUT4 translocation in
the absence of insulin stimulation. Overexpression of 2xFYVE/Hrs at
high levels binds and sequesters PtdIns(3)P
(21). Cells were scored
for high expression of FLAG-2xFYVE/Hrs and/or 72-5ptase. When both
2xFYVE/Hrs and the 72-5ptase constructs were expressed at high levels,
a 40% reduction in the number of cells demonstrating GLUT4
translocation to the PM was noted, relative to cells expressing the
72-5ptase alone. In addition, at moderate levels expression of the
72-5ptase, a >80% reduction in the number of adipocytes
demonstrating GLUT4 PM translocation in unstimulated cells was detected
upon coexpression of 2xFYVE/Hrs (Fig.
5F). Moderate expression
of the 72-5ptase alone promoted GLUT4 translocation in the majority of
adipocytes, similar to high-level overexpression. In control studies
the overexpression of GFP-PH/PLC had no effect (see below). These
studies suggest that the overexpression of the 72-5ptase induces GLUT4
trafficking via PM PtdIns(3)P production.
The specificity of the effects of the 72-5ptase on GLUT4 trafficking were determined by analysis of GLUT1 trafficking. Both endogenous and transfected HA-GLUT1 (not shown) demonstrated similar localization in empty-vector-, wild-type 5ptase-, or inactive-5ptase-expressing cells, both in unstimulated and insulin-stimulated adipocytes (Fig. 5G).
Overexpression of the 72-5ptase promotes insertion of GLUT4 into the PM. To examine the effects of 72-5ptase expression on endogenous GLUT4 distribution, the localization of GLUT4-containing vesicles in contact with the PM was determined by indirect immunofluorescence on isolated PM sheets. Recently, it has been proposed that the C-terminal antigenicity of endogenous or recombinant GLUT4 may be unmasked by insulin treatment, by removing bound proteins (27). These studies demonstrated that the delivery of exogenous PtdIns(3,4,5)P3 failed to be associated with a significant gain in C-terminal GLUT4 antibody immunoreactivity, while delivery of exogenous PtdIns(3)P results in detection of the C terminus of GLUT4 in isolated membrane sheets. To investigate whether in unstimulated adipocytes expression of the 72-5ptase resulted in the unmasking of the C-terminal epitope of GLUT4 at the PM, adipocytes were cotransfected with wild-type 72-5ptase and FLAG-Ras (a PM marker), and isolated PM sheets were examined for immunoreactivity for both FLAG and endogenous GLUT4. The GLUT4 antibody utilized for these studies recognizes only the C-terminal domain of the protein (amino acids 498 to 510) and therefore will only detect endogenous GLUT4 which has arrived but is not necessarily inserted into the PM. Only 5 to 8% of HA-vector- or inactive HA-72-D480N5ptase-transfected quiescent adipocytes (Fig. 6A and B) demonstrated GLUT4 immunoreactivity in isolated PM sheets, in contrast to 25% of PM sheets expressing HA-72-5ptase. Upon insulin stimulation, 25 to 30% of the PM sheets from vector- or inactive HA-72-D480N5ptase-expressing adipocytes demonstrated GLUT4 immunoreactivity (Fig. 6A and B).
|
To exclude the possibility that the
hydrolysis of PtdIns(4,5)P2 by the 72-5ptase may contribute
to GLUT4 translocation and/or insertion, we undertook two distinct
approaches. First, we coexpressed exofacially tagged Myc-GLUT4-GFP with
the wild-type 5-ptase and added exogenous carrier-labeled
PtdIns(4,5)P2 as described previously
(41). However, this did
not inhibit or enhance 72-5ptase-stimulated GLUT4 translocation and/or
insertion (results not shown). In addition, in an alternative approach,
we coexpressed PH/PLC at high levels as described previously
(24) to sequester
PtdIns(4,5)P2. In cells overexpressing the wild-type
72-5ptase, however, this did not affect 72-5ptase-stimulated GLUT4
insertion into the plasma membrane, although as reported, evidence of
PtdIns(4,5)P2 sequestration was shown by the inhibition of endocytosis
(not shown). Collectively, this analysis is consistent with the
contention that the formation of endogenous PtdIns(3)P at the plasma
membrane contributes to both GLUT4 translocation and
insertion.
Since 72-5ptase overexpression promoted the translocation, tethering, and PM insertion of GLUT4, we determined its effect on 2-deoxyglucose uptake in adipocytes transduced with adenovirus expressing this enzyme (Fig. 6E and F). In unstimulated cells expressing 72-5ptase, the 2-deoxyglucose uptake was similar to vector-expressing cells. After insulin stimulation, glucose uptake was equally stimulated (four- to fivefold) in cells expressing vector, 72-5ptase, or inactive 72-D480N5ptase (Fig. 6F), revealing that, despite evidence that the 72-5ptase promotes GLUT4 translocation and insertion into the PM, glucose uptake was not increased. These results are consistent with other reports that suggest PtdIns(3)P alone cannot stimulate glucose uptake (41).
It has been proposed that insulin-stimulated PtdIns(3)P production at the PM, and thereby GLUT4 translocation, occurs downstream of TC10 activation (41). To investigate whether 72-5ptase-mediated production of PtdIns(3)P and/or GLUT4 translocation to the PM is dependent on TC10 activation, adipocytes were cotransfected with 72-5ptase and either constitutively active (Q75L) or inactive (T31N) TC10. However, expression of either active or inactive TC10 had no effect on 72-5ptase-stimulated GLUT4 recruitment to the PM or PtdIns(3)P production, indicating the enzyme acts independent of TC10 (not shown).
PtdIns(4,5)P2, PtdIns(3,4,5)P3, and TC10-dependent signaling pathways contribute to actin dynamics in adipocytes (56, 80). The role of plasma membrane PtdIns(3)P in the regulation of actin dynamics is unclear but in other cells, it may increase actin polymerization via recruitment of CKIP-1, although this has not been demonstrated in adipocytes (55). To determine the effect of 72-5ptase on actin rearrangement in adipocytes, cells were stained with phalloidin and cortical actin (imaging through cell center), and actin stress fibers (imaging at the cell base) were assessed (Fig. 7A). At the cell base, small patches of punctate actin were detected, which represented the adipocyte counterpart of stress fibers (32). Imaging through the center identified subcortical actin as a thin rim around the cell. In cells expressing HA-72-5ptase, punctate actin staining at the cell base was markedly reduced, suggesting decreased actin polymerization, most evident in cells in which 72-5ptase-expressing cells localized adjacent to nontransfected cells (Fig. 7A, see arrow). In 72-5ptase-expressing cells the decreased actin polymerization observed in adipocytes overexpressing the 5-ptase is most likely a consequence of decreased PtdIns(4,5)P2 and/or PtdIns(3,5)P2, rather than due to plasma membrane PtdIns(3)P which has been predicted in one study to bind and recruit CKIP-1 which promotes actin polymerization, although this has not been demonstrated in adipocytes (55). To investigate whether 72-5ptase-stimulated GLUT4 PM translocation was dependent on actin, adipocytes were treated with either cytochalasin D, which depolymerizes actin, or latrunculin A, which binds actin monomers (32, 44). Cytochalasin D inhibited insulin-stimulated GFP-GLUT4 PM rim fluorescence from 78 to 48% in vector-expressing cells (Fig. 7B) and decreased cortical actin staining (not shown). Similar treatment inhibited GFP-GLUT4 PM trafficking in 72-5ptase-expressing cells, although to a lesser extent (65 to 55%). Latrunculin A disrupts actin filaments in adipocytes more effectively than cytochalasin D, correlating with the inhibition of GLUT4 translocation and glucose transport (44). Latrunculin A treatment significantly inhibited unstimulated and insulin-stimulated GFP-GLUT4 PM rim fluorescence (70 to 28%) in cells expressing the 72-5ptase. These studies reveal that 72-5ptase-stimulated GLUT4 translocation is facilitated by the regulation of actin dynamics.
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Insulin stimulation results in PtdIns(3)P production at the PM. Evidence to support the contention that this phosphoinositide promotes GLUT4 trafficking has been shown by the temporal correlation of its insulin-stimulated accumulation at the PM with GLUT4 trafficking and with studies in which synthetic carrier-labeled PtdIns(3)P delivery into nonstimulated adipocytes promotes GLUT4 translocation (27, 41). However, it has been proposed that PtdIns(3)P, unlike PtdIns(3,4,5)P3, does not promote GLUT4 insertion; rather, it mediates the C-terminal unmasking of the GLUT4 at the PM (27). The results from the studies shown here demonstrate endogenous PtdIns(3)P production at the PM, in the absence of insulin stimulation, can promote both the translocation and the insertion of GLUT4 at the PM. Insertion of GLUT4 was demonstrated using exofacially tagged GLUT4 constructs, analogous to the recently reported studies using exogenously added carrier-linked PtdIns(3)P (27), which did not promote GLUT4 insertion. The reason for these apparently discrepant results may relate to the failure of correct targeting of exogenous lipids to the PM and/or that the turnover of the exogenous lipids may differ from that of the endogenous phosphoinositides. In addition, the levels of the exogenously added carrier-linked lipids such as PtdIns(3)P may not reach that of the endogenous lipids at the PM. In this regard, it is noteworthy that we demonstrated that the levels of PtdIns(3)P at the PM of 72-5ptase-expressing cells were significantly higher than those detected in empty vector-transfected insulin-stimulated cells. Interestingly, a recent model by Klip and coworkers proposed that remodeled actin sites may function to position GLUT4 near fusion sites on the PM (16, 47). In this regard it is of interest that we noted in 72-5ptase expressing cells significantly decreased polymerized actin. Furthermore, latrunculin A treatment inhibited 72-5ptase induced GLUT4 translocation. Therefore, it is possible that plasma membrane PtdIns(3)P, in the context of decreased submembraneous actin, facilitates GLUT4 translocation and insertion. Recently, it has been demonstrated that exogenous PtdIns(3)P can induce GLUT4 PM insertion in Munc18c–/– adipocytes. This study proposes that perhaps insulin-induced synthesis of PtdIns(3)P may be sufficient to induce GLUT4 translocation and insertion into the PM (30). Collectively, these studies imply that plasma membrane PtdIns(3)P may have the capacity to promote GLUT4 insertion under specific cellular contexts in nonstimulated cells, in which the normal cellular constraints which inhibit GLUT4 insertion, such as submembraneous actin and/or Munc18 are absent.
Enhanced glucose uptake was not exhibited in 72-5ptase-expressing cells, despite evidence of GLUT4 translocation, tethering, and insertion into the PM. These results are consistent with other studies indicating that glucose uptake requires both localization and increased intrinsic activity of GLUT4, which involves the activation of signaling pathways in addition to those generated by PtdIns(3)P and/or PtdIns(3,4,5)P3 (20, 41, 71).
An emerging role for PtdIns(3,4,5)P3, PtdIns(3,5)P2, and PtdIns(3)P in the regulation of insulin-stimulated GLUT4 translocation is established (8, 41, 66). However, to our knowledge the studies described here are the first to report insulin-independent endogenous PtdIns(3)P generation at the PM. We propose the effect of the 72-5ptase expression on GLUT4 trafficking in the unstimulated adipocytes was a consequence of the production of PtdIns(3)P at the PM, in the absence of PtdIns(3,4,5)P3. The following experimental findings supports this contention. First, we could detect no GFP-PH/ARNO, a PtdIns(3,4,5)P3-specific biosensor, at the PM of unstimulated cells and no evidence of phosphorylation of Akt at Ser473, indicating that in the unstimulated cell there was no activation of the class I PI3-kinase. Second, wortmannin treatment, which blocks class I PI 3-kinase activation and thereby PtdIns(3,4,5)P3 synthesis, did not inhibit either 72-5ptase-induced PM PtdIns(3)P accumulation or GLUT4 translocation. In unstimulated cells, overexpression of the wild type but not inactive 72-5ptase resulted in PM PtdIns(3)P accumulation, which correlated with GLUT4 translocation. Upon sequestration of PtdIns(3)P by overexpression of 2xFYVE/Hrs, 72-5ptase-stimulated GLUT4 translocation in unstimulated cells was significantly attenuated, a finding consistent with the contention that this was the molecular mechanism by which the 72-5ptase induced GLUT4 trafficking.
We propose that 72-5ptase hydrolysis of PtdIns(3,5)P2 produces PtdIns(3)P, since the 5-phosphatase hydrolyzes this phosphoinositide in vitro, forming PtdIns(3)P (38), and in intact cells overexpressing the 72-5ptase, PtdIns(3)P was generated at the PM, as shown by the recruitment of two distinct PtdIns(3)P biosensors to this site. Recent studies by our laboratory and others have highlighted that the lipid phosphatases may function as signal-terminating enzymes but can also generate functional pools of phosphoinositides at distinct subcellular sites (28, 64). PtdIns(3)P generation at the plasma membrane in cells overexpressing the 72-5ptase is most likely derived from 5-position phosphate dephosphorylation of PtdIns(3,5)P2 and/or PtdIns(3,4,5)P3 since 5-phosphatases exclusively dephosphorylate only the 5-position phosphate and hydrolysis of PtdIns(4,5)P2 would produce PtdIns(4)P (42, 74). PtdIns(3,4,5)P3, generated in response to agonist stimulation can be sequentially dephosphorylated by 5- and 4-phosphatases to form PtdIns(3)P, which is functional in the Rab5-regulated endocytic pathway (64). However, as shown here, PtdIns(3,4,5)P3 was not detected in unstimulated cells; therefore, PtdIns(3)P generated at the PM by the 72-5ptase must by exclusion be derived from the hydrolysis of PtdIns(3,5)P2.
Previous studies have not revealed the identity of the PI3-kinase responsible for insulin-stimulated PM PtdIns(3)P production. However, this is a wortmannin-resistant activity. Class II PI3-kinase enzyme activity is wortmannin resistant and is stimulated by insulin, and its principal substrate in vitro is PtdIns, generating PtdIns(3)P (10, 14). It is possible that this class II generated pool of PtdIns(3)P may be further phosphorylated by PIKfyve to generate PtdIns(3,5)P2, although this has yet to be shown. Interestingly, in unstimulated adipocytes significant levels of PtdIns(3,5)P2 can be detected (58, 65).
Although the PtdIns(3)P effectors on early endosomes have been identified, the effectors that are recruited and/or activated by PM-localized PtdIns(3)P in adipocytes remain to be identified. Interestingly, we found no evidence that 72-5ptase-generated PtdIns(3)P contributes to transferrin receptor endocytosis. In addition, GLUT4 trafficking to the PM in cells overexpressing the 72-5ptase was not regulated by expression of Rab5 mutants but was inhibited after the coexpression of dominant-negative Rab11. Recently, both Rab11 and Rab14 have been shown to be constitutively associated with GLUT4 vesicles (40). The precise physiological role of Rab11 in regulating GLUT4 trafficking remains to be fully delineated; however, Rab11 may promote GLUT4 trafficking from the Golgi/TGN to the PM, and/or targeting of GLUT4 into specialized endosomal compartments.
We have demonstrated here that overexpression of the 72-5ptase promotes GLUT4 translocation and insertion into the PM; however, we have no evidence yet that this 5-phosphatase is functionally significant in the insulin-stimulated GLUT4 translocation pathway in adipocytes. Rather, we have used the overexpression of this 5-phosphatase as an experimental tool to dissect the function of PtdIns(3)P at the PM in GLUT4 trafficking. In summary, we demonstrate here that the generation of PtdIns(3)P at the PM correlates with GLUT4 translocation and insertion into the plasma membrane.
|
ACKNOWLEDGMENTS |
|---|
We thank Cynthia Ng for outstanding technical assistance and David James, Jenny Stow, and Jennifer Dyson for advice and helpful discussions. We thank Judy Callaghan for 2xFYVE/Hrs cDNA, Xiang-Ming Zhang for the Rab11 plasmid, and Phil Majerus for the OCRL cDNA. GFP-VSV-G plasmid was a gift from Jennifer Lippincott-Schwartz. Imaging was performed at Monash Micro Imaging Facility.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Al-Hasani,
H., C. S. Hinck, and S. W. Cushman.1998
. Endocytosis of the glucose transporter GLUT4 is
mediated by the GTPase dynamin. J. Biol. Chem.
273:17504-17510.
3. Asano,
T., A. Kanda, H. Katagiri, M. Nawano, T. Ogihara, K. Inukai, M. Anai,
Y. Fukushima, Y. Yazaki, M. Kikuchi, R. Hooshmand-Rad, C. H.
Heldin, Y. Oka, and M. Funaki. 2000. p110beta is
up-regulated during differentiation of 3T3-L1 cells and contributes to
the highly insulin-responsive glucose transport activity.J. Biol. Chem.
275:17671-17676.
4. Asano, T., Y. Mochizuki, K. Matsumoto, T. Takenawa, and T. Endo.1999 . Pharbin, a novel inositol polyphosphate 5-phosphatase, induces dendritic appearances in fibroblasts.Biochem. Biophys. Res. Commun. 261:188-195.[CrossRef][Medline]
5. Backer, J. M. 2000. Phosphoinositide 3-kinases and the regulation of vesicular trafficking. Mol. Cell. Biol. Res. Commun. 3:193-204.[CrossRef][Medline]
6. Balla, T., T. Bondeva, and P. Varnai. 2000. How accurately can we image inositol lipids in living cells? Trends Pharmacol. Sci. 21:238-241.[CrossRef][Medline]
7. Barbieri, M. A., G. Li, L. S. Mayorga, and P. D. Stahl. 1996. Characterization of Rab5:Q79L-stimulated endosome fusion. Arch. Biochem. Biophys. 326:64-72.[CrossRef][Medline]
8. Berwick,
D. C., G. C. Dell, G. I. Welsh,
K. J. Heesom, I. Hers, L. M. Fletcher, F.
T. Cooke, and J. M. Tavare. 2004. Protein
kinase B phosphorylation of PIKfyve regulates the trafficking of GLUT4
vesicles. J. Cell Sci.
117:5985-5993.
9. Brown,
F. D., A. L. Rozelle, H. L. Yin, T.
Balla, and J. G. Donaldson. 2001.
Phosphatidylinositol 4,5-bisphosphate and Arf6-regulated membrane
traffic. J. Cell Biol.
154:1007-1017.
10. Brown,
R. A., J. Domin, A. Arcaro, M. D. Waterfield, and
P. R. Shepherd. 1999. Insulin activates the
alpha isoform of class II phosphoinositide 3-kinase.J. Biol. Chem.
274:14529-14532.
11. Bryant, N. J., R. Govers, and D. E. James.2002 . Regulated transport of the glucose transporter GLUT4. Nat. Rev. Mol. Cell. Biol. 3:267-277.[CrossRef][Medline]
12. Chi,
Y., B. Zhou, W. Q. Wang, S. K. Chung, Y.
U. Kwon, Y. H. Ahn, Y. T. Chang, Y. Tsujishita,
J. H. Hurley, and Z. Y. Zhang.2004
. Comparative mechanistic and substrate specificity
study of inositol polyphosphate 5-phosphatase Schizosaccharomyces
pombe Synaptojanin and SHIP2. J. Biol.
Chem.
279:44987-44995.
13. Clarke, J. F., P. W. Young, K. Yonezawa, M. Kasuga, and G. D. Holman. 1994. Inhibition of the translocation of GLUT1 and GLUT4 in 3T3-L1 cells by the phosphatidylinositol 3-kinase inhibitor, wortmannin. Biochem. J. 300:631-635.[Medline]
14. Domin, J., F. Pages, S. Volinia, S. E. Rittenhouse, M. J. Zvelebil, R. C. Stein, and M. D. Waterfield.1997 . Cloning of a human phosphoinositide 3-kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem. J. 326:139-147.[Medline]
15. Donaldson, J. G., D. Finazzi, and R. D. Klausner.1992 . Brefeldin A inhibits Golgi membrane-catalyzed exchange of guanine nucleotide onto ARF protein. Nature 360:350-352.[CrossRef][Medline]
16. Dugani, C. B., and A. Klip. 2005. Glucose transporter 4: cycling, compartments and controversies. EMBO Rep. 6:1137-1142.[CrossRef][Medline]
