Previous Article | Next Article ![]()
Molecular and Cellular Biology, August 2006, p. 6105-6116, Vol. 26, No. 16
0270-7306/06/$08.00+0 doi:10.1128/MCB.02429-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Shingo Maeda,1,
Tomomi Gotoh,3
Makoto Hayashi,1,4
Kenichi Shinomiya,2
Shogo Ehata,1
Riko Nishimura,5
Masataka Mori,3
Kikuo Onozaki,6
Hidetoshi Hayashi,6
Satoshi Uematsu,7
Shizuo Akira,7
Etsuro Ogata,8
Kohei Miyazono,1,9 and
Takeshi Imamura1*
Department of Biochemistry, The Cancer Institute of the Japanese Foundation for Cancer Research, Tokyo,1 Section of Orthopedic and Spinal Surgery, Department of Frontier Surgical Therapeutics, Division of Advanced Therapeutical Sciences, Graduate School, Tokyo Medical and Dental University, Tokyo,2 Department of Molecular Genetics, Graduate School of Medical Sciences, Kumamoto University, Kumamoto,3 Department of Biological Sciences, Graduate School of Bioscienceand Biotechnology, Tokyo Institute of Technology, Yokohama,4 Department of Biochemistry, Graduate School of Dentistry, Osaka University, Osaka,5 Department of Molecular Health Sciences, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya,6 Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Department of Host Defense, and The 21st Century COE, Combined Program on Microbiology and Immunology, Research Institute for Microbial Diseases, Osaka University, Osaka,7 Cancer Institute Hospital, Tokyo,8 Department of Molecular Pathology, Graduate School of Medicine, University of Tokyo, Tokyo, Japan9
Received 21 December 2005/ Returned for modification 20 February 2006/ Accepted 26 May 2006
|
|
|---|
) is expressed in bone as well as in
mesenchymal progenitors and primary osteoblasts. Overexpression of CHOP
reduces alkaline phosphatase activity in primary osteoblasts and
suppresses the formation of calcified bone nodules. CHOP-deficient
osteoblasts differentiate more strongly than their wild-type
counterparts, suggesting that endogenous CHOP plays an important role
in the inhibition of osteoblast differentiation. Furthermore,
endogenous CHOP induces differentiation of calvarial osteoblasts upon
bone morphogenetic protein (BMP) treatment. CHOP forms heterodimers
with C/EBPß and inhibits the DNA-binding activity as well as
Runx2-binding activity of C/EBPß, leading to inhibition of
osteocalcin gene transcription. These findings indicate that CHOP acts
as a dominant-negative inhibitor of C/EBPß and prevents
osteoblast differentiation but promotes BMP signaling in a
cell-type-dependent manner. Thus, endogenous CHOP may have dual roles
in regulating osteoblast differentiation and bone
formation. |
|
|---|
Recently, CCAAT/enhancer-binding
proteins (C/EBPs) have been reported to regulate differentiation of
mesenchymal progenitor cells into osteoblasts. C/EBPs, including
C/EBP
, ß,
,
,
, and C/EBP
homologous protein (CHOP; also known as C/EBP
), belong to the
leucine zipper family of transcription factors. C/EBP proteins contain
a highly conserved DNA-binding domain as well as a leucine dimerization
domain and can form homo- and/or heterodimers that bind to similar
sequence motifs (27).
Overexpression of C/EBPß in mesenchymal cells induces
expression of an adipocyte-specific nuclear receptor, peroxisome
proliferator-activated receptor
(PPAR
),followed by adipocyte differentiation in cooperation with
C/EBP
(30). Mice
deficient in C/EBPß exhibit reduced adipogenesis
(29). These findings
indicate that C/EBPß plays one of the
central roles in adipogenesis by operating complex gene expression
cascades governed by the PPAR
gene. While being indispensable
for adipogenesis, C/EBPß is also expressed in the osteoblastic
cell lineages and its expression is up-regulated during osteoblast
differentiation (1,
7,
10,
20,
24). C/EBPß and
C/EBP
regulate the osteocalcin gene promoter through physical
interaction with Runx2
(7). Recently, Hata et al.
demonstrated that C/EBPß and its isoform, liver-enriched
inhibitory protein (LIP), promote the differentiation of mesenchymal
cells into an osteoblastic lineage in cooperation with Runx2
(10). In contrast,
producing transgenic mice bone-targeted LIP exhibit evidence of
osteopenia secondary to reduced bone formation that is accompanied by
severely suppressed osteocalcin expression in bone
(9). These reports
strongly suggest that C/EBPs have a certain role in modifying the
function of Runx2. Moreover, it has been reported that overexpression
of C/EBPß stimulates the proliferation of a mouse osteoblastic
cell line, MC3T3-E1, but suppresses its osteoblast differentiation
(13). Collectively,
although it is clear that C/EBPs control osteoblast differentiation in
appropriate stages, it is unclear and controversial whether C/EBPs are
promotive or suppressive of osteogenesis. Since the C/EBP family
consists of multiple genes and isoforms, the universal inhibitor for
pan-C/EBP proteins should address these complex
problems.
CHOP, also known as C/EBP
, growth
arrest and DNA damage-inducible gene 153 (GADD153), and DNA damage
inducible transcript 3 (DDIT3), is a member of the C/EBP family and
plays a role in cell proliferation and differentiation
(2,
3,
22,
28). CHOP lacks the
ability to bind classical C/EBP-binding DNA elements, whereas it forms
heterodimers with other C/EBP family members and plays a role as a
dominant-negative inhibitor of C/EBPs
(28). Therefore, given
that CHOP is well expressed in bone, elucidation of its function during
osteoblast differentiation would be very helpful in clarifying the
roles of C/EBPs in osteogenesis. Pereira et al. demonstrated that CHOP
could promote the osteoblast differentiation of ST-2 stromal cells in
overexpression assays, since it formed heterodimers with C/EBP
and C/EBPß and sensitized the bone morphogenetic protein
(BMP)-Smad1/5/8 pathway
(23). However, how CHOP
enhanced BMP signaling remained unclear. Recent analyses of
CHOP-null mice revealed normal skeleton and normal bone
mineral density (25),
suggesting that there may be some factors to compensate for the
function of CHOP in vivo or that CHOP may act only in C/EBP-dependent
osteoblast differentiation. How CHOP acts on osteoblast differentiation
cell autonomously should be addressed in more detail.
To overcome the complexity inherent in studying the function of CHOP in osteoblast differentiation, we performed loss-of-function experiments by employing primary osteoblasts purified from calvaria of CHOP-null mice to investigate the cell-autonomous function of CHOP. In contrast to a previous study (23), our results showed that CHOP acts as a dominant-negative inhibitor of C/EBPß to inhibit osteoblast differentiation through blocking cooperation between C/EBPß and Runx2. However, endogenous CHOP exhibited opposite effects on osteoblasts upon BMP treatment. Our present findings indicate that C/EBPß and CHOP reciprocally regulate osteoblast differentiation. We also show that C/EBPß and CHOP reciprocally regulate adipocyte differentiation of mesenchymal progenitor cells.
|
|
|---|
minimum
essential medium containing 10% fetal bovine serum (FBS)
with 100 U/ml penicillin G and 100 µg/ml streptomycin and used
at the second passage. Differentiation of primary osteoblasts was
induced by 100 or 300 ng/ml recombinant human bone morphogenetic
protein 2 (rhBMP-2) provided by Astellas Pharma Inc., 50 µg/ml
ascorbic acid, and 5 mM ß-glycerophosphate in
medium. Primary fibroblasts were isolated as previously described (12). In brief, the skins from 2-, 3-, or 4-day-old neonatal mice were isolated and digested with 0.05% collagenase in 10% FBS-containing medium for 24 h at 4°C. The cells were then dispersed by vigorous pipetting, collected by centrifugation, and used as primary fibroblasts. The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Osteoblast and adipocyte differentiation of primary fibroblasts was induced by 100 or 300 ng/ml rhBMP-2 in medium unless otherwise indicated. The generation of CHOP/ mice was previously described (21).
Primary bone marrow cells (marrow stromal cells) were collected from long bones of 8-week-old mice. The cells were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. C2C12 cells (American Type Culture Collection) were maintained in DMEM containing 20% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Osteoblast differentiation of C2C12 cells was induced by 100 or 300 ng/ml rhBMP-2, in 5% FBS-containing medium. C3H10T1/2 cells (American Type Culture Collection) were maintained in Eagle's basal medium containing 10% FBS with 100 U/ml penicillin G, 100 µg/ml streptomycin, and 2 mM L-glutamine. ST-2 cells (RIKEN Cell Bank) were maintained in RPMI 1640 medium containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. 3T3-L1 cells (American Type Culture Collection) were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Adipogenic differentiation of 3T3-L1 cells was induced by adding 1 µM dexamethasone, 0.2 mM indomethacin, 0.01 mg/ml insulin, and 0.5 mM 3-isobutyl-1-methyl-xanthine (designated hereafter as DIII) to medium. COS7 cells were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin.
Plasmid construction. The plasmids pcDNA3.1-FLAG-CHOP and pcDNA3.1-Myc-CHOP were used as previously described (11). The plasmids pcDEF3-FLAG-Runx2 and pcDEF3-6xMyc-Runx2 were also used as previously described (8). The plasmids pcDNA3-FLAG-C/EBPß and pcDEF3-6xMyc-C/EBPß were generated by a PCR-based approach with the expression vector for C/EBPß (14) as the template and subcloned into pcDNA3-FLAG and pcDEF3-6xMyc. A total of 1.3 kb of the mouse osteocalcin promoter, which contains the OSE2 site (positions 137 to 131), was used as previously described (10).
Generation of adenoviruses. Generation of adenoviruses was performed using an adenovirus expression vector kit (TaKaRa). In brief, recombinant adenoviruses carrying FLAG-CHOP, FLAG-C/EBPß, or FLAG-Runx2 were constructed by homologous recombination between the expression cosmid cassette (pAxCAwt) and parental virus genome in 293 cells. The viruses exhibited no proliferative activity due to the lack of E1A-E1B (17). Titers of viruses were determined using an Adeno-X rapid titer kit (Clontech). Infection of C2C12 cells, primary osteoblasts, primary fibroblasts, and 3T3-L1 cells with recombinant adenoviruses was performed by incubation with adenoviruses at a multiplicity of infection (MOI) of 100 unless otherwise indicated.
ALP assays, von Kossa staining, and Nile red staining. Quantitative analysis of alkaline phosphatase (ALP) activity was performed as previously described (6) using Sigma Fast p-nitrophenylphosphate tablet sets (Sigma). All samples were quantified in triplicate. The protein concentration in each extract was measured by DC protein assay (Bio-Rad) using bovine serum albumin as a standard. Histochemical analysis of the ALP assay was performed using an ALP staining kit (#85L-3R; Sigma) according to the manufacturer's protocol. Calcium deposition was visualized by the von Kossa method as previously described (16). Cells were fixed in 3% glutaraldehyde in phosphate-buffered saline (PBS), washed with PBS, and rinsed with distilled water. Fixed cells were incubated with 2.5% silver nitrate during exposure to light for 60 min and then washed and developed with 0.5% hydroquinone for 2 min. Excess silver was washed out with 5% sodium thiosulfate for 2 min.
Adipogenic differentiation was examined by Nile red staining. Cells were fixed in 3% glutaraldehyde in PBS, washed with PBS, incubated with AdipoRed lipid assay reagent (CAMBREX) for 10 min, and then washed with PBS. Fluorescence was examined using an Olympus IX71 microscope.
Conventional RT-PCR and quantitative real-time RT-PCR.
Total RNA was extracted using TRIzol
reagent (Invitrogen). cDNA was synthesized with the SuperScript III
first-strand synthesis system (Invitrogen). Reverse transcription-PCR
(RT-PCR) was performed using a 2720 thermal cycler (Applied
Biosystems). The primer sequences used were as follows: for
HPRT1, forward,
5'-CATCACATTGTGGCCCTCTGT-3'; for
HPRT1, reverse,
5'-GGTCCTTTTCACAGCAAGCT-3'; for
C/EBP
, forward,
5'-AGCCAAGAAGTCGGTGGACAAG-3'; for
C/EBP
reverse,
5'-TAGAGATCCAGCGACCCGAAAC-3'; for
C/EBPß, forward,
5'-GGACTTGATGCAATCCGGA-3'; for
C/EBPß, reverse,
5'-GCTCGAAACGGAAAAGGTTC-3'; for
C/EBP
, forward,
5'-GGAAGAGACTGCGCATGCTTT-3'; for
C/EBP
, reverse,
5'-AGTTAGGCCAACTGTTCTCCGC-3'; for
CHOP, forward,
5'-GAAAGCAGAACCTGGTCCACGT-3'; and
for CHOP, reverse,
5'-ATGTGCGTGTGACCTCTGTTG-3'. PCR
products were loaded onto agarose gel and stained with ethidium
bromide.
Quantitative real-time RT-PCR was performed using SYBR
green PCR master mix (Applied Biosystems) and an ABI Prism 7000
sequence detection system (Applied Biosystems). All samples were run in
duplicate in each experiment. The specificity of detected signals was
confirmed by a dissociation curve consisting of a single peak. Values
were normalized by HPRT1. The primer sequences used were as
follows: for HPRT1, forward,
5'-CTGGTTAAGCAGTACAGCCCCA-3'; for
HPRT1, reverse,
5'-GGTCCTTTTCACCAGCAAGCT-3'; for
osteocalcin, forward,
5'-TAGCAGACACCATGAGGACCCT-3'; for
osteocalcin, reverse,
5'-TGGACATGAAGGCTTTGTCAGA-3'; for
Runx2, forward,
5'-AACCACAGAACCACAAGTGCG-3'; for
Runx2, reverse,
5'-AAATGACTCGGTTGGTCTCGG-3'; for
adipsin, forward,
5'-ATGGCTTCCGTGCAAGTGAA-3'; for
adipsin, reverse,
5'-TCATCCGTCACTCCATCCATG-3'; for
aP2, forward,
5'-GGTGACAAGCTGGTGGTGGA-3'; for
aP2, reverse,
5'-CCTTTGGCTCATGCCCTTTC-3'; for
CHOP, forward,
5'-GCGACAGAGCCAGAATAACAGC-3'; for
CHOP, reverse,
5'-TTCTGCTTTCAGGTGTGGTGGT-3'; for
PPAR
2, forward,
5'-TCTTAACTGCCGGATCCACAAA-3'; and
for PPAR
2, reverse,
5'-CCAAACCTGATGGCATTGTGA-3'.
Transfection, immunoprecipitation, and immunoblotting. Transient transfection of DNA was performed using FuGENE6 (Roche Applied Science). COS7 cells were seeded in six-well plates and then transiently transfected using FuGENE6 and incubated 24 h before analysis. Then, the cells were lysed with Nonident P-40 (NP-40) lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40), 1% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. Immunoprecipitation and immunoblotting were performed as previously described (5). To examine endogenous CHOP and C/EBPß, C2C12 cells were harvested 4 days after stimulation or not with BMP-2. The lysates were sonicated and centrifuged. The supernatants were measured for protein concentrations, and equal amounts (100 µg) of lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis in a 7 to 12% gradient gel. Separated proteins were electrotransferred to Pall Fluorotrans W polyvinylidene difluoride membrane (Pall) and immunoblotted with anti-GADD153 antibody (F168) (Santa Cruz) or anti-C/EBPß antibody (C-19) (Santa Cruz). Signals were detected using high-grade luminol sodium salt(Wako).
Luciferase assay. C2C12 and C3H10T1/2 cells were seeded in duplicate in 12-well plates, followed by transient transfection with 0.15 µg of osteocalcin-Luc and 0.0005 µg of phRL-TK-renilla reporter (Promega) per well. Cells were harvested 24 h after transfection. Luciferase activity was measured by use of an AutoLumat LB953 instrument (Berthold Technologies). Osteocalcin-Luc activities were normalized to phRL-TK-renilla activity.
DNA affinity precipitation (DNAP). COS7 cells were seeded in six-well plates and then transiently transfected using FuGENE6 and incubated for 24 h. Then, the cells were lysed with NP-40 lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40), 1% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. The lysates preincubated with streptavidin-agarose beads (Sigma) were incubated with 30 pmol of a biotinylated double-stranded oligonucleotide probe that contained three repeats of the C/EBP-binding element present in the osteocalcin gene promoter (sense strand, 5'-GATCGGACATTACTGAACACTACGGGACATTACTGAACACTCCCGGGACATTACTGAACACT-3'; antisense strand, 5'-GATCAGTGTTCAGTAATGTCCCGGGAGTGTTCAGTAATGTCCCGTAGTGTTCAGTAATGTCC-3') and 12 µg of poly(dI-dC) at 4°C for 16 h. DNA-bound proteins were collected with streptavidin-agarose beads for 30 min, washed with the lysis buffer, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and identified by immunoblotting.
EMSA. Nuclear extracts from primary calvarial osteoblasts were purified using NE-PER (Pierce). Electrophoretic mobility shift assay (EMSA) reactions were performed using a LightShift chemiluminescent EMSA kit (Pierce). The sequences of the oligonucleotides (CEBP-BEOG2) were as follows: wild-type, 5' AATGAGGACATTACTGAACACTCCC; mutant, 5' AATGAGGACACGACTCTGCACTCCC. Wild-type oligonucleotide was biotinylated and used as a probe. Binding reactions were carried out for 20 min at room temperature in a total volume of 20 µl containing 1x binding buffer, 1 µg poly(dI-dC), 1% glycerol, 0.05% NP-40, 1 mM EDTA, and 20 fmol of biotinylated probe. For oligonucleotide competition, 4 pmol (x200) of unbiotinylated oligonucleotides was added 15 min before the application of a biotinylated probe and incubation at room temperature. One microliter of anti-C/EBPß antibody (H-7X; Santa Cruz) was added 30 min before the addition of probes and incubated on ice for the supershift experiment.
ChIP assay. C2C12 cells were cross-linked with 1% formaldehyde for 15 min at room temperature and washed three times with ice-cold PBS containing 1 mM phenylmethylsulfonyl fluoride and 1% aprotinin. Soluble chromatin was prepared using a chromatin immunoprecipitation (ChIP) assay kit (Upstate) according to the manufacturer's recommendations and immunoprecipitated with either anti-C/EBPß antibody (H-7X; Santa Cruz) or normal mouse immunoglobulin G. Following washes and elution, precipitates were heated overnight at 65°C to reverse cross-linking. DNA fragments were purified by phenol-chloroform extraction and ethanol precipitation. A total of 2 µl of purified DNA was subjected to PCR amplification using the specific primers for the C/EBP-binding element present in the osteocalcin gene (sense primer, 5'-TGCCCTACAACCGGATCTTA-3'; antisense primer, 5'-AAACTGGGCTCCAACTCTCA-3').
Statistical analysis. Results of ALP assays and quantitative RT-PCR were expressed as means ± standard errors of the means. Statistical significance was determined by t testing.
|
|
|---|
,
C/EBPß, and C/EBP
mRNA. As shown in Fig.
1A, CHOP was widely
expressed in many tissues, including bone. C/EBP
was highly
expressed in muscle, lung, and liver, but not in bone, whereas
C/EBPß showed relatively ubiquitous expression, including in
bone. C/EBP
was expressed widely but at low levels in most
tissues.
![]() View larger version (33K): [in a new window] |
FIG. 1. Profiles
of expression of C/EBP family members in neonatal tissues and
mesenchymal progenitor cells. (A) RT-PCR performed on cDNA
derived from various neonatal mouse tissues. RT-PCR experiments were
performed using primers specific for CHOP, C/EBP ,
C/EBPß, C/EBP , and HPRT1. Amplification of CHOP,
C/EBP , C/EBPß, or C/EBP was performed with 32
cycles. Amplification of a HPRT1 fragment was used to confirm equal
levels of target cDNA in the samples. (B) RT-PCR performed on
cDNA derived from several mesenchymal cells cultured with or without
BMP-2 (300 ng/ml) for 5 days or from 3T3-L1 cells cultured with or
without adipogenic cocktail DIII for 2 days. Amplification of CHOP,
C/EBP , C/EBPß, or C/EBP was performed with 30
cycles. MSC, marrow stromal cells. (C) C2C12 cells were
cultured with or without BMP-2 (300 ng/ml) for 4 days, and total cell
lysates were immunoblotted with anti-GADD153 (anti-CHOP) antibody,
anti-C/EBPß antibody, or antitubulin antibody. Lysate of 3T3-L1
cells which express CHOP and C/EBPß was loaded as a positive
control. The asterisk indicates a nonspecific
band.
|
and C/EBP
, are abundantly
expressed in bone and mesenchymal progenitor cells, we decided to focus
on the function of C/EBPß and CHOP in osteoblast
differentiation in subsequent
experiments. CHOP inhibits adipogenesis. To clarify the potential roles of C/EBPß and CHOP in osteoblast differentiation, we generated adenoviruses carrying C/EBPß and CHOP to obtain high gene induction efficiency in mesenchymal cells infected as previously described(6). Almost 100% of the cells were infected by adenoviruses containing LacZ, as determined by staining of various mesenchymal cells for ß-galactosidase (data not shown). Immunoblot analysis revealed sufficient levels of expression of C/EBPß and CHOP proteins in infected primary calvarial osteoblasts (Fig. 2A). We further confirmed the function of adenovirus-induced C/EBPß and CHOP by an adipocyte differentiation assay using 3T3-L1 preadipocytes. Pereira et al. (23) showed that CHOP retrovirus inhibited adipogenic cocktail-induced adipogenesis in ST-2. We reproduced this event with our CHOP adenovirus in 3T3-L1 treated with adipogenic cocktail DIII (Fig. 2B). Since CHOP is a dominant-negative inhibitor for C/EBPs in adipogenesis, we also examined whether CHOP inhibits C/EBPß adenovirus-induced adipocyte differentiation. As shown in Fig. 2C, C/EBPß adenovirus induced lipid droplet accumulation in infected 3T3-L1, and CHOP inhibited this phenomenon. We thus confirmed that C/EBPß and CHOP introduced by the recombinant adenovirus system were functional.
![]() View larger version (17K): [in a new window] |
FIG. 2. CHOP
suppresses adipocyte differentiation. (A) Calvarial
osteoblasts were infected with LacZ (MOI = 200), FLAG-CHOP
(F-CHOP) (MOI = 200), or FLAG-C/EBPß (MOI =
100) adenovirus and cultured for 3 days. Then, nuclear extracts from
infected cells were immunoblotted with anti-FLAG antibody to determine
the expression levels of induced proteins. (B) 3T3-L1 cells
were infected with LacZ adenovirus, C/EBPß adenovirus, or both
at an MOI of 100 for each and incubated with or without DIII cocktail
for 4 days. Then, cells were examined for adipogenic differentiation by
Nile red staining and real-time RT-PCR for aP2 and adipsin. mRNA values
were normalized to the amounts of HPRT1. (C) 3T3-L1 cells
were infected with LacZ adenovirus, FLAG-C/EBPß adenovirus, or
both at an MOI of 100
for each and incubated for 14 days. Then, expression levels of PPAR 2
and adipsin were assessed by real-time RT-PCR. mRNA values were
normalized to the amounts of
HPRT1.
|
![]() View larger version (48K): [in a new window] |
FIG. 3. CHOP
inhibits differentiation of calvarial osteoblasts. Primary calvarial
osteoblasts were infected with LacZ or CHOP adenovirus at an MOI of 200
for each. (A) Osteoblasts were cultured with or without 50
µg/ml AA plus ß-GP for 16 days. ALP staining and ALP
activity are shown. p-NP, p-nitrophenylphosphate.(B) Osteoblasts were cultured with or without
AA-ß-GP and 300 ng/ml BMP-2 for 7 days. (C and D)
Quantitative RT-PCR for osteocalcin and Runx2 was performed, and values
were normalized to the amounts of HPRT1. a.a., AA; ß-gp,
ß-GP; OC,
osteocalcin.
|
![]() View larger version (35K): [in a new window] |
FIG. 4. Endogenous
CHOP has a dual effect on primary osteoblast differentiation.
(A) Expression levels of the CHOP protein in wild-type and
CHOP-null calvarial osteoblasts were assessed by immunoblot analysis
and compared to that in C2C12 cells stimulated by BMP-2. Nuclear
extracts were immunoblotted with anti-CHOP antibody and antilamin
antibody (for a loading control). (B) Primary calvarial
osteoblasts from two groups of littermates (four wild-type and three
knockout mice total) were cultured without any stimulants for 6 days.
Cells were subjected to ALP staining. (C) Total RNA from
parallel samples shown in panel B was subjected to quantitative RT-PCR
individually for Runx2, ALP, and osteocalcin, and values were
normalized to the amounts of HPRT1. The expression levels of the two
genotypes were compared and significance was determined by t
testing. (D) Wild-type (litter II #7) and homozygous
CHOP-null (litter II #6) osteoblasts were infected with LacZ or CHOP
adenovirus at an MOI of 200 and subsequently cultured in normal medium
for 11 days. ALP staining is shown. (E) Wild-type (litter II
#7) and homozygous CHOP-null (litter II #6) osteoblasts were infected
with LacZ or CHOP adenovirus at an MOI of 200 and cultured with
AA-ß-GP plus 100 ng/ml BMP-2 for 4 days (ALP staining)
or 11 days (von Kossa staining). (F) Osteoblasts treated in
parallel with those shown in panels D and E were subjected to
quantitative RT-PCR for ALP and osteocalcin at day 4. a.a.,
AA; ß-gp, ß-GP; OC,
osteocalcin.
|
However, when these cells were treated with AA-ß-GP plus BMP-2 to accelerate osteogenesis, the production of ALP and formation of mineralized bone nodules were significantly stronger in wild-type cells than in the CHOP/ cells (Fig. 4E) and were suppressed by CHOP overexpression. This contradictory observation was confirmed by determining mRNA for ALP and osteocalcin (Fig. 4F). The expression of ALP and osteocalcin was significantly induced in CHOP/ osteoblasts, an effect which was reversed by the CHOP adenovirus. Surprisingly, wild-type osteoblasts treated with AA-ß-GP plus BMP-2 showed higher expression of ALP and osteocalcin than CHOP/ cells, an effect suppressed by the CHOP adenovirus, suggesting that the expression level of CHOP is an extremely important factor. These results suggest that endogenous CHOP plays a dual role in the regulation of committed osteoblast differentiation, depending on the presence or absence of BMP.
Endogenous CHOP negatively regulates adipocyte differentiation.
Since the possible role of endogenous
CHOP in adipocyte differentiation had not been examined previously, we
examined adipogenesis in CHOP-deficient fibroblasts. Three independent
fibroblasts derived from three pups were tested for both wild-type and
CHOP-null genotypes (Fig.
5A). BMP-2 induced Nile red-positive adipocyte differentiation more strongly
in CHOP/ fibroblasts than in
CHOP+/+ fibroblasts. Accordingly, induction
of adipocyte differentiation markers such as PPAR
2 and aP2 in
CHOP/ primary fibroblasts was more
prominent than that in wild-type fibroblasts (Fig.
5B). These results show
that endogenous CHOP suppresses both osteoblast maturation and
adipocyte differentiation, at least in a cell-autonomous
fashion.
![]() View larger version (28K): [in a new window] |
FIG. 5. Inhibition
of adipogenic differentiation by endogenous CHOP. (A) Primary
fibroblasts from three individual wild-type and CHOP knockout
littermates were infected or not with CHOP adenovirus and cultured with
or without BMP-2 (100 ng/ml) for 10 days. Then, cells were examined for
adipogenic differentiation by Nile red staining. (B) Primary
fibroblasts from CHOP/ and
CHOP+/+ littermates were infected or not
with CHOP adenovirus and cultured with or without BMP-2 (100 ng/ml) for
5 days. Then, levels of expression of PPAR 2 and aP2 were
assessed by quantitative RT-PCR. mRNA values were normalized to the
amounts of
HPRT1.
|
![]() View larger version (32K): [in a new window] |
FIG. 6. CHOP
interferes with cooperative induction of the osteocalcin gene by Runx2
and C/EBPß. (A) C2C12 cells were infected with LacZ
or Runx2 adenovirus in combination with LacZ or CHOP virus at an MOI of
100 for each (total, 200 MOI per well) and cultured in normal medium
for 7 days and subsequently ALP stained and subjected to quantitative
RT-PCR for osteocalcin (upper panels). C2C12 cells were transfected
with the osteocalcin gene promoter fused to the luciferase reporter
construct and the phRL-TK-renilla reporter together with Runx2 and/or
CHOP cDNAs (lower panel). Osteocalcin-Luc activity levels were
normalized to the level of phRL-TK-renilla activity. (B)
Primary fibroblasts were infected with the indicated adenoviruses at
the MOIs shown and then subjected to quantitative RT-PCR for
osteocalcin (day 5) and ALP staining (day 7). (C) C3H10T1/2
cells were transfected with the osteocalcin gene luciferase reporter
and the phRL-TK-renilla reporter together with combinations of the
indicated cDNAs. OC,
osteocalcin.
|
![]() View larger version (59K): [in a new window] |
FIG. 7. CHOP
prevents interaction between Runx2 and C/EBPß as well as the
binding of C/EBPß to the C/EBP-binding element of the
osteocalcin promoter. (A) COS7 cells were transfected with
various combinations of plasmids for C/EBPß, Runx2, or CHOP.
The cell lysates were immunoprecipitated (IP) with anti-FLAG antibody
and subsequently immunoblotted with anti-Myc antibody. (B)
The lysates of COS7 cells transfected with pcDNA3 (control), 6x
Myc-C/EBPß, or both 6x Myc-C/EBPß and Myc-CHOP
were incubated with or without a biotinylated probe containing the
C/EBP-binding element in the osteocalcin gene promoter
(C/EBP-BEOG2). Proteins bound to the biotinylated probe were
determined by immunoblotting with anti-Myc antibody. Ppt,
precipitation. (C) Nuclear extracts from primary calvarial
osteoblasts infected with indicated adenoviruses were subjected to EMSA
with the biotinylated CEBP-BEOG2 probe. Unlabeled 200 molar
excess oligonucleotides (wild-type [Wt] and mutant [Mut]) were added as
competitors. Anti-C/EBPß antibody was used for the supershift
experiment. (D) C2C12 cells were infected or not with CHOP
adenovirus and cultured with or without BMP-2 (300 ng/ml) for 2 days.
The lysates were subjected to ChIP. PCR amplification was performed
using the primers specific for the osteocalcin promoter. -,
anti-; IgG, control mouse immunoglobulin G; N.C., negative control
(water).
|
|
|
|---|
In agreement with the present findings, several studies have demonstrated that C/EBPß promotes osteoblast differentiation of mesenchymal progenitor cells (7, 10). Importantly, in our in vitro study using CHOP-null calvarial osteoblasts, CHOP appeared to act as an inhibitor of spontaneous osteoblast differentiation. This finding indicates that a cell-autonomous activity of endogenous C/EBPß is stimulatory for osteogenesis. However, Iyer et al. reported that C/EBPß negatively regulates osteoblast differentiation of MC3T3-E1 cells (13). As it is possible that C/EBPß differentially regulates osteoblast differentiation in a cell-type- and context-dependent manner, we used primary calvarial osteoblasts to resolve this issue. In the primary osteoblasts, C/EBPß enhanced the osteoblast differentiation induced by AA-ß-GP plus BMP-2, and CHOP reduced this additional effect, indicating that C/EBPß promotes osteoblast maturation.
Of the various osteoblast differentiation markers we tested, CHOP mainly affected the expression of ALP and osteocalcin. We hypothesize that CHOP functions only on the promoters of osteoblast marker genes where cooperation between C/EBPß and Runx2 takes place. Since database analysis (www.cbrc.jp/research/db/TFSEARCH.html) of the human ALP promoter sequence indicates the presence of binding sites for both Runx2 and C/EBPß, ALP may be induced through a mechanism similar to that for induction of osteocalcin. It may also be important to determine whether functional C/EBP elements are absent in the promoters of osteogenic genes that do not respond to CHOP.
In contrast to our present findings, Pereira et al. reported that CHOP introduced by a retrovirus system promoted the osteoblast differentiation of ST-2 stromal cells (23). We also tested the effect of CHOP on ST-2 cells and found that CHOP acts bidirectionally to the osteoblast differentiation of ST-2. We could not conduct the long-term culture experiment to examine the effect of CHOP virus alone as Pereira et al. did, since we had undertaken a transient adenovirus induction system. When ST-2 cells were treated with BMP-2 plus ascorbic acid, CHOP showed some suppressive effects on osteoblast differentiation (data not shown). The adipocyte differentiation driven by the same stimulant in ST-2 was clearly inhibited by CHOP (data not shown). However, when induced with Runx2 adenovirus without any stimulants, CHOP promoted osteoblast differentiation of ST-2 cells (data not shown), supporting the findings by Pereira et al. Moreover, adenoviruses carrying Runx2 and C/EBPß did not show synergism in ALP production (data not shown). These differences may be derived from the status of the cells, since ST-2 cells are osteoblast/adipocyte progenitors and calvarial cells are committed osteoblasts. Also, the expression profiles of basic leucine zipper (bZIP) proteins other than those of the C/EBP family in terms of the formation of heterodimers with CHOP may differ between the cell types. Recently, bZIP protein ATF4 has been reported to be critical in osteogenesis (32), and the ATF4 protein is present exclusively in committed osteoblasts (31). To address these possibilities, we used calvarial osteoblasts. However, we found that endogenous CHOP also has dual functions in the differentiation of calvarial osteoblasts, depending on the BMP signals. Pereira et al. reported that CHOP enhanced the BMP signals without affecting the phosphorylation of Smad1/5/8, the direct mediators of BMP signaling (23). We also obtained similar evidence, as shown in Fig. 4E and F. Therefore, CHOP may inhibit Runx2/C/EBPß-mediated promotion of osteogenesis independent of BMP signaling (Fig. 8). Once BMP signaling becomes active, CHOP may indirectly enhance BMP signals through unknown mechanisms, resulting in accelerated osteogenesis (Fig. 8). Thus, these two pathways have to be well balanced in vivo during osteogenesis. Recently, Pereira et al. (25) reported that CHOP-null mice exhibit no skeletal phenotype in vivo. This finding suggests that CHOP may act mainly in de novo bone formation stages, such as during fracture repair and response to gravity stress, while the lack of CHOP during development may be compensated by other molecules. Thus, further analyses of CHOP-null mice under de novo bone formation conditions may be required. Since CHOP seems to have these two opposite roles, it is also possible that the loss of CHOP may result in the inhibition of Runx2/C/EBPß-mediated osteoblast differentiation and the enhancement of BMP signals simultaneously and that these alterations may be compensated by each other to gain normal bone phenotype.
![]() View larger version (9K): [in a new window] |
FIG. 8. Proposed
model for the dual function of CHOP in osteoblast differentiation.
Runx2 plays indispensable roles in commitment and maturation of
osteoblasts. C/EBPß cooperates with Runx2 to accelerate
osteoblast differentiation. CHOP blocks C/EBPß from accessing
Runx2 and binding the promoters of osteogenic marker genes. BMP
signaling positively acts on osteoblast differentiation. Under such
conditions, CHOP enhances BMP signaling indirectly, resulting in
accelerated osteoblast
differentiation.
|
In conclusion, the findings of the present study clearly suggest that CHOP, a naturally occurring dominant-negative C/EBP family member, regulates osteoblast differentiation at least in part by interfering with the Runx2 cofactor C/EBPß and probably by accelerating BMP signaling. Further studies of CHOP-deficient mice in de novo bone formation processes should improve understanding of the importance of CHOP in osteogenesis.
This research was supported by grants-in-aid for scientific research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. T.I. was supported by the Tokyo Biochemical Research Foundation and the Takeda Science Foundation. S.M. was supported by the Takeda Science Foundation and the Uehara Memorial Foundation.
These
authors contributed equally. ![]()
|
|
|---|
activate osteocalcin gene transcription and
synergize with Runx2 at the C/EBP element to regulate bone-specific
expression. J. Biol. Chem.
277:1316-1323.
gene. EMBO J.
16:7432-7443.[CrossRef][Medline]
and stimulates adipogenesis.Genes Dev.
9:2350-2363.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»