Previous Article | Next Article ![]()
Molecular and Cellular Biology, August 2006, p. 6197-6208, Vol. 26, No. 16
0270-7306/06/$08.00+0 doi:10.1128/MCB.02214-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Cellular and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229,1 Department of Periodontics, University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229,2 Department of Orthopedics, University of Rochester Medical Center, Rochester, New York 146423
Received 15 November 2005/ Returned for modification 22 December 2005/ Accepted 25 May 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
BMP-2 has been shown to play a major role in chondrogenic and osteogenic differentiation. BMP-2 is involved in almost every aspect of chondrogenesis, including commitment to the chondrogenic lineage and development of the growth plate (11, 51, 59). BMP-2 also promotes commitment of pluripotent mesenchymal cells to the osteoblast lineage by regulating signals that stimulate specific transcriptional programs required for bone formation (7, 39, 43). The bone-inducing function of BMP-2 has also been demonstrated in studies of subcutaneous or intramuscular implantation of BMP-2 into rodents, where BMP-2 induces ectopic cartilage and bone formation in a similar manner to endochondral bone formation (55, 61). This activity has been applied to repair bone defects in humans (4, 20).
BMP-2 is an autocrine and paracrine growth factor. The BMP-2 gene has been mapped to chromosome 3 and contains an 11-kb transcription unit and three exons (12, 21). BMP-2 is expressed from the early stages of embryonic development and in adulthood, primarily in bone-forming tissues (2). During osteoblastic differentiation, BMP-2 mRNA is induced and maintains the sustained phenotype of mature osteoblasts (17, 23). It has been found that BMP-2 expression in bones of aged animals is significantly decreased (34, 49), suggesting that BMP-2 expression may play a role in bone remodeling in aging. A recent human genetic study indicated that polymorphisms of BMP-2 gene expression are linked to a high risk for osteoporosis (47). Previous studies have indicated that the regulation of BMP-2 gene expression during limb morphogenesis and osteoblast differentiation may involve multiple signaling pathways (1, 3, 15, 19, 24, 25, 53), suggesting considerable complexity in BMP-2 gene regulation. Our group has previously characterized the 5'-flanking region of the mouse BMP-2 gene and identified several cis elements in the BMP-2 promoter which are likely required for its transcriptional regulation (12, 13, 14, 19). However, the precise mechanisms responsible for BMP-2 gene regulation during osteoblast differentiation and bone formation are not well elucidated.
Previous studies of Drosophila melanogaster have found that Sonic hedgehog (Shh) signaling, which is important in the development of a wide variety of tissues (29, 52), enhances decapentaplegic (dpp) gene expression by the transcription factor Cubitus interruptus (Ci) (38). dpp is the ortholog of mammalian BMP-2 and -4. In mammals, Shh signaling has been shown to be necessary for skeletogenesis, as deletion of the Shh gene causes severe distal anterior/posterior skeletal abnormalities (9). Shh signaling in vertebrates is mediated by the Gli family of zinc finger proteins, the mammalian homologues of Drosophila Ci. Three Gli family members, Gli1, Gli2, and Gli3, have been identified (28, 32), and these Gli proteins play an essential role in embryonic development by regulating Shh target genes through Gli binding sites (38, 45). Disruption of Gli genes results in diverse developmental defects and abnormalities in multiple tissues and organs (5, 9, 36, 37). The Gli family is thought to have similar functions in mammalian cells to those of Ci. In the absence of Shh, these proteins undergo proteolytic processing, by which Gli3 is cleaved to form C-terminally truncated Gli3, while Gli2 is completely degraded. Available data suggest that the predominant functional form of Gli3 is truncated Gli3, which functions as a transcriptional repressor. In contrast, the Gli2 protein is a major transactivator of many Shh target genes (16, 46, 54). Genetic studies have shown that null mutations of Gli2 and/or Gli3 result in severe defects in skeletal development in mice and humans (6, 22, 35, 36).
Based on this information, we hypothesized that the Shh signaling mediators Gli2 and Gli3 play important roles in regulating BMP-2 gene expression for osteoblast differentiation. In the present study, we determined the function of Gli2 on BMP-2 gene transcription. We found that Gli2 is a powerful transactivator of the BMP-2 gene in vitro and in vivo and that overexpression of Gli2 in osteoblast precursor cells induces osteoblast differentiation. These results provide new insights into the molecular mechanisms responsible for BMP-2 gene regulation during osteogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and transfection.
C3H10T1/2 and 2T3 cells were cultured in
-minimal essential medium (
-MEM), and C2C12 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). cDNA expression plasmids were transiently transfected into cells by using Lipofectamine Plus reagents following the manufacturer's instructions (Invitrogen, Carlsbad, CA).
DNA constructs and promoter mutation.
For construction of mouse BMP-2 promoter reporters, a series of deletion cassettes of the 5' promoter region of the mouse BMP-2 gene (16, 19), including 2712/+165, 1997/+165, 1803/+165, 838/+165, 310/+165, 212/+165, and 150/+165, were linked to firefly luciferase in the pGL3 vector. Mutant promoter constructs (
BS1,
BS2, and
BS3) were made in which the putative Gli binding sites in the BMP-2 promoter were mutated, using the GeneEditor in vitro site-directed mutagenesis system (Promega) and the mutant oligonucleotides 5'-AAGCCAGCAGGCACGCGTCAAGGTGGAGTAAC, 5'-CTTCGGAGCGCGAGGATCCCGGTTTGGCAACCCGAG, and 5'-GAGCGCTGATGGGGGCCCGCCAGAGTCAGGC for BS1, BS2, and BS3, respectively. A mouse BMP-4 promoter reporter construct was made by inserting a 3.6-kb BMP-4 5'-flanking sequence into the pGL3 vector. The Gli-responsive reporter construct 8x3'Gli-BS
5/LucII, which contains multiple copies of Gli response elements, and the expression plasmids for Gli1, Gli2, and Gli3 were kindly provided by Hiroshi Sasaki (46). Gli1 was cloned into pcDNA3. Gli2, Gli2
N2, and Gli2
C4 were cloned into the pcDNA3.1/His vector. Gli3 and trGli3 were cloned into the pact vector under the control of the ß-actin promoter.
Promoter reporter luciferase assay. C2C12 cells were plated into 24-well plates at 4 x 104 cells per well in DMEM with 10% FCS 18 to 24 h prior to transfection. Cells were incubated for 4 h at 37°C with 250 µl of Opti-MEM transfection solution containing Lipofectamine Plus reagent, 0.5 µg of reporter plasmids, 0.1 µg of pSV-ß-galactosidase (ß-Gal) expression vector (Promega, Madison, WI), and 0 to 0.5 µg of different Gli expression constructs. After 4 h of incubation, 250 µl of fresh DMEM containing 20% FCS was added. The cells were cultured for 24 to 48 h and lysed with 100 µl of reporter lysis buffer (Promega). The luciferase activities of cell lysates were measured by a luciferase assay kit (Promega) and normalized with ß-Gal activity (63).
Reverse transcription-PCR (RT-PCR). Total RNAs of the cells receiving different treatments were extracted using the RNA STAT-60 reagent (TEL-TEST, Inc., Friendswood, TX). The purified RNAs were reverse transcribed into cDNAs by using the SuperScript III first-strand synthesis system (Invitrogen), and the synthesized cDNAs were amplified by PCR for 35 cycles (94°C for 1 min, 56°C for 1 min, and 72°C for 1 min). The mouse primers used were as follows: for Ptc1, 5'-AACAAAAATTCAACCAAACCTC and 5'-TGTCTTCATTCCAGTTGATGTG; for Smo, 5'-TGCCACCAGAAGAACAAGCCA and 5'-GCCTCCATTAGGTTAGTGCGG; for BMP-2, 5'-TGAGGATTAGCAGGTCTTTG and 5'-CACAACCATGTCCTGATAAT; for Gli2, 5'-GATATCTCCTTGATGCGACTT and 5'-TGCTACTGCTGCTGAGTTGGG; for Gli3, 5'-TCCATGGCTCTCTACCACATC and 5'-GTGGCAGCTGAGGGAAGGAT; and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'-CACCATGGAGAAGGCCGGG and 5'-GACGGACACATTGGGGGTAG.
Real-time PCR. Quantitative PCR was performed using the QuantiTect SYBR green PCR system (QIAGEN, Valencia, CA). Mouse BMP-2 primers (5'-TGAGGATTAGCAGGTCTTTG and 5'-CACAACCATGTCCTGATAA) were added to 25 µl of QuantiTect SYBR green PCR master mix containing test cDNA, PCR was performed, and the quantitative real-time PCR value was analyzed using an ABI sequence detection system (Applied Biosystems, CA) following the manufacturer's instructions. The BMP-2 mRNA signal was normalized with GAPDH.
RNA interference (RNAi). Both sense and antisense DNA oligonucleotides (56 nucleotides), each containing two 21-nucleotide copies of palindromic sequence identical to that of Gli2 cDNA, were designed with the siRNA Wizard program (Invivogen, San Diego, CA). The synthesized and annealed short double-stranded DNA was inserted into a small interfering RNA (siRNA)-expressing vector carrying a neomycin resistance selection cassette (Invivogen). The psiRNA-Gli2 plasmid, which expresses Gli2 siRNA hairpins in cells, was transfected into the target osteoblasts with Lipofectamine Plus reagents (Invitrogen), and the cells were selected with G418. Reduced expression of Gli2 in the cell colonies was confirmed by both RT-PCR and Western blotting.
Gli2 null mutant mice. Gli2wt/zfd heterozygous knockout mice were obtained from Alexandra Joyner's lab. Mice were maintained as heterozygotes and crossed to generate mutant combinations. Fetal mice (embryonic day 20.5 [E20.5]) were genotyped by PCR analysis of tail genomic DNA with Gli2 sense (5'-AAACAAAGCTCCTGTACACG), Gli2 antisense (5'-CACCCCAAAGCATGTGTTTT), and pPNT (5'-ATGCCTGCTCTTTACTGAAG) primers (36). The homozygous mutants (Gli2zfd/zfd) and their wild-type littermates (Gli2wt/wt) were used for in situ hybridization and immunohistochemistry (IHC).
Immunoblotting. In RNAi studies, C2C12 cells expressing Gli2 siRNA were cultured in six-well plates and transfected with His-tagged Gli2 expression plasmid and cultures for 30 h. In PKA experiments, C3H10T1/2 cells were transfected with His-Gli2 and treated with compound KT5720 at 2 µM for 30 h. After that, the cells were lysed with sodium dodecyl sulfate (SDS)-radioimmunoprecipitation assay lysate buffer containing the protease inhibitors phenylmethylsulfonyl fluoride (1 mM), aprotinin (10 µg/ml), and leupeptin (10 µg/ml). SDS sample buffer (2x) containing 0.5 M ß-mercaptoethanol was added. The sample was loaded into a Mini-Protein II SDS-PAGE Ready gel (Bio-Rad, Hercules, CA). Proteins were transblotted from the gel onto a polyvinylidene difluoride membrane (Bio-Rad) in transblotting buffer (25 mM Tris, 192 mM glycine, and 20% [vol/vol] methanol, pH 8.3) at 4°C for 1 h. The membrane was blocked with 5% milk in Tris-buffered saline with 0.1% Tween 20 (TBS-T) for 1 h at room temperature and incubated with rabbit Omni Probe anti-His antibody (Santa Cruz, CA) diluted 1:2,000 in 5% milk in TBS-T at 4°C overnight. After being washed, the membrane was incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (IgG) antibody (Amersham Biosciences, Buckinghamshire, United Kingdom) diluted 1:5,000 at room temperature for 1 h. The membrane was then washed six times with TBS-T for 5 min each time. Immunostaining was detected using an enhanced chemiluminescence (ECL) system (Amersham) with exposure on X-ray film. The His-Gli2 protein signal was normalized to the GAPDH protein level.
Immunohistochemistry. Formalin-fixed, paraffin-embedded embryos were sectioned at 4 to 6 µm and applied to slides. After deparaffinization, the slides were treated with 10 mM sodium citrate, pH 6.0, at 95°C for 5 min and then immunostained using the ImmunoCruz staining system (Santa Cruz), which utilizes an HRP-streptavidin complex. Goat anti-BMP-2 antibody (sc-6895; Santa Cruz) was used as the first antibody at a 1:200 dilution. The visible brown staining of the HRP substrate was analyzed by the automated image analysis program Image-Pro Plus (Media Cybernetics, Silver Spring, MD).
In situ hybridization. Embryos were fixed overnight in fresh 10% paraformaldehyde in RNase-free PBS, transferred via an ethanol series to 100% ethanol, followed by methanol and xylene, and finally embedded in wax. Ten-micrometer-thick sections were placed on microscope slides, dewaxed, and utilized for in situ hybridization. A 1.0-kb mouse BMP-2 RNA probe was hybridized to these sections, and the hybridized tissues were subsequently stained with HRP as described previously (19). The stained images were captured with a Nikon E400 microscope.
ALP activity assay.
C2C12 cells, 2T3 cells, or primary calvarial cells isolated from newborn Gli2zfd/zfd mice were seeded into 48-well plates in DMEM or
-MEM with 10% FCS. The cells were treated with Shh or cyclopamine or transfected with Gli2 expression plasmid for 2 to 5 days in medium with 2.5% FCS. The cells were then lysed with 0.05% Triton X-100 buffer. The cell lysate was analyzed for alkaline phosphatase (ALP) activity in a 96-well plate. Ten microliters of lysate was incubated with 90 µl of fresh AMP solution containing p-nitrophenol phosphate substrate at 37°C for 30 to 60 min. One hundred microliters of 0.5 N NaOH was added to stop the reaction. The plates were read at 405 nm. ALP activity was determined by using a p-nitrophenol standard curve and normalized to the amount of cell protein (16, 63, 64).
Mineralized matrix formation.
2T3 cells or calvarial cells from Gli2zfd/zfd mice were cultured in 12-well plates in
-MEM with 10% FCS, and the cells were treated with BMP-2 or transfected with Gli2 expression vector. When the cells reached confluence, the medium was changed, and 100 µg/ml ascorbic acid and 5 mM ß-glycerol phosphate were added. The medium was changed every other day. On day 15, the cultures were harvested. Cells were washed, fixed in phosphate-buffered formalin for 10 min, and then washed with water. For von Kossa staining, a 2% silver nitrate solution was added, and the plate was exposed to sunlight for 20 min and then rinsed with water. Five percent sodium thiosulfate was added for 3 min, followed by a rinse. The modified van Gieson stain was then used as a counterstain after the von Kossa stain. The area of von Kossa-stained matrix was quantified by automated image analysis using a video analysis program (62, 64).
ChIP. C3H10T1/2 and C2C12 cells (1 x 106) cultured in 100-mm petri dishes were transfected with Gli2 expression plasmid for 24 h and treated with 1% formaldehyde for 10 min to cross-link chromatin. Chromatin immunoprecipitation (ChIP) assays were performed following the protocol of a ChIP kit (Upstate, MA). Briefly, the cells were scraped and sonicated on ice to shear chromatin DNA down to 0.2- to 1.0-kb fragments. The sonicated cell supernatant was diluted and precleared with a protein A agarose-salmon sperm DNA slurry. The protein A bead pellet was discharged, and anti-Gli2 antibody (a gift provided by Philip Beachy) was added to the supernatant at 4°C overnight with rotation, followed by incubation with fresh protein A agarose beads for 1 h at 4°C for precipitation. The specific protein-DNA complex was reversely cross-linked, and DNA fragments were purified. With these DNAs as templates, PCRs were performed using primer set 1 (P1, TTTTAGCAGCACCTCTCTG; and P2, AACCATTGCTTCTGTCATC) and primer set 2 (P3, CTGCCACAAAAGACACTTG; and P4, AAGGGCGCAGCGAAGATCTG). The input was the positive control. No IgG or normal goat IgG (sc-2028; Santa Cruz) was the negative control.
EMSA. Approximately 2 x 106 to 4 x 106 C3H10T1/2 cells transfected with His-Gli2 were collected by digestion, and nuclear extracts were prepared using an NE-PER nuclear extract reagent kit (Pierce, IL). Oligonucleotide DNA probes containing wild-type or mutant Gli binding sites were end labeled with biotin by using a biotin 3'-end DNA labeling kit (Pierce). Electrophoresis mobility shift assays (EMSAs) were performed using a chemiluminescent EMSA kit (Pierce) according to the manufacturer's instructions. Briefly, DNA-protein binding reactions were carried out by incubating 2- to 3-µl nuclear protein extracts with 20 fmol of labeled and/or 100- to 200-fold unlabeled probe in a 20-µl volume at room temperature for 20 min. The 20-µl binding reaction mixes were then subjected to gel electrophoresis on a 5% polyacrylamide gel (Bio-Rad) and transferred to a nylon membrane. Biotin-labeled DNA was detected by using a streptavidin-HRP conjugate and a chemiluminescent substrate. To examine supershifts of DNA-protein complexes, Omni Probe anti-His antibody (Santa Cruz) was added to DNA-protein reactions and loaded into the gel.
| RESULTS |
|---|
|
|
|---|
|
500 ng/well, increased BMP-2 promoter activity in a dose-dependent manner, with maximal enhancement of up to 10-fold (Fig. 2B). To determine if Gli2 regulates BMP-2 mRNA expression, we performed quantitative PCR experiments. C2C12 and 2T3 cells were transiently transfected with Gli2 plasmid or empty vector for 30 h. BMP-2 mRNA expression was analyzed by real-time RT-PCR using mouse BMP-2 primers. Figures 2C and D show that the BMP-2 mRNA level was significantly enhanced by Gli2 transfection. These results indicate that Gli2 specifically activates BMP-2 gene transcription and mRNA expression.
|
5/LucII, in C2C12 cells (46). Compared with the individual empty vector, we found that full-length Gli1 and Gli2 are powerful activators of the Gli reporter, while Gli3 is a weak activator. In similar studies, we also found that N-terminally truncated Gli2 (Gli2
N2) is more potent than full-length Gli2, an effect which is due to deletion of the repressor domain. In contrast, C-terminally truncated Gli2 (Gli2
C4) and Gli3 (trGli3) repressed the Gli reporter (Fig. 3B). Next, we examined the functions of these Gli proteins in BMP-2 gene transcription. Experiments with the mouse BMP-2 promoter-luciferase construct showed that Gli2 is the only member of the Gli family which enhances BMP-2 promoter activity in C2C12 cells (Fig. 3C). To verify the effects of the Gli proteins on BMP-2 expression, we transfected the expression plasmids and examined endogenous BMP-2 mRNA levels in osteoblastic 2T3 cells. Consistently, we found that Gli1 does not have an effect on BMP-2 gene regulation, while Gli2 enhances and trGli3 inhibits endogenous BMP-2 expression compared with individual vectors (Fig. 3D). These data suggest that Gli2 is a major activator of BMP-2 gene transcription among the Gli family.
|
|
|
|
In EMSA experiments, about 30-bp DNA probes for the BMP-2 promoter containing the sequence of each putative Gli binding site or mutant binding site were synthesized and, after being labeled with biotin, were incubated with nuclear proteins extracted from osteoblast precursor C3H10T1/2 cells in which His-Gli2 was ectopically expressed. By using a gel shift assay, we found that Gli2 proteins bound directly to each probe (BS1, BS2, and BS3), as shown by shifted bands which were further supershifted by adding anti-His antibody, and an excess of unlabeled probes abolished both shifted and supershifted bands (Fig. 6D, lanes 1 to 3, 6 to 8, and 11 to 13). Mutations of these binding sites abolished the binding abilities of the probes with nuclear extracts, as shown with mutant probes
BS1,
BS2, and
BS3 (Fig. 6D, lanes 4, 5, 9, 10, 14, and 15). These results indicated that Gli2 interacts directly with the BMP-2 promoter through these Gli binding sites, which was further confirmed by the following promoter mutation experiments. We mutated BS1, BS2, and BS3 in the promoter and tested their responsiveness to Gli2. We found that individual mutation of each Gli binding site caused a partial inhibition of promoter activity (Fig. 6E), suggesting that all of these elements have a contribution to and may be required for Shh/Gli2 activation. This needs to be further verified by an assay of combined mutations.
Gli2 mediates the effects of Shh on BMP-2 gene transcription. Gli proteins transduce Shh signals to target genes, and Gli2 has been shown to be an important activator in this pathway in many systems (10, 33, 46). In this study, we investigated the effect of Shh on BMP-2 gene expression in osteoblast precursor cells and determined whether this Shh function is mediated by Gli2. First, we examined the effects of Shh on BMP-2 promoter activity. C2C12 cells were transfected with the BMP-2 promoter reporter gene (2712/+165-luc) and treated with Shh (200 ng/ml) for 48 h, with or without ectopically forced expression of Gli2. We found that the treatment of Shh significantly increased both basal and Gli2-enhanced BMP-2 promoter activity (Fig. 7A). In addition, pretreatment with cyclopamine (2 µM), a hedgehog signaling inhibitor, not only reduced basal BMP-2 promoter activity but also attenuated Shh-induced BMP-2 promoter activity (Fig. 7B). We also determined the effect of Gli2 RNAi on the Shh-induced enhancement of BMP-2 transcription in C2C12 cells. Knocking down Gli2 expression eliminated the enhancing effect of Shh on BMP-2 promoter activity (Fig. 7C). This suggests that the induction of BMP-2 expression by Shh is mediated by Gli2. We have previously shown that trGli3 is a powerful negative regulator of BMP-2 gene expression (16). Thus, we investigated the interaction of the Shh signaling mediators Gli2 and trGli3 in the regulation of BMP-2 gene transcription. When Gli2 and trGli3 were cotransfected, the Gli2-mediated enhancement of BMP-2 promoter activity was significantly antagonized by the repressor form of Gli3 (Fig. 7D). The activities of both Gli2 and Gli3 are known to be down-regulated by PKA phosphorylation, leading to proteolytic processing in the absence of the Shh signal. We next examined the effects of PKA on Gli2 regulation in osteoblasts. A Western blot of C3H10T1/2 cells showed that treatment with the PKA-specific inhibitor KT5720 substantially increased the Gli2 protein level (Fig. 7E). Consistently, in the BMP-2 promoter assay, we found that overexpression of PKA markedly attenuated Gli2-mediated activation of BMP-2 transcription (Fig. 7F). In summary, these data indicate that the activation of Shh signaling enhances BMP-2 promoter activity and that this effect is mediated by the transactivation of Gli2, and they suggest that Gli2 function in osteoblasts is regulated by the PKA pathway.
|
| DISCUSSION |
|---|
|
|
|---|
Shh-Gli2-BMP-2 pathway in osteoblast differentiation. BMP signaling induces mesenchymal cells to differentiate into mature osteoblasts (42, 43, 56). Like the BMP signaling pathway, the hedgehog signaling pathway has been implicated in osteoblast differentiation. In the present studies, we found that the hedgehog receptor signaling pathway is intact in osteoblast precursor C3H10T1/2, C2C12, and 2T3 cells, as treatment with Shh triggers osteoblast differentiation in these cells. Using Gli2 gain- and loss-of-function approaches, we also demonstrated that the transcription factor Gli2 plays a critical role in mediating Shh stimulation of osteoblast differentiation (Fig. 1, 4, and 5). Importantly, this Gli2-induced osteoblast differentiation in osteoblast precursor cells is likely due to up-regulation of BMP-2 expression, since the addition of Noggin, a specific natural BMP-2 antagonist, blocked this effect of Gli2 (Fig. 1D). The data in Fig. 1 and 7 show that treatment with Shh has less potency than transfection of Gli2 on either ALP activity or BMP-2 promoter activity in C2C12 cells. This is a puzzle. It is known that Shh acts on cells through its receptors (Ptc and Smo) and that its signal is transduced to Gli proteins by a protein complex composed of Fu, SuFu, Cos-2, and cytoskeletons which regulates the proteolytic processing of Gli proteins. A possible explanation for the phenomenon we observed is that the receptor pathway for Shh in C2C12 cells may not function well, although we could detect the expression of these receptors in these cells. However, overexpression of Gli2 by transfection bypasses such a pathway and directly activates BMP-2 transcription.
In addition, our data also suggest that Gli2 has a synergistic effect with BMP-2 signaling in osteoblasts, since overexpression of Gli2 greatly enhanced BMP-2 stimulation of mineralized matrix formation in cultures of 2T3 cells (Fig. 1C) and since, in contrast, Gli2 deficiency reduced BMP-2 activity (Fig. 5G). We also found that Gli2 synergizes with Smad1 to stimulate a luciferase reporter gene that contains both Gli binding sites and Smad binding sites (data not shown). Thus, we think that the Shh-Gli2 pathway not only regulates BMP-2 gene expression, which we have demonstrated in the present studies, but also may regulate BMP-2 signaling by cross talk between Gli2 and Smad1 in osteoblasts. These results raise strong support for our notion that Shh/Gli2 signaling promotes the osteoblastic phenotype, at least in part, through the BMP-2 pathway.
Gli family regulates BMP-2 gene expression in osteoblasts.
Genetic and embryologic studies suggest that Gli proteins have distinct activities and are not functionally equivalent. Nevertheless, their partial redundancy and often overlapping domains of expression have made it difficult to define precisely their individual features and functions (27, 28, 31, 32, 44, 46). Gli family members have been characterized by their sequence homology, including a central DNA binding domain with five C-2-H-2 zinc fingers, a C-terminal transcription activation domain, and an N-terminal repression domain. In the promoter study (Fig. 3), we found that only Gli2 markedly enhanced BMP-2 promoter activity, while Gli1 and Gli3 had very weak effects. Deletion of the N-terminal domain (Gli2
N2) caused a significant increase in Gli2 transactivation of the BMP-2 promoter, and deletion of the C-terminal region turned Gli2 into a repressor of the BMP-2 gene. Consistent with our previous findings (21), C-terminally truncated Gli3 possessed a potent inhibitory effect on BMP-2 gene transcription. These results, along with those for Gli2 RNAi and Gli2 null mutation, demonstrate that Gli2 is a powerful activator of BMP-2 gene expression and indicate that Gli2 regulates target genes in a similar manner to that of Gli3.
Gli2 and Gli3 have important but distinct functions in bone, especially in skeletal development. Both Gli2 and Gli3 mutant mice have severe skeletal abnormalities. In Gli2 null mutant mice, the skeletal defects include cleft palate, the absence of vertebral bodies and intervertebral discs, and shortened tibias and sternums as well as cartilage defects (22, 35, 36). These Gli2 phenotypes are distinct from those of Gli3 mutants. Gli3 mutant mice exhibit polysyndactyly that is similar to several human skeletal syndromes, namely the Greig cephalopolysyndactyly syndrome and the Pallister-Hall syndrome (6). The exaggeration of skeletal defects in Gli2/Gli3 double mutant mice suggests some unique and redundant functions for these two genes in skeletal development. In characterizing Gli2 null mice, we found that in addition to the skeletal defects in embryos, one-third of heterozygous Gli2 null mice developed an osteopenic phenotype postnatally, as represented by a lower bone mineral density and markedly reduced trabecular bone volume (data not shown). These mice also had severe defects in cartilage development, including smaller stature, extremely short forelimbs, disorganized elbow joints, and enlarged growth plates in the long bones of the hindlimbs (data not shown). In this study, we also examined BMP-2 gene expression in bones of Gli2zfd/zfd mice and found that BMP-2 mRNA and protein expression was decreased in osteoblasts on the trabecular bone surface as well in hypertrophic chondrocytes in the growth plates of long bones and developing vertebrae (Fig. 5). This suggests that the regulation of BMP-2 gene expression by Gli2 in these areas is important for normal endochondral bone formation.
Gli transcription factors act on target genes by binding to the specific Gli-responsive element(s) in promoters (38, 45). Through promoter deletion analysis, we mapped out two Gli2-responsive regions in the BMP-2 promoter. Using ChIP and EMSA, we identified three putative Gli binding sites in these areas (Fig. 6). Our data suggest that the Gli binding sites are responsible for direct transactivation of Gli2. However, the individual roles of each of the Gli binding sites in this promoter have yet to be defined by single and multiple mutations of these binding sites. Moreover, the possible implication of competition between Gli2 and trGli3 for binding to the BMP-2 promoter remains to be established, since Gli2 and Gli3 are known to occupy the same binding sites on other promoters. We have found that trGli3 dramatically inhibits Gli2 enhancement of BMP-2 promoter activity (Fig. 7D). The levels and activities of endogenous Gli2 and trGli3 during osteoblast differentiation need to be further investigated.
Processing of Gli proteins and BMP-2 gene regulation. In cells, Gli2 and Gli3 share similar regulatory mechanisms in responding to Shh signaling. In the absence of Shh, both proteins are phosphorylated by PKA and undergo proteolytic processing (54). However, unlike that of Gli3, the processing of Gli2 was not well identified until a recent study conducted by Wang et al. (41). In this study, Wang et al. demonstrated that the phosphorylation of Gli2 is done sequentially by PAK, CK1, and GSK3 and that the E3 ubiquitin ligase ß-TrCP is required for leading Gli2 to proteasomal degradation. Unlike Gli3 and Ci, only a minor fraction of Gli2 is proteolytically processed to form a transcriptional repressor, and in addition to being processed, the full-length Gli2 protein is readily degraded. Coincidentally, in our studies, we found that blocking PKA activity elevated the Gli2 protein levels in osteoblasts, suggesting that the inhibition of PKA prevents Gli2 from degradation (Fig. 7E). Furthermore, overexpression of PKA significantly inhibited Gli2-enhanced BMP-2 promoter activity (Fig. 7F). The data on PKA-mediated Gli2 processing provide a mechanism for Shh effects on BMP-2 gene expression in osteoblasts (Fig. 7A to C). These results are consistent with our previous findings with Gli3 in which we demonstrated that the effect of Gli3 on BMP-2 gene transcription is PKA dependent and that proteasome inhibitors prevent Gli3 proteolytic processing and consequently enhance BMP-2 gene expression as well as bone formation (16). Therefore, based on these observations, we suspect that proteasome inhibitors enhance BMP-2 gene expression, not only by reducing trGli3 production but also by preventing Gli2 degradation.
Proteasomal processing is mediated by members of the large family of PKA-dependent E3 ubiquitin ligases (48). Consistent with the finding of Wang et al., we recently found that Slimb, a Drosophila homologue of ß-TrCP, induces proteolytic processing of Gli2 protein and inhibits BMP-2 promoter activity in osteoblasts (data not shown). However, it is very interesting that Smurf1, a Hect domain E3 ligase, also plays a role in Gli2 processing. We identified a "PY" motif at the N-terminal region that is known to be recognized by Smurf1. Previously, we demonstrated that Smurf1 has an important role in BMP-2 gene regulation, osteoblast differentiation, and bone formation by regulating proteolytic processing of Smad1 and Runx2 (63, 64). The additional requirement for Smurf1 in Gli2 processing may raise the possibility that Gli2 undergoes sequential proteolytic processing mediated by ß-TrCP and then Smurf1, resulting in degradation of full-length Gli2. Taken together, these findings suggest that the PKA- and E3 ligase-dependent proteasomal pathway is involved in the regulation of Gli proteins and BMP-2 gene expression in osteoblasts.
In conclusion, we provide evidence that Gli2 is a transcriptional activator of BMP-2 gene transcription and plays a critical role in the Shh-Gli2-BMP-2 signaling pathway in osteoblast differentiation.
| ACKNOWLEDGMENTS |
|---|
This study was supported by NIH grants AG024637, AR051165, and AR050605 and by the pilot grants program of the Nathan Shock Center for Excellence in the Biology of Aging.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Anderson, H. C., P. T. Hodges, X. M. Aguilera, L. Missana, and P. E. Moylan. 2000. Bone morphogenetic protein (BMP) localization in developing human and rat growth plate, metaphysis, epiphysis, and articular cartilage. J. Histochem. Cytochem. 48:1493-1502.
3. Arikawa, T., K. Omura, and I. Morita. 2004. Regulation of bone morph genetic protein-2 expression by endogenous prostaglandin E2 in human mesenchymal stem cells. J. Cell. Physiol. 200:400-406.[CrossRef][Medline]
4. Boden, S. D. 2005. The ABCs of BMPs. Orthop. Nurs. 24:49-52.[Medline]
5. Büscher, D., B. Bosse, J. Heymer, and U. Rüther. 1997. Evidence for genetic control of Sonic hedgehog by Gli3 in mouse limb development. Mech. Dev. 62:175-182.[CrossRef][Medline]
6. Büscher, D., L. Grotewold, and U. Rüther. 1998. The XtJ allele generates a Gli3 fusion transcript. Mamm. Genome 9:676-678.[CrossRef][Medline]
7. Chen, D., X. Ji, M. A. Harris, J. Q. Feng, G. Karsenty, A. J. Celeste, V. Rosen, G. R. Mundy, and S. E. Harris. 1998. Differential roles for bone morphogenetic protein (BMP) receptor type IB and IA in differentiation and specification of mesenchymal precursor cells to osteoblast and adipocyte lineages. J. Cell Biol. 142:295-305.
8. Chen, D., M. Zhao, and G. R. Mundy. 2004. Bone morphogenetic proteins. Growth Factors 22:233-241.[CrossRef][Medline]
9. Chiang, C., Y. Litingtung, E. Lee, K. E. Young, J. L. Corden, H. Westphal, and P. A. Beachy. 1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383:407-413.[CrossRef][Medline]
10. Cohen, M. M., Jr. 2003. The Hedgehog signaling network. Am. J. Med. Genet. 123:5-28.
11. De Luca, F. D., K. M. Barnes, J. A. Uyeda, S. De-Levi, V. Abad, T. Palese, V. Mericq, and J. Baron. 2001. Regulation of growth plate chondrogenesis by bone morph genetic protein-2. Endocrinology 142:430-436.
12. Feng, J. Q., M. A. Harris, N. Ghosh-Choudhury, M. Feng, G. R. Mundy, and S. E. Harris. 1994. Structure and sequence of mouse bone morphogenetic protein-2 gene (BMP-2): comparison of the structures and promoter regions of BMP-2 and BMP-4 genes. Biochim. Biophys. Acta 1218:221-224.[Medline]
13. Feng, J. Q., D. Chen, N. Ghosh-Choudhury, J. Esparza, G. R. Mundy, and S. E. Harris. 1997. Bone morph genetic protein 2 transcripts in rapidly developing deer antler tissue contain an extended 5' non-coding region arising from a distal promoter. Biochim. Biophys. Acta 1350:47-52.[Medline]
14. Feng, J. Q., L. P. Xing, J. H. Zhang, M. Zhao, D. Horn, J. Chan, B. F. Boyce, S. E. Harris, G. R. Mundy, and D. Chen. 2003. NF-
B specifically activates BMP-2 gene expression in growth plate chondrocytes in vivo and in a chondrocyte cell line in vitro. J. Biol. Chem. 278:29130-29135.
15. Fowler, M. J., Jr., M. S. Neff, R. C. Borghaei, E. A. Pease, E. Mochan, and P. Thoenton. 1998. Induction of bone morph genetic protein-2 by interleukin-1 in human fibroblasts. Biochem. Biophys. Res. Commun. 248:450-453.[CrossRef][Medline]
16. Garrett, I. R., D. Chen, G. Gutierrez, M. Zhao, A. Escobedo, G. Rossini, S. E. Harris, W. Gallwitz, K. B. Kim, S. Hu, C. M. Crews, and G. R. Mundy. 2003. Selective inhibitors of the chymotrypsin-like activity of the osteoblast proteasome are potent stimulators of bone formation in vivo and in vitro. J. Clin. Investig. 111:1771-1782.[CrossRef][Medline]
17. Ghosh-Choudhury, N., M. A. Harris, J. Q. Feng, G. R. Mundy, and S. E. Harris. 1994. Expression of the BMP-2 gene during bone cell differentiation. Crit. Rev. Eukaryot. Gene Expr. 4:345-355.[Medline]
18. Ghosh-Choudhury, N., J. J. Windle, B. A. Koop, M. A. Harris, D. L. Guerrero, J. M. Wozney, G. R. Mundy, and S. E. Harris. 1996. Immortalized murine osteoblasts derived from BMP-2T antigen expressing transgenic mice. Endocrinology 137:331-339.[Abstract]
19. Ghosh-Choudhury, N., G. Ghosh-Choudhury, M. A. Harris, J. M. Wozney, G. R. Mundy, S. L. Abboud, and S. E. Harris. 2001. Autoregulation of mouse BMP-2 gene transcription is directed by the proximal promoter element. Biochem. Biophys. Res. Commun. 286:101-108.[CrossRef][Medline]
20. Govender, S., C. Csimma, H. K. Genant, A. Valentin-Opran, Y. Amit, R. Arbel, H. Aro, D. Atar, M. Bishay, M. G. Borner, P. Chiron, P. Choong, J. Cinats, B. Courtenay, R. Feibel, B. Geulette, C. Gravel, N. Haas, M. Raschke, E. Hammacher, D. van der Velde, P. Hardy, M. Holt, C. Josten, R. L. Ketterl, B. Lindeque, G. Lob, H. Mathevon, G. McCoy, D. Marsh, R. Miller, E. Munting, S. Oeyre, L. Nordsletten, A. Patel, A. Pohl, W. Rennie, P. Revnders, P. M. Rommens, J. Rondia, W. C. Rossouw, P. J. Daneel, S. Ruff, A. Ruter, S. Santavirta, T. A. Schildhauer, C. Gekle, R. Schnettler, D. Segal, H. Seiler, R. B. Snowdowne, J. Stapert, G. Taglang, R. Verdonk, L. Vogels, A. Weckbach, A. Wentzensen, and T. Wisniewski. 2002. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J. Bone Joint Surg. Am. 84:2123-2134.
21. Guttenbach, M., I. Nanda, P. M. Brickell, R. Godbout, P. Staeheli, Z. E. Zehner, and M. Schmid. 2000. Chromosomal localization of the genes encoding ALDH, BMP-2, R-FABP, IFN-gamma, RXR-gamma, and VIM in chicken by fluorescence in situ hybridization. Cytogenet. Cell Genet. 88:266-271.[CrossRef][Medline]
22. Hardcastle, Z., R. Mo, C. C. Hui, and P. T. Sharpe. 1998. The Shh signaling pathway in tooth development: defects in Gli2 and Gli3 mutants. Development 125:2803-2811.[Abstract]
23. Harris, S. E., M. Sabatini, M. A. Harris, J. Q. Feng, J. M. Wozney, and G. R. Mundy. 1994. Expression of bone morphogenetic protein messenger RNA in prolonged cultures of fetal rat calvarial cells. J. Bone Miner. Res. 9:389-394.[Medline]
24. Harris, S. E., J. Q. Feng, M. A. Harris, N. Ghosh-Choudhury, M. R. Dallas, J. M. Wozney, and G. R. Mundy. 1995. Recombinant bone morphogenetic protein 2 accelerates bone cell differentiation and stimulates BMP-2 mRNA expression and BMP-2 promoter activity in primary fetal rat calvarial osteoblast cultures. Mol. Cell. Differ. 3:138-155.
25. Helvering, L. M., R. L. Sharp, X. Qu, and A. G. Geiser. 2000. Regulation of the promoters of the human bone morph genetic protein 2 and 4 genes. Gene 256:123-138.[CrossRef][Medline]
26. Hogan, B. L. M. 1996. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10:1580-1594.
27. Hui, C. C., and A. L. Joyner. 1993. A mouse model of Greig cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene. Nat. Genet. 3:241-246.[CrossRef][Medline]
28. Hui, C. C., D. Slusarski, K. A. Platt, R. Holmgren, and A. L. Joyner. 1994. Expression of three mouse homologs of the Drosophila segment polarity gene cubitus interruptus, Gli, Gli-2, and Gli-3, in ectoderm- and mesoderm-derived tissues suggests multiple roles during postimplantation development. Dev. Biol. 162:402-413.[CrossRef][Medline]
29. Ingham, P. W. 1998. Transducing Hedgehog. The story so far. EMBO J. 17:3505-3511.[CrossRef][Medline]
30. Kinto, N., M. Iwamoto, M. Enomoto-Iwamoto, S. Noji, H. Ohuchi, H. Yoshioka, H. Kataoka, Y. Wada, G. Yuhao, H. E. Takahashi, S. Yoshiki, and A. Yamaguchi. 1997. Fibroblasts expressing Sonic hedgehog induce osteoblast differentiation and ectopic bone formation. FEBS Lett. 404:319-323.[CrossRef][Medline]
31. Lee, J., K. A. Platt, P. Censullo, and A. Ruiz i Altaba. 1997. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development. Development 124:2537-2552.[Abstract]
32. Marigo, V., M. Scott, R. Johnson, L. Goodrich, and C. J. Tabin. 1996. Conservation in hedgehog signaling: induction of a chicken patched homolog by Sonic hedgehog in the developing limb. Development 122:1225-1233.[Abstract]
33. Matise, M. P., D. J. Epstein, H. L. Park, K. A. Platt, and A. L. Joyner. 1998. Gli2 is required for induction of floor plate and adjacent cells, but not most ventral neurons in the mouse central nervous system. Development 125:2759-2770.[Abstract]
34. Meyer, R. A., M. H. Meyer, M. Tenholder, W. R. Wondracel, and P. Garges. 2003. Gene expression in older rats with delayed union of femoral fractures. J. Bone Joint Surg. Am. 85:1243-1254.
35. Miao, D., H. L. Liu, P. Plut, M. J. Niu, R. J. Huo, D. Goltzman, and J. E. Henderson. 2004. Impaired endochondral bone development and osteopenia in Gli2-deficient mice. Exp. Cell Res. 294:210-222.[CrossRef][Medline]
36. Mo, R., A. M. Freer, D. L. Zinyk, M. A. Crackower, J. Michaud, H. H.-Q. Heng, K. W. Chik, X.-M. Shi, L.-C. Tsui, S. H. Cheng, A. L. Joyner, and C.-C. Hui. 1997. Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development 124:113-123.[Abstract]
37. Motoyama, J., J. Liu, R. Mo, Q. Ding, M. Post, and C. C. Hui. 1998. Essential function of Gli2 and Gli3 in the formation of lung, trachea and esophagus. Nat. Genet. 20:54-57.[CrossRef][Medline]
38. Muller, B., and K. Basler. 2000. The repressor and activator forms of Cubitus interruptus control Hedgehog target genes through common generic Gli-binding sites. Development 127:2999-3007.[Abstract]
39. Mundy, G. R., I. R. Garrett, S. E. Harris, J. Chan, D. Chen, G. Rossini, B. Boyce, M. Zhao, and G. Gutierrez. 1999. Stimulation of bone formation in vitro and in rodents by statins. Science 286:1946-1949.
40. Mundy, G. R., D. Chen, M. Zhao, S. Dallas, C. Xu, and S. E. Harris. 2001. Growth regulatory factors and bone, p. 105-115. In D. LeRoith (ed.), Endocrine and metabolic disorders, vol. 2. Kluwer Academic Publishers, Norwell, Mass.
41. Pan, Y., C. B. Bai, A. L. Joyner, and B. Wang. 2006. Sonic hedgehog signaling regulates Gli2 transcriptional activity by suppressing its processing and degradation. Mol. Cell. Biol. 26:3365-3377.
42. Rosen, V., J. Nove, J. J. Song, R. S. Thies, K. Cox, and J. M. Wozney. 1994. Responsiveness of clonal limb bud cell lines to bone morphogenetic protein 2 reveals a sequential relationship between cartilage and bone cell phenotypes. J. Bone Miner. Res. 9:1759-1768.[Medline]
43. Rosen, V., J. M. Wozney, A. Fujisawa-Sehara, and T. Suda. 1994. Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J. Cell Biol. 127:1755-1766.
44. Ruiz i Altaba, A. 1998. Combinatorial Gli function in floor plate and neuronal inductions by Sonic hedgehog. Development 125:2203-2212.[Abstract]
45. Sasaki, H., C. C. Hui, M. Nakafuku, and H. Kondoh. 1997. A binding site for Gli proteins is essential for HNF-3b floor plate enhancer activity in transgenics and can respond to Shh in vitro. Development 124:1313-1322.[Abstract]
46. Sasaki, H., Y. Nishizaki, C. C. Hui, M. Nakafuku, and H. Kondoh. 1999. Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development 126:3915-3924.[Abstract]
47. Styrkarsdottir, U., J. B. Cazier, A. Kong, O. Rolfsson, H. Larsen, E. Bjarnadottir, V. D. Johannsdottir, M. S. Sigurdardottir, Y. Bagger, C. Christiansen, I. Reynisdottir, S. F. A. Grant, K. Jonasson, M. L. Frigge, J. R. Gulcher, G. Sigurdsson, and K. Stefansson. 2003. Linkage of osteoporosis to chromosome 20p12 and association to BMP-2. PLoS Biol. 1:1-10.
48. Sun, Y. 2003. Targeting E3 ubiquitin ligases for cancer therapy. Cancer Biol. Ther. 2:623-629.[Medline]
49. Takae, R., S. Matsunaga, N. Origuchi, T. Yamamoto, N. Morimoto, S. Suzuki, and T. Sakou. 1999. Immunolocalization of bone morphogenetic protein and its receptors in degeneration of intervertebral disc. Spine 24:1397-1401.[CrossRef][Medline]
50. Urist, M. R. 1965. Bone formation by autoinduction. Science 150:893-899.
51. Venezian, R., B. J. Shenker, S. Datar, and P. S. Leboy. 1998. Modulation of chondrocyte proliferation by ascorbic acid and BMP-2. J. Cell. Physiol. 174:331-341.[CrossRef][Medline]
52. Villavicencio, E. H., D. O. Walterhouse, and P. M. Lannaccone. 2000. The Sonic hedgehog-patched-Gli pathway in human development and disease. Am. J. Hum. Genet. 67:1047-1054.[Medline]
53. Virdi, A. S., L. J. Cook, R. O. Oreffo, and J. T. Triffitt. 1998.