This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirakawa, K.
Right arrow Articles by Imamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirakawa, K.
Right arrow Articles by Imamura, T.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 2006, p. 6105-6116, Vol. 26, No. 16
0270-7306/06/$08.00+0     doi:10.1128/MCB.02429-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

CCAAT/Enhancer-Binding Protein Homologous Protein (CHOP) Regulates Osteoblast Differentiation

Ken Shirakawa,1,2,{dagger} Shingo Maeda,1,{dagger} Tomomi Gotoh,3 Makoto Hayashi,1,4 Kenichi Shinomiya,2 Shogo Ehata,1 Riko Nishimura,5 Masataka Mori,3 Kikuo Onozaki,6 Hidetoshi Hayashi,6 Satoshi Uematsu,7 Shizuo Akira,7 Etsuro Ogata,8 Kohei Miyazono,1,9 and Takeshi Imamura1*

Department of Biochemistry, The Cancer Institute of the Japanese Foundation for Cancer Research, Tokyo,1 Section of Orthopedic and Spinal Surgery, Department of Frontier Surgical Therapeutics, Division of Advanced Therapeutical Sciences, Graduate School, Tokyo Medical and Dental University, Tokyo,2 Department of Molecular Genetics, Graduate School of Medical Sciences, Kumamoto University, Kumamoto,3 Department of Biological Sciences, Graduate School of Bioscienceand Biotechnology, Tokyo Institute of Technology, Yokohama,4 Department of Biochemistry, Graduate School of Dentistry, Osaka University, Osaka,5 Department of Molecular Health Sciences, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya,6 Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Department of Host Defense, and The 21st Century COE, Combined Program on Microbiology and Immunology, Research Institute for Microbial Diseases, Osaka University, Osaka,7 Cancer Institute Hospital, Tokyo,8 Department of Molecular Pathology, Graduate School of Medicine, University of Tokyo, Tokyo, Japan9

Received 21 December 2005/ Returned for modification 20 February 2006/ Accepted 26 May 2006


arrow
ABSTRACT
 
Differentiation of committed osteoblasts is controlled by complex activities involving signal transduction and gene expression, and Runx2 and Osterix function as master regulators for this process. Recently, CCAAT/enhancer-binding proteins (C/EBPs) have been reported to regulate osteogenesis in addition to adipogenesis. However, the roles of C/EBP transcription factors in the control of osteoblast differentiation have yet to be fully elucidated. Here we show that C/EBP homologous protein (CHOP; also known as C/EBP{zeta}) is expressed in bone as well as in mesenchymal progenitors and primary osteoblasts. Overexpression of CHOP reduces alkaline phosphatase activity in primary osteoblasts and suppresses the formation of calcified bone nodules. CHOP-deficient osteoblasts differentiate more strongly than their wild-type counterparts, suggesting that endogenous CHOP plays an important role in the inhibition of osteoblast differentiation. Furthermore, endogenous CHOP induces differentiation of calvarial osteoblasts upon bone morphogenetic protein (BMP) treatment. CHOP forms heterodimers with C/EBPß and inhibits the DNA-binding activity as well as Runx2-binding activity of C/EBPß, leading to inhibition of osteocalcin gene transcription. These findings indicate that CHOP acts as a dominant-negative inhibitor of C/EBPß and prevents osteoblast differentiation but promotes BMP signaling in a cell-type-dependent manner. Thus, endogenous CHOP may have dual roles in regulating osteoblast differentiation and bone formation.


arrow
INTRODUCTION
 
Osteoblasts, which play central roles in bone formation, are derived from undifferentiated mesenchymal cells that also have the capacity to differentiate into chondrocytes, adipocytes, and myoblasts (26). The osteogenic master regulators Runx2/Cbfa1 (4, 15) and Osterix (19) are indispensable for osteoblast commitment and maturation. Runx2 directly regulates osteoblast-specific genes, including the osteocalcin gene, through its binding to the specific DNA element OSE2 (4). Runx2-deficient mice exhibit no bone formation (15), and inherited mutations of the Runx2 gene in humans cause cleidocranial dysplasia, which is characterized by severely impaired osteogenesis (18). Targeted disruption of the Osterix gene in mice also results in abnormal skeletogenesis with a complete lack of bone formation in spite of unaffected Runx2 expression (19). These findings indicate that osteoblast differentiation requires a delicate transcriptional network formed mainly by Runx2 and Osterix. However, how the expression levels and functions of both master regulators are controlled is poorly understood. Because the rate of osteoblast differentiation should be tightly regulated in bone homeostasis, it is extremely important to elucidate the possible modifiers for Runx2 and/or Osterix.

Recently, CCAAT/enhancer-binding proteins (C/EBPs) have been reported to regulate differentiation of mesenchymal progenitor cells into osteoblasts. C/EBPs, including C/EBP{alpha}, ß, {delta}, {gamma}, {varepsilon}, and C/EBP homologous protein (CHOP; also known as C/EBP{zeta}), belong to the leucine zipper family of transcription factors. C/EBP proteins contain a highly conserved DNA-binding domain as well as a leucine dimerization domain and can form homo- and/or heterodimers that bind to similar sequence motifs (27). Overexpression of C/EBPß in mesenchymal cells induces expression of an adipocyte-specific nuclear receptor, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}),followed by adipocyte differentiation in cooperation with C/EBP{delta} (30). Mice deficient in C/EBPß exhibit reduced adipogenesis (29). These findings indicate that C/EBPß plays one of the central roles in adipogenesis by operating complex gene expression cascades governed by the PPAR{gamma} gene. While being indispensable for adipogenesis, C/EBPß is also expressed in the osteoblastic cell lineages and its expression is up-regulated during osteoblast differentiation (1, 7, 10, 20, 24). C/EBPß and C/EBP{delta} regulate the osteocalcin gene promoter through physical interaction with Runx2 (7). Recently, Hata et al. demonstrated that C/EBPß and its isoform, liver-enriched inhibitory protein (LIP), promote the differentiation of mesenchymal cells into an osteoblastic lineage in cooperation with Runx2 (10). In contrast, producing transgenic mice bone-targeted LIP exhibit evidence of osteopenia secondary to reduced bone formation that is accompanied by severely suppressed osteocalcin expression in bone (9). These reports strongly suggest that C/EBPs have a certain role in modifying the function of Runx2. Moreover, it has been reported that overexpression of C/EBPß stimulates the proliferation of a mouse osteoblastic cell line, MC3T3-E1, but suppresses its osteoblast differentiation (13). Collectively, although it is clear that C/EBPs control osteoblast differentiation in appropriate stages, it is unclear and controversial whether C/EBPs are promotive or suppressive of osteogenesis. Since the C/EBP family consists of multiple genes and isoforms, the universal inhibitor for pan-C/EBP proteins should address these complex problems.

CHOP, also known as C/EBP{zeta}, growth arrest and DNA damage-inducible gene 153 (GADD153), and DNA damage inducible transcript 3 (DDIT3), is a member of the C/EBP family and plays a role in cell proliferation and differentiation (2, 3, 22, 28). CHOP lacks the ability to bind classical C/EBP-binding DNA elements, whereas it forms heterodimers with other C/EBP family members and plays a role as a dominant-negative inhibitor of C/EBPs (28). Therefore, given that CHOP is well expressed in bone, elucidation of its function during osteoblast differentiation would be very helpful in clarifying the roles of C/EBPs in osteogenesis. Pereira et al. demonstrated that CHOP could promote the osteoblast differentiation of ST-2 stromal cells in overexpression assays, since it formed heterodimers with C/EBP{alpha} and C/EBPß and sensitized the bone morphogenetic protein (BMP)-Smad1/5/8 pathway (23). However, how CHOP enhanced BMP signaling remained unclear. Recent analyses of CHOP-null mice revealed normal skeleton and normal bone mineral density (25), suggesting that there may be some factors to compensate for the function of CHOP in vivo or that CHOP may act only in C/EBP-dependent osteoblast differentiation. How CHOP acts on osteoblast differentiation cell autonomously should be addressed in more detail.

To overcome the complexity inherent in studying the function of CHOP in osteoblast differentiation, we performed loss-of-function experiments by employing primary osteoblasts purified from calvaria of CHOP-null mice to investigate the cell-autonomous function of CHOP. In contrast to a previous study (23), our results showed that CHOP acts as a dominant-negative inhibitor of C/EBPß to inhibit osteoblast differentiation through blocking cooperation between C/EBPß and Runx2. However, endogenous CHOP exhibited opposite effects on osteoblasts upon BMP treatment. Our present findings indicate that C/EBPß and CHOP reciprocally regulate osteoblast differentiation. We also show that C/EBPß and CHOP reciprocally regulate adipocyte differentiation of mesenchymal progenitor cells.


arrow
MATERIALS AND METHODS
 
Cell culture and induction of osteoblast and adipocyte differentiation. To isolate primary osteoblasts, calvaria were isolated from 0-, 1-, or 4-day-old neonatal mice and digested with 0.1% collagenase and 0.2% dispase for 7 min at 37°C. The digested calvaria were sequentially digested four times with 0.1% collagenase and 0.2% dispase for 7 min at 37°C, and the last three groups of fractionated cells were collected and used as primary osteoblasts. The cells were maintained in {alpha} minimum essential medium containing 10% fetal bovine serum (FBS) with 100 U/ml penicillin G and 100 µg/ml streptomycin and used at the second passage. Differentiation of primary osteoblasts was induced by 100 or 300 ng/ml recombinant human bone morphogenetic protein 2 (rhBMP-2) provided by Astellas Pharma Inc., 50 µg/ml ascorbic acid, and 5 mM ß-glycerophosphate in medium.

Primary fibroblasts were isolated as previously described (12). In brief, the skins from 2-, 3-, or 4-day-old neonatal mice were isolated and digested with 0.05% collagenase in 10% FBS-containing medium for 24 h at 4°C. The cells were then dispersed by vigorous pipetting, collected by centrifugation, and used as primary fibroblasts. The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Osteoblast and adipocyte differentiation of primary fibroblasts was induced by 100 or 300 ng/ml rhBMP-2 in medium unless otherwise indicated. The generation of CHOP–/– mice was previously described (21).

Primary bone marrow cells (marrow stromal cells) were collected from long bones of 8-week-old mice. The cells were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. C2C12 cells (American Type Culture Collection) were maintained in DMEM containing 20% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Osteoblast differentiation of C2C12 cells was induced by 100 or 300 ng/ml rhBMP-2, in 5% FBS-containing medium. C3H10T1/2 cells (American Type Culture Collection) were maintained in Eagle's basal medium containing 10% FBS with 100 U/ml penicillin G, 100 µg/ml streptomycin, and 2 mM L-glutamine. ST-2 cells (RIKEN Cell Bank) were maintained in RPMI 1640 medium containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. 3T3-L1 cells (American Type Culture Collection) were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin. Adipogenic differentiation of 3T3-L1 cells was induced by adding 1 µM dexamethasone, 0.2 mM indomethacin, 0.01 mg/ml insulin, and 0.5 mM 3-isobutyl-1-methyl-xanthine (designated hereafter as DIII) to medium. COS7 cells were maintained in DMEM containing 10% FBS with 100 U/ml penicillin G and 100 µg/ml streptomycin.

Plasmid construction. The plasmids pcDNA3.1-FLAG-CHOP and pcDNA3.1-Myc-CHOP were used as previously described (11). The plasmids pcDEF3-FLAG-Runx2 and pcDEF3-6xMyc-Runx2 were also used as previously described (8). The plasmids pcDNA3-FLAG-C/EBPß and pcDEF3-6xMyc-C/EBPß were generated by a PCR-based approach with the expression vector for C/EBPß (14) as the template and subcloned into pcDNA3-FLAG and pcDEF3-6xMyc. A total of 1.3 kb of the mouse osteocalcin promoter, which contains the OSE2 site (positions –137 to –131), was used as previously described (10).

Generation of adenoviruses. Generation of adenoviruses was performed using an adenovirus expression vector kit (TaKaRa). In brief, recombinant adenoviruses carrying FLAG-CHOP, FLAG-C/EBPß, or FLAG-Runx2 were constructed by homologous recombination between the expression cosmid cassette (pAxCAwt) and parental virus genome in 293 cells. The viruses exhibited no proliferative activity due to the lack of E1A-E1B (17). Titers of viruses were determined using an Adeno-X rapid titer kit (Clontech). Infection of C2C12 cells, primary osteoblasts, primary fibroblasts, and 3T3-L1 cells with recombinant adenoviruses was performed by incubation with adenoviruses at a multiplicity of infection (MOI) of 100 unless otherwise indicated.

ALP assays, von Kossa staining, and Nile red staining. Quantitative analysis of alkaline phosphatase (ALP) activity was performed as previously described (6) using Sigma Fast p-nitrophenylphosphate tablet sets (Sigma). All samples were quantified in triplicate. The protein concentration in each extract was measured by DC protein assay (Bio-Rad) using bovine serum albumin as a standard. Histochemical analysis of the ALP assay was performed using an ALP staining kit (#85L-3R; Sigma) according to the manufacturer's protocol. Calcium deposition was visualized by the von Kossa method as previously described (16). Cells were fixed in 3% glutaraldehyde in phosphate-buffered saline (PBS), washed with PBS, and rinsed with distilled water. Fixed cells were incubated with 2.5% silver nitrate during exposure to light for 60 min and then washed and developed with 0.5% hydroquinone for 2 min. Excess silver was washed out with 5% sodium thiosulfate for 2 min.

Adipogenic differentiation was examined by Nile red staining. Cells were fixed in 3% glutaraldehyde in PBS, washed with PBS, incubated with AdipoRed lipid assay reagent (CAMBREX) for 10 min, and then washed with PBS. Fluorescence was examined using an Olympus IX71 microscope.

Conventional RT-PCR and quantitative real-time RT-PCR. Total RNA was extracted using TRIzol reagent (Invitrogen). cDNA was synthesized with the SuperScript III first-strand synthesis system (Invitrogen). Reverse transcription-PCR (RT-PCR) was performed using a 2720 thermal cycler (Applied Biosystems). The primer sequences used were as follows: for HPRT1, forward, 5'-CATCACATTGTGGCCCTCTGT-3'; for HPRT1, reverse, 5'-GGTCCTTTTCACAGCAAGCT-3'; for C/EBP{alpha}, forward, 5'-AGCCAAGAAGTCGGTGGACAAG-3'; for C/EBP{alpha} reverse, 5'-TAGAGATCCAGCGACCCGAAAC-3'; for C/EBPß, forward, 5'-GGACTTGATGCAATCCGGA-3'; for C/EBPß, reverse, 5'-GCTCGAAACGGAAAAGGTTC-3'; for C/EBP{delta}, forward, 5'-GGAAGAGACTGCGCATGCTTT-3'; for C/EBP{delta}, reverse, 5'-AGTTAGGCCAACTGTTCTCCGC-3'; for CHOP, forward, 5'-GAAAGCAGAACCTGGTCCACGT-3'; and for CHOP, reverse, 5'-ATGTGCGTGTGACCTCTGTTG-3'. PCR products were loaded onto agarose gel and stained with ethidium bromide.

Quantitative real-time RT-PCR was performed using SYBR green PCR master mix (Applied Biosystems) and an ABI Prism 7000 sequence detection system (Applied Biosystems). All samples were run in duplicate in each experiment. The specificity of detected signals was confirmed by a dissociation curve consisting of a single peak. Values were normalized by HPRT1. The primer sequences used were as follows: for HPRT1, forward, 5'-CTGGTTAAGCAGTACAGCCCCA-3'; for HPRT1, reverse, 5'-GGTCCTTTTCACCAGCAAGCT-3'; for osteocalcin, forward, 5'-TAGCAGACACCATGAGGACCCT-3'; for osteocalcin, reverse, 5'-TGGACATGAAGGCTTTGTCAGA-3'; for Runx2, forward, 5'-AACCACAGAACCACAAGTGCG-3'; for Runx2, reverse, 5'-AAATGACTCGGTTGGTCTCGG-3'; for adipsin, forward, 5'-ATGGCTTCCGTGCAAGTGAA-3'; for adipsin, reverse, 5'-TCATCCGTCACTCCATCCATG-3'; for aP2, forward, 5'-GGTGACAAGCTGGTGGTGGA-3'; for aP2, reverse, 5'-CCTTTGGCTCATGCCCTTTC-3'; for CHOP, forward, 5'-GCGACAGAGCCAGAATAACAGC-3'; for CHOP, reverse, 5'-TTCTGCTTTCAGGTGTGGTGGT-3'; for PPAR{gamma}2, forward, 5'-TCTTAACTGCCGGATCCACAAA-3'; and for PPAR{gamma}2, reverse, 5'-CCAAACCTGATGGCATTGTGA-3'.

Transfection, immunoprecipitation, and immunoblotting. Transient transfection of DNA was performed using FuGENE6 (Roche Applied Science). COS7 cells were seeded in six-well plates and then transiently transfected using FuGENE6 and incubated 24 h before analysis. Then, the cells were lysed with Nonident P-40 (NP-40) lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40), 1% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. Immunoprecipitation and immunoblotting were performed as previously described (5). To examine endogenous CHOP and C/EBPß, C2C12 cells were harvested 4 days after stimulation or not with BMP-2. The lysates were sonicated and centrifuged. The supernatants were measured for protein concentrations, and equal amounts (100 µg) of lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis in a 7 to 12% gradient gel. Separated proteins were electrotransferred to Pall Fluorotrans W polyvinylidene difluoride membrane (Pall) and immunoblotted with anti-GADD153 antibody (F168) (Santa Cruz) or anti-C/EBPß antibody (C-19) (Santa Cruz). Signals were detected using high-grade luminol sodium salt(Wako).

Luciferase assay. C2C12 and C3H10T1/2 cells were seeded in duplicate in 12-well plates, followed by transient transfection with 0.15 µg of osteocalcin-Luc and 0.0005 µg of phRL-TK-renilla reporter (Promega) per well. Cells were harvested 24 h after transfection. Luciferase activity was measured by use of an AutoLumat LB953 instrument (Berthold Technologies). Osteocalcin-Luc activities were normalized to phRL-TK-renilla activity.

DNA affinity precipitation (DNAP). COS7 cells were seeded in six-well plates and then transiently transfected using FuGENE6 and incubated for 24 h. Then, the cells were lysed with NP-40 lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40), 1% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. The lysates preincubated with streptavidin-agarose beads (Sigma) were incubated with 30 pmol of a biotinylated double-stranded oligonucleotide probe that contained three repeats of the C/EBP-binding element present in the osteocalcin gene promoter (sense strand, 5'-GATCGGACATTACTGAACACTACGGGACATTACTGAACACTCCCGGGACATTACTGAACACT-3'; antisense strand, 5'-GATCAGTGTTCAGTAATGTCCCGGGAGTGTTCAGTAATGTCCCGTAGTGTTCAGTAATGTCC-3') and 12 µg of poly(dI-dC) at 4°C for 16 h. DNA-bound proteins were collected with streptavidin-agarose beads for 30 min, washed with the lysis buffer, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and identified by immunoblotting.

EMSA. Nuclear extracts from primary calvarial osteoblasts were purified using NE-PER (Pierce). Electrophoretic mobility shift assay (EMSA) reactions were performed using a LightShift chemiluminescent EMSA kit (Pierce). The sequences of the oligonucleotides (CEBP-BEOG2) were as follows: wild-type, 5' AATGAGGACATTACTGAACACTCCC; mutant, 5' AATGAGGACACGACTCTGCACTCCC. Wild-type oligonucleotide was biotinylated and used as a probe. Binding reactions were carried out for 20 min at room temperature in a total volume of 20 µl containing 1x binding buffer, 1 µg poly(dI-dC), 1% glycerol, 0.05% NP-40, 1 mM EDTA, and 20 fmol of biotinylated probe. For oligonucleotide competition, 4 pmol (x200) of unbiotinylated oligonucleotides was added 15 min before the application of a biotinylated probe and incubation at room temperature. One microliter of anti-C/EBPß antibody (H-7X; Santa Cruz) was added 30 min before the addition of probes and incubated on ice for the supershift experiment.

ChIP assay. C2C12 cells were cross-linked with 1% formaldehyde for 15 min at room temperature and washed three times with ice-cold PBS containing 1 mM phenylmethylsulfonyl fluoride and 1% aprotinin. Soluble chromatin was prepared using a chromatin immunoprecipitation (ChIP) assay kit (Upstate) according to the manufacturer's recommendations and immunoprecipitated with either anti-C/EBPß antibody (H-7X; Santa Cruz) or normal mouse immunoglobulin G. Following washes and elution, precipitates were heated overnight at 65°C to reverse cross-linking. DNA fragments were purified by phenol-chloroform extraction and ethanol precipitation. A total of 2 µl of purified DNA was subjected to PCR amplification using the specific primers for the C/EBP-binding element present in the osteocalcin gene (sense primer, 5'-TGCCCTACAACCGGATCTTA-3'; antisense primer, 5'-AAACTGGGCTCCAACTCTCA-3').

Statistical analysis. Results of ALP assays and quantitative RT-PCR were expressed as means ± standard errors of the means. Statistical significance was determined by t testing.


arrow
RESULTS
 
Tissue distribution and cellular expression of CHOP. To determine whether endogenous CHOP is involved in the regulation of osteoblast differentiation and bone formation, we first examined the expression levels of CHOP mRNA in various mouse tissues by RT-PCR (Fig. 1A) and compared the profiles of expression with those of C/EBP{alpha}, C/EBPß, and C/EBP{delta} mRNA. As shown in Fig. 1A, CHOP was widely expressed in many tissues, including bone. C/EBP{alpha} was highly expressed in muscle, lung, and liver, but not in bone, whereas C/EBPß showed relatively ubiquitous expression, including in bone. C/EBP{delta} was expressed widely but at low levels in most tissues.


Figure 1
View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1. Profiles of expression of C/EBP family members in neonatal tissues and mesenchymal progenitor cells. (A) RT-PCR performed on cDNA derived from various neonatal mouse tissues. RT-PCR experiments were performed using primers specific for CHOP, C/EBP{alpha}, C/EBPß, C/EBP{delta}, and HPRT1. Amplification of CHOP, C/EBP{alpha}, C/EBPß, or C/EBP{delta} was performed with 32 cycles. Amplification of a HPRT1 fragment was used to confirm equal levels of target cDNA in the samples. (B) RT-PCR performed on cDNA derived from several mesenchymal cells cultured with or without BMP-2 (300 ng/ml) for 5 days or from 3T3-L1 cells cultured with or without adipogenic cocktail DIII for 2 days. Amplification of CHOP, C/EBP{alpha}, C/EBPß, or C/EBP{delta} was performed with 30 cycles. MSC, marrow stromal cells. (C) C2C12 cells were cultured with or without BMP-2 (300 ng/ml) for 4 days, and total cell lysates were immunoblotted with anti-GADD153 (anti-CHOP) antibody, anti-C/EBPß antibody, or antitubulin antibody. Lysate of 3T3-L1 cells which express CHOP and C/EBPß was loaded as a positive control. The asterisk indicates a nonspecific band.

We next examined the levels of expression of C/EBPs and CHOP in various murine mesenchymal progenitor cells (Fig. 1B). RT-PCR revealed that CHOP was abundantly expressed in C2C12 cells and murine primary fibroblasts but weakly in ST-2, which had been used to study the function of CHOP in osteogenesis (23). BMP-2 induced expression of CHOP mRNA in C2C12 cells and murine primary fibroblasts but did not do so significantly in other cells tested (Fig. 1B). 3T3-L1 showed strong expression of CHOP as a positive control. Expression levels of the CHOP protein were confirmed in C2C12 and 3T3-L1 by immunoblotting (Fig. 1C). Since C/EBPß and CHOP, but not C/EBP{alpha} and C/EBP{delta}, are abundantly expressed in bone and mesenchymal progenitor cells, we decided to focus on the function of C/EBPß and CHOP in osteoblast differentiation in subsequent experiments.

CHOP inhibits adipogenesis. To clarify the potential roles of C/EBPß and CHOP in osteoblast differentiation, we generated adenoviruses carrying C/EBPß and CHOP to obtain high gene induction efficiency in mesenchymal cells infected as previously described(6). Almost 100% of the cells were infected by adenoviruses containing LacZ, as determined by staining of various mesenchymal cells for ß-galactosidase (data not shown). Immunoblot analysis revealed sufficient levels of expression of C/EBPß and CHOP proteins in infected primary calvarial osteoblasts (Fig. 2A). We further confirmed the function of adenovirus-induced C/EBPß and CHOP by an adipocyte differentiation assay using 3T3-L1 preadipocytes. Pereira et al. (23) showed that CHOP retrovirus inhibited adipogenic cocktail-induced adipogenesis in ST-2. We reproduced this event with our CHOP adenovirus in 3T3-L1 treated with adipogenic cocktail DIII (Fig. 2B). Since CHOP is a dominant-negative inhibitor for C/EBPs in adipogenesis, we also examined whether CHOP inhibits C/EBPß adenovirus-induced adipocyte differentiation. As shown in Fig. 2C, C/EBPß adenovirus induced lipid droplet accumulation in infected 3T3-L1, and CHOP inhibited this phenomenon. We thus confirmed that C/EBPß and CHOP introduced by the recombinant adenovirus system were functional.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. CHOP suppresses adipocyte differentiation. (A) Calvarial osteoblasts were infected with LacZ (MOI = 200), FLAG-CHOP (F-CHOP) (MOI = 200), or FLAG-C/EBPß (MOI = 100) adenovirus and cultured for 3 days. Then, nuclear extracts from infected cells were immunoblotted with anti-FLAG antibody to determine the expression levels of induced proteins. (B) 3T3-L1 cells were infected with LacZ adenovirus, C/EBPß adenovirus, or both at an MOI of 100 for each and incubated with or without DIII cocktail for 4 days. Then, cells were examined for adipogenic differentiation by Nile red staining and real-time RT-PCR for aP2 and adipsin. mRNA values were normalized to the amounts of HPRT1. (C) 3T3-L1 cells were infected with LacZ adenovirus, FLAG-C/EBPß adenovirus, or both at an MOI of 100 for each and incubated for 14 days. Then, expression levels of PPAR{gamma}2 and adipsin were assessed by real-time RT-PCR. mRNA values were normalized to the amounts of HPRT1.

CHOP inhibits differentiation of primary osteoblasts. CHOP has been shown to promote osteoblast differentiation of a multipotential mesenchymal progenitor cell line, ST-2, derived from marrow stroma (23). However, it is not clear whether CHOP affects the differentiation of committed osteoblasts. To solve this issue, we induced CHOP in primary calvarial osteoblasts. Calvarial osteoblasts can undergo spontaneous osteogenic differentiation without any stimulants, which can be enhanced by the addition of ascorbic acid (AA) and ß-glycerophosphate (ß-GP) and further enhanced by BMPs. In contrast to a previous report using ST-2, overexpression of CHOP reduced ALP activity in both nonstimulated and AA-ß-GP-stimulated primary osteoblasts (Fig. 3A). This inhibitory effect of CHOP was further observed in a bone nodule formation assay and by detection of osteocalcin expression of AA-ß-GP-treated cells stimulated by BMP-2 (Fig. 3B). Thus, CHOP showed suppressive effect on maturation of committed osteoblasts. Hata et al. (10) reported that osteocalcin had been up-regulated by C/EBPß adenovirus. Therefore, we thought that this inhibitory effect of CHOP in osteogenesis might be achieved by blocking the role of C/EBPß in a dominant-negative manner. To test this, we applied CHOP into calvarial osteoblasts in combination with C/EBPß adenovirus. The quantitative RT-PCR revealed that the expression of the osteocalcin gene induced by AA-ß-GP plus BMP-2 was further cooperatively stimulated by C/EBPß, and CHOP cancelled this additional enhancement by C/EBPß (Fig. 3C). Weak but similar effects were observed in the expression of Osterix and bone sialoprotein mRNA (data not shown). Runx2 expression was promoted weakly by AA-ß-GP plus BMP-2 (Fig. 3D), suggesting that the committed osteoblasts already have sufficiently elevated levels of Runx2. As osteocalcin is a direct target of Runx2 (4), suppression of osteocalcin by CHOP may be induced by Runx2 expression. However, neither CHOP nor C/EBPß affected the expression of Runx2 (Fig. 3D). Thus, instead of regulating the expression levels of Runx2, C/EBPß and CHOP seem to modify the activity of Runx2.


Figure 3
View larger version (48K):
[in this window]
[in a new window]
  		FIG. 3. CHOP inhibits differentiation of calvarial osteoblasts. Primary calvarial osteoblasts were infected with LacZ or CHOP adenovirus at an MOI of 200 for each. (A) Osteoblasts were cultured with or without 50 µg/ml AA plus ß-GP for 16 days. ALP staining and ALP activity are shown. p-NP, p-nitrophenylphosphate.(B) Osteoblasts were cultured with or without AA-ß-GP and 300 ng/ml BMP-2 for 7 days. (C and D) Quantitative RT-PCR for osteocalcin and Runx2 was performed, and values were normalized to the amounts of HPRT1. a.a., AA; ß-gp, ß-GP; OC, osteocalcin.

Endogenous CHOP negatively regulates spontaneous osteoblast differentiation but promotes BMP-induced osteogenesis. To further investigate the physiological action of CHOP in osteoblast differentiation and to exclude the possibility of nonspecific responses driven by overexpression assays, we purified primary osteoblasts from calvaria of CHOP-deficient mice as well as their counterparts from wild-type mice. First, we evaluated expression levels of the CHOP protein in calvarial osteoblasts to see whether osteoblasts express sufficient amounts of CHOP to be knocked out. In immunoblot analysis of nuclear extracts from calvarial osteoblasts, wild-type cells showed an expression level of CHOP protein comparable to that of BMP-stimulated C2C12 cells (Fig. 4A), while CHOP–/– cells showed no visible band. Since BMP-treated C2C12 cells have higher expression levels of the CHOP protein than 3T3-L1 cells do (Fig. 1C) and since CHOP has been shown to exhibit a physiological function in 3T3-L1 cells, this expression level of CHOP in calvarial osteoblasts may be sufficient for the exhibition of certain biological effects in these cells.


Figure 4
View larger version (35K):
[in this window]
[in a new window]
  		FIG. 4. Endogenous CHOP has a dual effect on primary osteoblast differentiation. (A) Expression levels of the CHOP protein in wild-type and CHOP-null calvarial osteoblasts were assessed by immunoblot analysis and compared to that in C2C12 cells stimulated by BMP-2. Nuclear extracts were immunoblotted with anti-CHOP antibody and antilamin antibody (for a loading control). (B) Primary calvarial osteoblasts from two groups of littermates (four wild-type and three knockout mice total) were cultured without any stimulants for 6 days. Cells were subjected to ALP staining. (C) Total RNA from parallel samples shown in panel B was subjected to quantitative RT-PCR individually for Runx2, ALP, and osteocalcin, and values were normalized to the amounts of HPRT1. The expression levels of the two genotypes were compared and significance was determined by t testing. (D) Wild-type (litter II #7) and homozygous CHOP-null (litter II #6) osteoblasts were infected with LacZ or CHOP adenovirus at an MOI of 200 and subsequently cultured in normal medium for 11 days. ALP staining is shown. (E) Wild-type (litter II #7) and homozygous CHOP-null (litter II #6) osteoblasts were infected with LacZ or CHOP adenovirus at an MOI of 200 and cultured with AA-ß-GP plus 100 ng/ml BMP-2 for 4 days (ALP staining) or 11 days (von Kossa staining). (F) Osteoblasts treated in parallel with those shown in panels D and E were subjected to quantitative RT-PCR for ALP and osteocalcin at day 4. a.a., AA; ß-gp, ß-GP; OC, osteocalcin.

We obtained two litter sets of embryos, which harbored both wild-type and homozygous CHOP-null littermates. Levels of spontaneous osteoblast differentiation, as assessed by ALP activity, were compared between CHOP–/– osteoblasts and their counterparts from wild-type littermates (Fig. 4B). CHOP–/– osteoblasts showed higher expression of ALP than CHOP+/+ cells. RNA purified from the calvarial osteoblasts (four wild-type and three knockout mice) was subjected to quantitative RT-PCR individually, and the difference between the genotypes was statistically analyzed (Fig. 4C). Runx2 was unaffected, but ALP was significantly (P = 0.024) up-regulated in osteoblasts from knockout mice. The expression of osteocalcin was also induced in CHOP–/– cells, but less significantly (P = 0.138), which may be due to the sample size in the present study. Importantly, as shown by the activity of ALP, this enhanced osteogenesis in CHOP-null cells was restored by infection with the CHOP adenovirus (Fig. 4D).

However, when these cells were treated with AA-ß-GP plus BMP-2 to accelerate osteogenesis, the production of ALP and formation of mineralized bone nodules were significantly stronger in wild-type cells than in the CHOP–/– cells (Fig. 4E) and were suppressed by CHOP overexpression. This contradictory observation was confirmed by determining mRNA for ALP and osteocalcin (Fig. 4F). The expression of ALP and osteocalcin was significantly induced in CHOP–/– osteoblasts, an effect which was reversed by the CHOP adenovirus. Surprisingly, wild-type osteoblasts treated with AA-ß-GP plus BMP-2 showed higher expression of ALP and osteocalcin than CHOP–/– cells, an effect suppressed by the CHOP adenovirus, suggesting that the expression level of CHOP is an extremely important factor. These results suggest that endogenous CHOP plays a dual role in the regulation of committed osteoblast differentiation, depending on the presence or absence of BMP.

Endogenous CHOP negatively regulates adipocyte differentiation. Since the possible role of endogenous CHOP in adipocyte differentiation had not been examined previously, we examined adipogenesis in CHOP-deficient fibroblasts. Three independent fibroblasts derived from three pups were tested for both wild-type and CHOP-null genotypes (Fig. 5A). BMP-2 induced Nile red-positive adipocyte differentiation more strongly in CHOP–/– fibroblasts than in CHOP+/+ fibroblasts. Accordingly, induction of adipocyte differentiation markers such as PPAR{gamma}2 and aP2 in CHOP–/– primary fibroblasts was more prominent than that in wild-type fibroblasts (Fig. 5B). These results show that endogenous CHOP suppresses both osteoblast maturation and adipocyte differentiation, at least in a cell-autonomous fashion.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5. Inhibition of adipogenic differentiation by endogenous CHOP. (A) Primary fibroblasts from three individual wild-type and CHOP knockout littermates were infected or not with CHOP adenovirus and cultured with or without BMP-2 (100 ng/ml) for 10 days. Then, cells were examined for adipogenic differentiation by Nile red staining. (B) Primary fibroblasts from CHOP–/– and CHOP+/+ littermates were infected or not with CHOP adenovirus and cultured with or without BMP-2 (100 ng/ml) for 5 days. Then, levels of expression of PPAR{gamma}2 and aP2 were assessed by quantitative RT-PCR. mRNA values were normalized to the amounts of HPRT1.

CHOP suppresses cooperative induction of the osteocalcin gene by Runx2 and C/EBPß. Overexpression of CHOP in committed osteoblasts inhibited expression of osteocalcin (Fig. 3B and C), and deletion of CHOP showed enhanced osteocalcin expression in nonstimulated osteoblasts (Fig. 4C). Since the expression of osteocalcin is tightly regulated and limited exclusively in osteoblasts and odontoblasts, the osteocalcin promoter is therefore an excellent model to study the function of CHOP in osteoblast-specific gene expression. First, we asked whether CHOP affects Runx2-induced osteocalcin expression or not, since this gene is a direct target of Runx2. CHOP inhibited Runx2 adenovirus-induced ALP activity and osteocalcin mRNA in C2C12 cells (Fig. 6A, upper panels). This repression by CHOP was reproduced in a luciferase assay using a natural mouse osteocalcin promoter-reporter construct containing both C/EBP-binding element and Runx2-binding element (OSE2), on which the cooperation between Runx2 and C/EBPß has been reported to take place (10) (Fig. 6A, lower panel). Next, as CHOP is a dominant-negative molecule for C/EBPß and suppresses C/EBPß-mediated promotion of osteocalcin expression (Fig. 3C), we hypothesized that CHOP disrupts the cooperation between Runx2 and C/EBPß on the osteocalcin promoter. As previously described (10), C/EBPß and Runx2 synergistically induced osteocalcin mRNA and ALP activity in mesenchymal cells (Fig. 6B). Interestingly, CHOP reversed the cooperative induction of osteocalcin mRNA and ALP activity mediated by Runx2 and C/EBPß in a dose-dependent fashion. This effect was confirmed by the osteocalcin promoter luciferase assay (Fig. 6C). Thus, CHOP seemed to act in an inhibitory manner on the synergistic action of Runx2 and C/EBPß on the osteocalcin promoter.


Figure 6
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 6. CHOP interferes with cooperative induction of the osteocalcin gene by Runx2 and C/EBPß. (A) C2C12 cells were infected with LacZ or Runx2 adenovirus in combination with LacZ or CHOP virus at an MOI of 100 for each (total, 200 MOI per well) and cultured in normal medium for 7 days and subsequently ALP stained and subjected to quantitative RT-PCR for osteocalcin (upper panels). C2C12 cells were transfected with the osteocalcin gene promoter fused to the luciferase reporter construct and the phRL-TK-renilla reporter together with Runx2 and/or CHOP cDNAs (lower panel). Osteocalcin-Luc activity levels were normalized to the level of phRL-TK-renilla activity. (B) Primary fibroblasts were infected with the indicated adenoviruses at the MOIs shown and then subjected to quantitative RT-PCR for osteocalcin (day 5) and ALP staining (day 7). (C) C3H10T1/2 cells were transfected with the osteocalcin gene luciferase reporter and the phRL-TK-renilla reporter together with combinations of the indicated cDNAs. OC, osteocalcin.

CHOP interferes with the interaction between Runx2 and C/EBPß as well as the binding of C/EBPß to the osteocalcin promoter. C/EBPß has been reported to interact with Runx2, and this interaction is critical for the cooperative action of the two molecules in osteogenesis, at least in the induction of the osteocalcin gene (7). We therefore examined whether CHOP affects the interaction of C/EBPß with Runx2 by a coimmunoprecipitation assay. In transfected COS7 cells, CHOP formed heterodimers with C/EBPß and disrupted the C/EBPß homodimers (Fig. 7A, left half). C/EBPß also bound to Runx2 as previously reported, and importantly, CHOP blocked this interaction (Fig. 7A, right half).


Figure 7
View larger version (59K):
[in this window]
[in a new window]
  		FIG. 7. CHOP prevents interaction between Runx2 and C/EBPß as well as the binding of C/EBPß to the C/EBP-binding element of the osteocalcin promoter. (A) COS7 cells were transfected with various combinations of plasmids for C/EBPß, Runx2, or CHOP. The cell lysates were immunoprecipitated (IP) with anti-FLAG antibody and subsequently immunoblotted with anti-Myc antibody. (B) The lysates of COS7 cells transfected with pcDNA3 (control), 6x Myc-C/EBPß, or both 6x Myc-C/EBPß and Myc-CHOP were incubated with or without a biotinylated probe containing the C/EBP-binding element in the osteocalcin gene promoter (C/EBP-BEOG2). Proteins bound to the biotinylated probe were determined by immunoblotting with anti-Myc antibody. Ppt, precipitation. (C) Nuclear extracts from primary calvarial osteoblasts infected with indicated adenoviruses were subjected to EMSA with the biotinylated CEBP-BEOG2 probe. Unlabeled 200 molar excess oligonucleotides (wild-type [Wt] and mutant [Mut]) were added as competitors. Anti-C/EBPß antibody was used for the supershift experiment. (D) C2C12 cells were infected or not with CHOP adenovirus and cultured with or without BMP-2 (300 ng/ml) for 2 days. The lysates were subjected to ChIP. PCR amplification was performed using the primers specific for the osteocalcin promoter. {alpha}-, anti-; IgG, control mouse immunoglobulin G; N.C., negative control (water).

Since C/EBPß has been shown to bind to a consensus C/EBP-binding element in the osteocalcin gene promoter and since this binding is required for cooperation with Runx2, we determined whether CHOP affects the binding of C/EBPß to this element using a DNAP assay. As previously described (10), C/EBPß bound to this element. Surprisingly, CHOP blocked C/EBPß from binding to the DNA (Fig. 7B). This inhibitory effect of CHOP against C/EBPß was also observed in EMSA using the C/EBP-binding element probe (Fig. 7C). Finally, with a ChIP assay using BMP-2-treated C2C12 cells, we showed that endogenous C/EBPß bound to the endogenous osteocalcin promoter and that CHOP prevented the DNA binding of C/EBPß (Fig. 7D). Collectively, these findings suggest that CHOP suppresses osteocalcin expression by interfering with the interaction of C/EBPß with Runx2 as well as by preventing the binding of C/EBPß to the C/EBP-binding element on the promoter.


arrow
DISCUSSION
 
To determine the complexity of regulation of osteogenesis by the C/EBP family, we investigated the functional roles of CHOP in committed osteoblast differentiation using primary calvarial osteoblasts from wild-type and CHOP knockout mice. In the present study, we obtained the following findings: (i) endogenous CHOP is ubiquitously expressed, including in bone in vivo and in various mesenchymal cells, including primary calvarial osteoblasts; (ii) overexpression of CHOP leads to suppression of spontaneous osteoblast differentiation, as well as to suppression of enhanced differentiation by ascorbic acid and ß-glycerophosphate with or without BMP-2, accompanied by down-regulation of ALP and osteocalcin; (iii) the lack of CHOP expression results in an enhancement of the spontaneous differentiation of osteoblasts, accompanied by up-regulation of ALP and osteocalcin; (iv) under BMP-induced conditions, endogenous CHOP promotes osteogenesis; and (v) CHOP interferes with the binding of C/EBPß to Runx2 and to the C/EBP-binding element of the osteocalcin promoter.

In agreement with the present findings, several studies have demonstrated that C/EBPß promotes osteoblast differentiation of mesenchymal progenitor cells (7, 10). Importantly, in our in vitro study using CHOP-null calvarial osteoblasts, CHOP appeared to act as an inhibitor of spontaneous osteoblast differentiation. This finding indicates that a cell-autonomous activity of endogenous C/EBPß is stimulatory for osteogenesis. However, Iyer et al. reported that C/EBPß negatively regulates osteoblast differentiation of MC3T3-E1 cells (13). As it is possible that C/EBPß differentially regulates osteoblast differentiation in a cell-type- and context-dependent manner, we used primary calvarial osteoblasts to resolve this issue. In the primary osteoblasts, C/EBPß enhanced the osteoblast differentiation induced by AA-ß-GP plus BMP-2, and CHOP reduced this additional effect, indicating that C/EBPß promotes osteoblast maturation.

Of the various osteoblast differentiation markers we tested, CHOP mainly affected the expression of ALP and osteocalcin. We hypothesize that CHOP functions only on the promoters of osteoblast marker genes where cooperation between C/EBPß and Runx2 takes place. Since database analysis (www.cbrc.jp/research/db/TFSEARCH.html) of the human ALP promoter sequence indicates the presence of binding sites for both Runx2 and C/EBPß, ALP may be induced through a mechanism similar to that for induction of osteocalcin. It may also be important to determine whether functional C/EBP elements are absent in the promoters of osteogenic genes that do not respond to CHOP.

In contrast to our present findings, Pereira et al. reported that CHOP introduced by a retrovirus system promoted the osteoblast differentiation of ST-2 stromal cells (23). We also tested the effect of CHOP on ST-2 cells and found that CHOP acts bidirectionally to the osteoblast differentiation of ST-2. We could not conduct the long-term culture experiment to examine the effect of CHOP virus alone as Pereira et al. did, since we had undertaken a transient adenovirus induction system. When ST-2 cells were treated with BMP-2 plus ascorbic acid, CHOP showed some suppressive effects on osteoblast differentiation (data not shown). The adipocyte differentiation driven by the same stimulant in ST-2 was clearly inhibited by CHOP (data not shown). However, when induced with Runx2 adenovirus without any stimulants, CHOP promoted osteoblast differentiation of ST-2 cells (data not shown), supporting the findings by Pereira et al. Moreover, adenoviruses carrying Runx2 and C/EBPß did not show synergism in ALP production (data not shown). These differences may be derived from the status of the cells, since ST-2 cells are osteoblast/adipocyte progenitors and calvarial cells are committed osteoblasts. Also, the expression profiles of basic leucine zipper (bZIP) proteins other than those of the C/EBP family in terms of the formation of heterodimers with CHOP may differ between the cell types. Recently, bZIP protein ATF4 has been reported to be critical in osteogenesis (32), and the ATF4 protein is present exclusively in committed osteoblasts (31). To address these possibilities, we used calvarial osteoblasts. However, we found that endogenous CHOP also has dual functions in the differentiation of calvarial osteoblasts, depending on the BMP signals. Pereira et al. reported that CHOP enhanced the BMP signals without affecting the phosphorylation of Smad1/5/8, the direct mediators of BMP signaling (23). We also obtained similar evidence, as shown in Fig. 4E and F. Therefore, CHOP may inhibit Runx2/C/EBPß-mediated promotion of osteogenesis independent of BMP signaling (Fig. 8). Once BMP signaling becomes active, CHOP may indirectly enhance BMP signals through unknown mechanisms, resulting in accelerated osteogenesis (Fig. 8). Thus, these two pathways have to be well balanced in vivo during osteogenesis. Recently, Pereira et al. (25) reported that CHOP-null mice exhibit no skeletal phenotype in vivo. This finding suggests that CHOP may act mainly in de novo bone formation stages, such as during fracture repair and response to gravity stress, while the lack of CHOP during development may be compensated by other molecules. Thus, further analyses of CHOP-null mice under de novo bone formation conditions may be required. Since CHOP seems to have these two opposite roles, it is also possible that the loss of CHOP may result in the inhibition of Runx2/C/EBPß-mediated osteoblast differentiation and the enhancement of BMP signals simultaneously and that these alterations may be compensated by each other to gain normal bone phenotype.


Figure 8
View larger version (9K):
[in this window]
[in a new window]
  		FIG. 8. Proposed model for the dual function of CHOP in osteoblast differentiation. Runx2 plays indispensable roles in commitment and maturation of osteoblasts. C/EBPß cooperates with Runx2 to accelerate osteoblast differentiation. CHOP blocks C/EBPß from accessing Runx2 and binding the promoters of osteogenic marker genes. BMP signaling positively acts on osteoblast differentiation. Under such conditions, CHOP enhances BMP signaling indirectly, resulting in accelerated osteoblast differentiation.

Previous studies and the present findings demonstrate that C/EBPß and Runx2 cooperatively enhance the expression of osteoblast-specific genes, including those encoding ALP and osteocalcin(7, 10) (Fig. 6B and C). Notably, C/EBPß has the ability to bind to Runx2, and this binding is required for their cooperative activation of the osteocalcin promoter (7). Interestingly, we found that CHOP blocked the association of C/EBPß with Runx2 (Fig. 7A). Moreover, the C/EBP regulatory element in the osteocalcin promoter has been reported to be critical for this process (7, 10). Using DNAP, EMSA, and ChIP assays, we found that CHOP prevented the binding of C/EBPß to this element (Fig. 7B, C, and D). Since CHOP itself does not bind to this DNA element (Fig. 7C), it interferes with the binding of C/EBPß to the C/EBP element not by occupying the element but by forming a heterodimer which cannot accessthe element. These findings suggest that CHOP disrupts the functional bridging between C/EBPß and Runx2, which is critical for full activation of the promoter. Thus, through analysis of the role of CHOP in osteoblast differentiation, we have elucidated the function of C/EBPß in the promotion of osteoblast differentiation as a cofactor with Runx2.

In conclusion, the findings of the present study clearly suggest that CHOP, a naturally occurring dominant-negative C/EBP family member, regulates osteoblast differentiation at least in part by interfering with the Runx2 cofactor C/EBPß and probably by accelerating BMP signaling. Further studies of CHOP-deficient mice in de novo bone formation processes should improve understanding of the importance of CHOP in osteogenesis.


arrow
ACKNOWLEDGMENTS
 
We thank A. Hanyu, N. Kaneniwa, E. Kobayashi, and Y. Yuuki (The Cancer Institute) for technical assistance.

This research was supported by grants-in-aid for scientific research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. T.I. was supported by the Tokyo Biochemical Research Foundation and the Takeda Science Foundation. S.M. was supported by the Takeda Science Foundation and the Uehara Memorial Foundation.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, The Cancer Institute of the Japanese Foundation for Cancer Research (JFCR), 3-10-6, Ariake, Koto-ku, Tokyo 135-8550, Japan. Phone: 81-3-3570-0459. Fax: 81-3-3570-0459. E-mail: timamura-ind{at}umin.ac.jp. Back

{dagger} These authors contributed equally. Back


arrow
REFERENCES
 
    1
  1. Bachner, D., M. Ahrens, D. Schroder, A. Hoffmann, J. Lauder, N. Betat, P. Steinert, L. Flohe, and G. Gross. 1998. Bmp-2 downstream targets in mesenchymal development identified by subtractive cloning from recombinant mesenchymal progenitors (C3H10T1/2).Dev. Dyn. 213:398-411.[CrossRef][Medline]
    2. 2
  2. Barone, M. V., A. Crozat, A. Tabaee, L. Philipson, and D. Ron.1994 . CHOP (GADD153) and its oncogenic variant, TLS-CHOP, have opposing effects on the induction of G1/S arrest. Genes Dev. 15:453-464.
    3. 3
  3. Batchvarova, N., X. Z. Wang, and D. Ron. 1995. Inhibition of adipogenesis by the stress-induced protein CHOP (Gadd153).EMBO J. 14:4654-4661.[Medline]
    4. 4
  4. Ducy, P., R. Zhang, V. Geoffroy, A. L. Ridall, and G. Karsenty.1997 . Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89:747-754.[CrossRef][Medline]
    5. 5
  5. Ebisawa, T., M. Fukuchi, G. Murakami, T. Chiba, K. Tanaka, T. Imamura, and K. Miyazono. 2001. Smurf1 interacts with transforming growth factor-ß type I receptor through Smad7 and induces receptor degradation. J. Biol. Chem. 276:12477-12480.[Abstract/Free Full Text]
    6. 6
  6. Fujii, M., K. Takeda, T. Imamura, H. Aoki, T. K. Sampath, S. Enomoto, M. Kawabata, M. Kato, H. Ichijo, and K. Miyazono.1999 . Roles of bone morphogenetic protein type I receptors and Smad proteins in osteoblast and chondroblast differentiation.Mol. Biol. Cell 10:3801-3813.[Abstract/Free Full Text]
    7. 7
  7. Gutierrez, S., A. Javed, D. K. Tennant, M. van Rees, M. Montecino, G. S. Stein, J. L. Stein, and J. B. Lian. 2002. CCAAT/enhancer-binding proteins (C/EBP) ß and {delta} activate osteocalcin gene transcription and synergize with Runx2 at the C/EBP element to regulate bone-specific expression. J. Biol. Chem. 277:1316-1323.[Abstract/Free Full Text]
    8. 8
  8. Hanai, J., L. F. Chen, T. Kanno, N. Ohtani-Fujita, W. Y. Kim, W. H. Guo, T. Imamura, Y. Ishidou, M. Fukuchi, M. J. Shi, J. Stavnezer, M. Kawabata, K. Miyazono, and Y. Ito. 1999. Interaction and functional cooperation of PEBP2/CBF with Smads. J. Biol. Chem. 274:31577-31582.[Abstract/Free Full Text]
    9. 9
  9. Harrison, J. R., Y. F. Huang, K. A. Wilson, P. L. Kelly, D. J. Adams, G. A. Gronowicz, and S. H. Clark. 2005. Col1a1 promoter-targeted expression of p20 CCAAT enhancer-binding protein ß (C/EBP ß), a truncated C/EBP ß isoform, causes osteopenia in transgenic mice. J. Biol. Chem. 280:8117-8124.[Abstract/Free Full Text]
    10. 10
  10. Hata, K., R. Nishimura, M. Ueda, F. Ikeda, T. Matsubara, F. Ichida, K. Hisada, T. Nokubi, A. Yamaguchi, and T. Yoneda. 2005. A CCAAT/Enhancer binding protein ß isoform, liver-enriched inhibitory protein, regulates commitment of osteoblasts and adipocytes.Mol. Cell. Biol. 25:1971-1979.[Abstract/Free Full Text]
    11. 11
  11. Hattori, T., N. Ohoka, Y. Inoue, H. Hayashi, and K. Onozaki.2003 . C/EBP family transcription factors are degraded by the proteasome but stabilized by forming dimer. Oncogene 22:1273-1280.[CrossRef][Medline]
    12. 12
  12. Hennings, H., D. Michael, C. Cheng, P. Steinert, K. Holbrook, and S. H. Yuspa. 1980. Calcium regulation of growth and differentiation of mouse epidermal cells in culture.Cell 19:245-254.[CrossRef][Medline]
    13. 13
  13. Iyer, V. V., T. B. Kadakia, L. R. McCabe, and R. C. Schwartz. 2004. CCAAT/enhancer-binding protein-ß has a role in osteoblast proliferation and differentiation. Exp. Cell Res. 295:128-137.[CrossRef][Medline]
    14. 14
  14. Kinoshita, S., S. Akira, and T. Kishimoto. 1992. A member of the C/EBP family, NF-IL6 ß, forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc. Natl. Acad. Sci. USA 89:1473-1476.[Abstract/Free Full Text]
    15. 15
  15. Komori, T., H. Yagi, S. Nomura, A. Yamaguchi, K. Sasaki, K. Deguchi, Y. Shimizu, R. T. Bronson, Y. H. Gao, M. Inada, M. Sato, R. Okamoto, Y. Kitamura, S. Yoshiki, and T. Kishimoto.1997 . Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts.Cell 89:755-764.[CrossRef][Medline]
    16. 16
  16. Maeda, S., M. Hayashi, S. Komiya, T. Imamura, and K. Miyazono.2004 . Endogenous TGF-ß signaling suppresses maturation of osteoblastic mesenchymal cells. EMBO J. 23:552-563.[CrossRef][Medline]
    17. 17
  17. Miyake, S., M. Makimura, Y. Kanegae, S. Harada, Y. Sato, K. Takamori, C. Tokuda, and I. Saito. 1996. Efficient generation of recombinant adenoviruses using adenovirus DNA-terminal protein complex and a cosmid bearing the full-length virus genome. Proc. Natl. Acad. Sci. USA 93:1320-1324.[Abstract/Free Full Text]
    18. 18
  18. Mundlos, S., F. Otto, C. Mundlos, J. B. Mulliken, A. S. Aylsworth, S. Albright, D. Lindhout, W. G. Cole, W. Henn, J. H. Knoll, M. J. Owen, R. Mertelsmann, B. U. Zabel, and B. R. Olsen.1997 . Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89:773-779.[CrossRef][Medline]
    19. 19
  19. Nakashima, K., X. Zhou, G. Kunkel, Z. Zhang, J. M. Deng, R. R. Behringer, and B. de Crombrugghe. 2002. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108:17-29.[CrossRef][Medline]
    20. 20
  20. Ogasawara, A., T. Arakawa, T. Kaneda, T. Takuma, T. Sato, H. Kaneko, M. Kumegawa, and Y. Hakeda. 2001. Fluid shear stress-induced cyclooxygenase-2 expression is mediated by C/EBP ß, cAMP-response element-binding protein, and AP-1 in osteoblastic MC3T3-E1 cells. J. Biol. Chem. 276:7048-7054.[Abstract/Free Full Text]
    21. 21
  21. Oyadomari, S., K. Takeda, M. Takiguchi, M. Matsumoto, I. Wada, S. Akira, E. Araki, and M. Mori. 2001. Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc. Natl. Acad. Sci. USA 98:10845-10850.[Abstract/Free Full Text]
    22. 22
  22. Park, J. S., J. D. Luethy, M. G. Wang, J. Fargnoli, A. J. Fornace, Jr., O. W. McBride, and N. J. Holbrook. 1992. Isolation, characterization and chromosomal localization of the human GADD153 gene. Gene 116:259-267.[CrossRef][Medline]
    23. 23
  23. Pereira, R. C., A. M. Delany, and E. Canalis.2004 . CCAAT/enhancer binding protein homologous protein (DDIT3) induces osteoblastic cell differentiation.Endocrinology 145:1952-1960.[Abstract/Free Full Text]
    24. 24
  24. Pereira, R. C., A. M. Delany, and E. Canalis.2002 . Effects of cortisol and bone morphogenetic protein-2 on stromal cell differentiation: correlation with CCAAT-enhancer binding protein expression. Bone 30:685-691.[Medline]
    25. 25
  25. Pereira, R. C., L. Stadmeyer, S. J. Marciniak, D. Ron, and E. Canalis. 2006. C/EBP homologous protein is necessary for normal osteoblastic function. J. Cell. Biochem. 97:633-640.[CrossRef][Medline]
    26. 26
  26. Pittenger, M. F., A. M. Mackay, S. C. Beck, R. K. Jaiswal, R. Douglas, J. D. Mosca, M. A. Moorman, D. W. Simonetti, S. Craig, and D. R. Marshak. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284:143-146.[Abstract/Free Full Text]
    27. 27
  27. Ramji, D. P., and P. Foka. 2002. CCAAT/enhancer-binding proteins: structure, function and regulation.Biochem. J. 365:561-575.[Medline]
    28. 28
  28. Ron, D., and J. F. Habener. 1992. CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes Dev. 6:439-453.[Abstract/Free Full Text]
    29. 29
  29. Tanaka, T., N. Yoshida, T. Kishimoto, and S. Akira. 1997. Defective adipocyte differentiation in mice lacking the C/EBPß and/or C/EBP{delta} gene. EMBO J. 16:7432-7443.[CrossRef][Medline]
    30. 30
  30. Wu, Z., Y. Xie, N. L. Bucher, and S. R. Farmer.1995 . Conditional ectopic expression of C/EBPß in NIH-3T3 cells induces PPAR{gamma} and stimulates adipogenesis.Genes Dev. 9:2350-2363.[Abstract/Free Full Text]
    31. 31
  31. Yang, X., and G. Karsenty. 2004. ATF4, the osteoblast accumulation of which is determined posttranslationally, can induce osteoblast-specific gene expression in non-osteoblastic cells.J. Biol. Chem. 279:47109-47114.[Abstract/Free Full Text]
    32. 32
  32. Yang, X., K. Matsuda, P. Bialek, S. Jacquot, H. C. Masuoka, T. Schinke, L. Li, S. Brancorsini, P. Sassone-Corsi, T. M. Townes, A. Hanauer, and G. Karsenty. 2004. ATF4 is a substrate of RSK2 and an essential regulator of osteoblast biology; implication for Coffin-Lowry Syndrome. Cell 117:387-398.[CrossRef][Medline]

Molecular and Cellular Biology, August 2006, p. 6105-6116, Vol. 26, No. 16
0270-7306/06/$08.00+0     doi:10.1128/MCB.02429-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Zanotti, S., Stadmeyer, L., Smerdel-Ramoya, A., Durant, D., Canalis, E. (2009). Misexpression of CCAAT/enhancer binding protein beta causes osteopenia. J Endocrinol 201: 263-274 [Abstract] [Full Text]  
  • Tominaga, H., Maeda, S., Hayashi, M., Takeda, S., Akira, S., Komiya, S., Nakamura, T., Akiyama, H., Imamura, T. (2008). CCAAT/Enhancer-binding Protein {beta} Promotes Osteoblast Differentiation by Enhancing Runx2 Activity with ATF4. Mol. Biol. Cell 19: 5373-5386 [Abstract] [Full Text]  
  • Cucinotta, M., Visalli, M., Aguennouz, M., Valenti, A., Loddo, S., Altucci, L., Teti, D. (2008). Regulation of Interleukin-8 Gene at a Distinct Site of Its Promoter by CCAAT Enhancer-binding Protein Homologous Protein in Prostaglandin E2-treated Human T Cells. J. Biol. Chem. 283: 29760-29769 [Abstract] [Full Text]  
  • Yamakawa, T., Whitson, R. H., Li, S.-L., Itakura, K. (2008). Modulator Recognition Factor-2 Is Required for Adipogenesis in Mouse Embryo Fibroblasts and 3T3-L1 Cells. Mol. Endocrinol. 22: 441-453 [Abstract] [Full Text]  
  • Hayashi, M., Maeda, S., Aburatani, H., Kitamura, K., Miyoshi, H., Miyazono, K., Imamura, T. (2008). Pitx2 Prevents Osteoblastic Transdifferentiation of Myoblasts by Bone Morphogenetic Proteins. J. Biol. Chem. 283: 565-571 [Abstract] [Full Text]  
  • Wiper-Bergeron, N., St-Louis, C., Lee, J. M. (2007). CCAAT/Enhancer Binding Protein {beta} Abrogates Retinoic Acid-Induced Osteoblast Differentiation via Repression of Runx2 Transcription. Mol. Endocrinol. 21: 2124-2135 [Abstract] [Full Text]  
  • Lawrence, M. C., McGlynn, K., Naziruddin, B., Levy, M. F., Cobb, M. H. (2007). Inaugural Article: Differential regulation of CHOP-10/GADD153 gene expression by MAPK signaling in pancreatic beta-cells. Proc. Natl. Acad. Sci. USA 104: 11518-11525 [Abstract] [Full Text]  
  • Mameli, G., Deshmane, S. L., Ghafouri, M., Cui, J., Simbiri, K., Khalili, K., Mukerjee, R., Dolei, A., Amini, S., Sawaya, B. E. (2007). C/EBPbeta regulates human immunodeficiency virus 1 gene expression through its association with cdk9. J. Gen. Virol. 88: 631-640 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirakawa, K.
Right arrow Articles by Imamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirakawa, K.
Right arrow Articles by Imamura, T.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»