![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, September 2006, p. 6808-6818, Vol. 26, No. 18
0270-7306/06/$08.00+0 doi:10.1128/MCB.00245-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Claas Otto,
Youssef Bakri,
Noushine Mossadegh,
Sandrine Sarrazin, and
Michael H. Sieweke*
Centre d'Immunologie de Marseille-Luminy, Campus de Luminy, Case 906, 13288 Marseille Cedex 09, France
Received 9 February 2006/ Returned for modification 1 April 2006/ Accepted 27 June 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the hematopoietic system MafB is selectively expressed at high levels in monocytes and macrophages but not in other myeloid or lymphoid lineages. This expression profile is conserved across species and was observed in avian and human cell lines as well as myeloid progenitor or monocyte-derived primary macrophages (3, 10, 12, 13, 20, 34). By contrast, MafB expression in closely related myeloid lineages such as granulocytes or dendritic cells is very low or absent (3, 20, 34). In vivo, MafB expression was observed in resident macrophages of several tissues (10) and transgenic mouse reporter lines indicated MafB expression in peritoneal and bone marrow F4/80+/Mac-1+ macrophages but not in other hematopoietic lineages (13).
Both in avian and in human differentiation systems MafB expression is strongly upregulated after inducing macrophage differentiation of myeloid progenitor cells (3, 10, 12, 20). Consistent with a functional importance of this expression profile, ectopic retroviral expression of MafB in these cells promotes phenotypic and functional monocyte/macrophage differentiation (3, 12, 20). In addition, MafB inhibits differentiation along other lineages such as the erythroid (34) or dendritic (3) cell lineage. Furthermore, a MafB deletion mutant lacking N-terminal effector domains and consisting only of the DNA binding domain acts as a dominant-negative mutant for MafB transactivation and inhibits monocyte/macrophage differentiation in avian myeloid progenitors (20). Together these results strongly suggested a critical function of MafB in macrophage differentiation. To further analyze the requirement for MafB in this process, we generated MafB-deficient mice. Since these mice die at birth from defects of respiratory neurons in the hindbrain and subsequent central breathing failure (4, 5), we analyzed macrophage development by in vitro differentiation and in the embryo and in adult mice reconstituted with MafB-deficient fetal liver cells. Surprisingly, we observed normal numbers of Mac-1+/F4/80+ monocytes and macrophages in all analyzed tissues. Macrophages could also be derived by vitro differentiation from MafB–/– fetal liver or spleen. On the other hand MafB–/– macrophages showed an increased expression of genes involved in modulation of actin organization and dramatically amplified morphological changes in response to monocyte colony-stimulating factor (M-CSF), involving the rapid formation of multiple, branched protrusions. Together our results indicated an unexpected redundancy of MafB function in macrophage differentiation and suggest a previously unknown role of MafB in influencing actin organization in macrophages.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell preparations and FACS analysis. Bone marrow cells were flushed from femurs and tibias in Iscove modified Dulbecco medium (IMDM)-20% fetal calf serum (FCS), and splenocytes and fetal liver cells were obtained by mechanical dissociation of organs. Peripheral blood was obtained by heparinized microcapillary aspiration from decapitated embryos. Cell preparations containing red cells were treated with lysis buffer (0.15 M NH4Cl, 17 mM Tris, pH 7.2) prior to fluorescence-activated cell sorting (FACS) analysis. For antibody staining cells were resuspended in FACS medium (0.2% bovine serum albumin [BSA] and 0.1% NaN3 in phosphate-buffered saline [PBS]) at a concentration of 1 x 106 to 1 x 107 cells/ml followed by incubation at 4°C for 20 min with properly diluted fluorochrome- or biotin-labeled monoclonal antibodies, followed by secondary incubation with fluorochrome-coupled streptavidin where required. Flow cytometry was performed on a FACScalibur cytometer (Becton Dickinson, San Jose, CA) with CellQuest (Becton Dickinson) software.
Bone marrow-reconstituted mice. Fetal liver cells (1 x 106) from E14.5 control and mafB–/– Ly5.2 embryos were injected into the tail vein of lethally irradiated (900- to 1,000-rad) age- and sex-matched Ly5.1 recipient mice. Irradiation was done at least 4 h before cell transfer, and mice were kept on antibiotics in the drinking water for 4 weeks posttransplantation.
Colony and plasma clot assays. Fetal liver cells (1.5 x 104) were seeded in 1 ml of IMDM containing 1% methylcellulose supplemented with 10% FCS, 450 µM monothioglycerol (Sigma), 10 µg/ml insulin (Sigma), 50 U/ml penicillin, 50 mg/ml streptomycin, and 2 mM glutamine (all from Invitrogen); 2.5% interleukin 3 (IL-3)-containing conditioned medium; 5% granulocyte-macrophage colony-stimulating factor (GM-CSF)-containing conditioned medium; and 5% M-CSF-containing conditioned medium (CA medium). At day 11, differentiated cells were washed out of methylcellulose and stained as described below for cytospins.
In plasma clot assays the morphology of the colony can be preserved during fixation and staining. Cells (104 to 105) from mouse fetal spleen were seeded directly in plasma clot media: CA medium and 10% bovine citrated plasma (Sigma) clotted by the addition of 10 U/ml of thrombin (Sigma). Assays were analyzed at day 6, and clotted colonies were compressed onto slides using Whatman paper and stained as described below for cytospins.
Cytospins, blood smears, and morphological staining and immunostaining. Cytocentrifugation of cells was carried out using 10 to 100,000 cells per well in a Shandon cytocentrifuge. Samples were air dried and fixed in 100% methanol for 4 min, followed by 2 min of incubation in neutral benzidine (1% O-dianisidine in methanol) to stain erythrocytes. Slides were then rinsed in hydrogen peroxide (0.5% in 50% ethanol) for 1.5 min followed by a 30-s rinse in water. Leukocytes were stained with Diff-Quick (Baxter), 3 min in eosin G in phosphate buffer, pH 6.6, and 2 min in thiazine dye in phosphate buffer, pH 6.6.
Peripheral blood smears were fixed in 100% methanol for 5 min and stained with Giemsa stain (Sigma Diagnostics; GS-5000) for 30 min at room temperature. Differential leukocyte counting was done on a Leitz DMRBE microscope and images acquired with Act-1 software. Nucleated red cells were counted per 100 leukocytes and used for correcting total leukocyte count. Whole blood was diluted (1:40) in Turk solution (Merck, catalog no. 9277), and total nucleated cells were counted in a Neubauer chamber.
For immunostaining, 18.5-day-postcoitum spleens were fixed in 3% paraformaldehyde for 120 min followed by O.C.T. (Tissue-Tek, The Netherlands) embedding. Cells were stained with biotin-conjugated anti-mouse antibody against F4/80 (eBioscience) and counterstained with the nuclear dye DAPI (4',6'-diamidino-2-phenylindole; 5 µg/ml for 45 min; Sigma-Aldrich). Photomicrographs were taken with a multifluorescence Zeiss Axioplan 2 microscope and acquired with SmartCapture 2 software.
In vitro-derived primary macrophages.
Control or mafB–/– fetal liver cells were seeded at 2 x 105 cells/ml on two 15-cm bacterial dishes in complete medium (IMDM-10% FCS; 450 µM monothioglycerol 
; 10 µg/ml insulin ; 50 U/ml penicillin, 50 mg/ml streptomycin, and 2 mM glutamine [all from Invitrogen]; 2.5% IL-3-containing conditioned medium; 5% GM-CSF-containing conditioned medium; 5% M-CSF-containing conditioned medium). From day 6, medium was changed to M-CSF medium (MM: complete medium without IL-3 and with GM-CSF and M-CSF only). At day 10, adherent cells were scraped off and harvested for RNA or protein extraction or split into new dishes for functional analysis.
Microarray and quantitative real-time reverse transcription-PCR (RT-PCR) analysis.
Total RNA was extracted using Trizol (Invitrogen) reagent from equal numbers of in vitro M-CSF-derived macrophages and digested with DNase I (QIAGEN). RNA was pooled from two MafB+/+ control and two MafB–/– macrophage samples derived from independent individual fetal livers and processed by a commercial service to generate probes for Affymetrix HG_U95Av2 chip hybridization with Microarray Suite software. Results from two independent arrays each containing duplicate data points were analyzed with Gene Chip EASI expression analysis software. For single gene expression analysis 1- to 2-µg RNA samples of macrophages derived from individual mafB+/+ or mafB–/– fetal livers were reverse transcribed with SuperScript II (Invitrogen) and subjected to quantitative real-time PCR using the SYBR green PCR master mix (PE Applied Biosystems, Foster City, CA), following the manufacturer's instructions. Reactions were performed in a 7500 Fast quantitative real-time PCR detection system (PE-Applied Biosystems, Foster City, CA). Tested expression levels were normalized to hypoxanthine phosphoribosyltransferase (HPRT) expression. Primers used were as follows: Fr1, plus strand, CCGACCGGAAACAGACGTT, and minus strand, AACCCGTGAGCTGTGGGTACT; adenylate cyclase-associated protein (CAP), plus strand, GAAAAGTGCCAACCATTTCCA, and minus strand, CACAGTCCAGGGAGTTCTTGCT; cytoplasmic ß-actin, plus strand, GACGGCCAAGTCATCACTATTG, and minus strand, CAAGAAGGAAGGCTGGAAAAGA; fascin 1, plus strand, TCAGTCCTCCTGTTATCCTTACTCATC, and minus strand, CCGTTTTCTCTTGGGTTTCCA; 
-actinin-1, plus strand, AGCCAGGAACAGATGAACGAA, and minus strand, CCAACGTGCCGGAGTGAT; c-Maf, plus strand, GGATGGCTTCAGAACTGGCA, and minus strand, AACATATTCCATGGCCAGGG; HPRT, plus strand, AGCCCTCTGTGTGCTAAGG, and minus strand, CTGATAAAATCTACAGTCCATAGGAATGGA.
Western blot analysis. Proteins were extracted from in vitro-differentiated macrophages. Western analysis was performed as described previously (20). Primary antibodies were rabbit anti-mouse c-Maf (Santa Cruz Biotechnology; sc-7866; 1:500), mouse anti-ß-actin (Sigma; A5316; 1:20,000), and mouse anti-ß-tubulin 1 (Sigma; T7816; 1:20,000). Secondary antibodies were horseradish peroxidase-coupled goat anti-rabbit immunoglobulin G (Santa Cruz Biotechnology; sc-2054; 1/1,000) and anti-mouse immunoglobulin G (Santa Cruz Biotechnology; sc-2055; 1/1,000).
Macrophage stimulation and assays for NO.
Day 12 in vitro-differentiated macrophages at 106 cells/ml were incubated for 24 h with 100 ng/ml lipopolysaccharide (LPS) (Sigma) and 50 U/ml of gamma interferon (IFN-
) (mouse recombinant; Sigma). Nitric oxide (NO) production was determined by measurement of nitrite, which forms in a reaction of NO with the culture medium. Cell supernatant was cleared of cell debris by centrifugation, and 200 µl was combined with 600 µl of Griess-Ilovays reagent (Merck) and incubated at room temperature for 10 min as recommended elsewhere (1). Absorbance was measured at 546 nm and compared to a standard curve prepared with sodium nitrite.
Phagocytosis assay. Fluorescent beads (Molecular Probes; 1 µM; F-8851) were washed once in sterile PBS, resuspended in Dulbecco modified Eagle medium-10% FCS, and sonicated for 10 intervals at 10 seconds each. Twenty-five microliters of bead solution was incubated with day 12 differentiated macrophages in 24-well plates for 2 h. Cells were then extensively washed with PBS, fixed with 1% paraformaldehyde, and analyzed by flow cytometry on a FACScalibur cytometer (Becton Dickinson).
M-CSF stimulation and actin filament staining. Day 10 in vitro-derived macrophages were plated in MM at 4 x 105 cells/ml on alcian blue-treated coverslips. After 24 h cells were cultured in M-CSF-free MM for 12 h and then restimulated with 5% M-CSF-conditioned medium for 5 min. Cells were fixed in 4% paraformaldehyde-PBS and stained with tetramethyl rhodamine isocyanate-conjugated phalloidin (Sigma; 25 ng/ml) in PBS-0.1% saponin-2% BSA. Peritoneal exudate cells were harvested from adult reconstituted mice. Cells (2 x 106) were plated for 2 h in IMDM-10% FCS, 50 U/ml penicillin, and 50 mg/ml streptomycin on alcian blue-treated coverslips. Coverslips were then washed once in PBS and stimulated with 5% M-CSF-conditioned medium for 5 min. Cells were fixed and stained with tetramethyl rhodamine isocyanate-conjugated phalloidin as above and labeled with biotin anti-F4/80 (eBiosciences; 1/500) in PBS-0.1% saponin-2% BSA and fluorescein isothiocyanate-coupled streptavidin (eBiosciences; 1/500). Photomicrographs were taken with a multifluorescence Zeiss Axioplan 2 microscope and acquired with SmartCapture 2 software.
Listeria infection. Day 12 in vitro-differentiated macrophages were prestimulated by treatment with 100 ng/ml LPS overnight (16 h). Listeria monocytogenes, strain 10403S cells were cultured overnight in brain heart infusion medium (DIFCO) at room temperature until they were in the exponential growth phase. A serial dilution of bacteria covering a range of 1,000 bacteria per cell to 10 bacteria per cell was added to macrophages in Dulbecco modified Eagle medium-10% FCS (without antibiotics) for 35 min. The wells were rinsed three times with medium, and remaining bacteria were killed by the addition of gentamicin at 5 µg/ml. Actin filaments were stained with phalloidin as described above, and bacterial and cellular nuclei were stained with 10 µg/ml DAPI (Roche) for 10 min. Photomicrographs were taken with an Axiophot fluorescence microscope.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
Together these results indicated that normal numbers of adult-type monocytes and macrophages could develop in MafB-deficient embryos.
Normal numbers of MafB–/– macrophages in reconstituted adult mice. Despite the apparently normal development of adult-type macrophages in MafB-deficient late gestational embryos, it could not be excluded that defects may become evident only later during adult life or in specific macrophage populations that could not be analyzed in the embryo. To test this possibility, we reconstituted lethally irradiated mice with MafB–/– and wt control fetal liver as a source of hematopoietic cells and analyzed macrophage populations in these mice after 8 to 12 weeks, when a complete hematopoietic system had been regenerated. Only mice with quantitative donor reconstitution and less than 2% remaining host contribution to the hematopoietic system were used for analysis. As shown in Fig. 4, we observed normal Mac-1/Gr-1 and Mac-1/F4/80 profiles of myelomonocytic populations in the bone marrow and spleen of MafB–/– reconstituted mice as well as elicited macrophages in the peritoneum 96 h after thioglycolate injection. No statistically significant differences could be detected between the relative proportions of MafB–/– (n = 4) and wt control (n = 4) myelomonocytic and macrophage populations in the analyzed organs (Fig. 4C). Together this indicated that also in adult mice MafB deficiency did not result in compromised macrophage differentiation.
|
and bacterial cell wall components such as LPS, macrophages secrete large quantities of NO, which is thought to contribute to bacterial killing. As shown in Fig. 5E, we observed the same level of NO production after LPS-IFN- stimulation for MafB–/– and wt control macrophages, indicating that MafB is not required for the signaling and effector mechanisms of this pathway.
|
|
-actinin. As shown in Fig. 7B, a significantly increased expression, ranging from 2- to over 12-fold, was observed in MafB-deficient macrophages for all of the analyzed genes, thus confirming the gene array data. Increased expression of ß-actin in MafB–/– macrophages was further confirmed on the protein level by Western blotting (Fig. 7C).
|
When Listeria monocytogenes cells are phagocytosed by macrophages, some bacteria can escape the phagolysosome and rearrange cellular actin to propel themselves through the cell and infect neighboring cells (9). Our studies with L. monocytogenes shown in Fig. 5A and B demonstrated that both MafB–/– and control macrophages contained actin-tailed bacteria that used the cellular actin machinery to move through the host cell. The altered expression of actin-modulating genes in MafB–/– macrophages thus did not appear to prevent the typical actin rearrangements induced by L. monocytogenes infection.
Macrophages are also highly motile cells and extend filopodia from the cell body during their movements, a process that equally involves extensive actin rearrangement. At least three of the genes that we found to be upregulated in MafB–/– macrophages, the formin, fascin, and -actinin genes, have been shown to participate in the formation of filopodia (30, 31, 33, 35, 36). We therefore carefully analyzed cellular protrusions of phalloidin-stained control and MafB–/– macrophages at high magnification under the microscope. In contrast to MafB+/+ control macrophages (Fig. 8A), we observed multiple and frequently branched protrusions on a high proportion of MafB-deficient cells (Fig. 8B). Although control macrophages also had protrusions, they were less prominent, less frequent, and rarely branched. This difference was confirmed by counting straight and branched protrusions per 100 cells on control and MafB–/– macrophages (Fig. 8C).
|
To analyze whether this phenotype was also observed in macrophage populations directly isolated from tissues in vivo, we prepared peritoneal exudate cells from wt control or MafB–/– reconstituted mice, cultured them for 5 min in M-CSF, and stained them with antibody for F4/80 to detect macrophages and phalloidin to reveal the actin skeleton. As shown in Fig. 8H and I, actin+ F4/80– lymphocytes with a typical round morphology were detected in both control and MafB–/– samples. By contrast, macrophages still had a round morphology in the control samples (Fig. 8H) but had undergone dramatic shape changes in the MafB–/– samples (Fig. 8I). The macrophages had spread out and formed multiple extensive and often branched protrusions, similar to those observed before with in vitro-differentiated macrophages.
Together these results suggested that the increased expression of actin-modulating genes in MafB–/– macrophages caused changes in actin organization that altered the rapidity and extent of the formation of cellular, possibly filopodial, protrusions in response to M-CSF.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Early fetal and adult-type macrophage populations develop along distinct pathways in the embryo (7, 24, 27) and differ in their expression profile for Mac-1 and F4/80 (24). MafB deficiency also did not appear to have selective effects on either of these populations, as we did not detect any differences of these populations in E12.5 interdigital macrophages (unpublished results), E14.5 fetal liver, prenatal spleen, or blood and adult reconstituted mice.
Although the original gain-of-function experiments were performed in an avian system (3, 20), the unexpected absence of a macrophage differentiation phenotype in MafB-deficient mice did not appear to be due to species-dependent differences of MafB function. The original observations in chicken cells have been confirmed in human cells now (3, 12), and retroviral overexpression of MafB in murine lineage negative bone marrow progenitors also promoted macrophage differentiation (S. Sarrazin and M. Sieweke, unpublished observations). Our data thus appear to indicate that MafB function in macrophage differentiation may be compensated for by other, closely related members of the Maf family such as c-Maf, which similarly to MafB can induce monocytic differentiation in human myeloid cell lines (14). Consistent with such a role, we observed that c-Maf expression is increased in MafB-deficient macrophages. The effect of a dominant-negative MafB construct on macrophage differentiation (20) might then be explained by its leucine zipper specificity, which permits dimerization with both MafB and c-Maf (18, 22) and thus inhibition of both molecules. These observations highlight the importance of the relative expression levels and functional interaction of different Maf family members in hematopoietic differentiation processes (25, 28). It may therefore be interesting in the future to combine MafB-deficient mice with other knockout alleles and overexpression strategies both for c-Maf and for other family members.
Despite the surprising absence of a macrophage differentiation phenotype, we found several genes to be differentially expressed between MafB+/+ control and MafB–/– macrophages that are related to the control of actin organization. At the moment it is unclear whether the identified genes are direct MafB targets. A preliminary inspection of the presumed promoter sequences of confirmed upregulated genes with MatInspector software (Genomatix), focusing on sequences between –2,000 bp and +500 bp from the transcriptional start site, did not identify high-homology sites with fewer than three mismatches to the TGCTGACTCAGCA MARE consensus binding site (19, 21). However, this does not necessarily exclude direct regulation of these genes by MafB. Firstly, Maf binding sites have been identified that deviate significantly from the MARE consensus but have high biological significance (16, 37). Furthermore, it is possible that more distant enhancer elements influence the expression of these genes. Finally, besides directly activating promoters via MARE binding sites, Maf factors including MafB can also repress gene expression by inhibitory interactions with other transcription factors (15, 34). It is thus possible that protein-protein interactions rather than direct DNA binding via MARE sequences mediate the repression of negative target genes, such as the potential candidates identified here. Irrespectively of whether these genes are direct MafB targets or whether their increased expression represents a more indirect consequence of an altered cellular state induced by MafB deficiency, their coregulation and functional relation suggest that they belong to a MafB-dependent transcriptional program of biological significance.
Essential monocyte/macrophage functions in patrolling and infiltrating tissues under physiological and pathological conditions require dynamic morphological changes (29). On the cellular level this involves the formation of lamellopodial and filopodial protrusions, processes that are highly dependent on the remodeling of the actin cytoskeleton (30). Of the genes upregulated in MafB-deficient macrophages a majority belonged to the family of actin binding proteins, which are known to regulate remodeling of the actin skeleton and dynamic changes in cell morphology (30). At least three of these have been shown to be directly involved in filopodium formation. The actin-bundling protein fascin has been shown to be required for filopodium formation in activated dendritic cells, neurons, and metastatic cancer cells (31, 35), cell types whose morphology is characterized by prominent cellular processes. Formins are a family of proteins that are also found in filopodia, including in macrophages (36), and some members have been shown to be required for filopodium formation (33). Interestingly, overexpression of FRL, a formin protein, has been shown to alter actin organization, morphology, and motility in macrophages (36). Finally -actinins also contribute to the remodeling of the actin skeleton (30) and are found at the base of filopodial structures (35).
Besides actin binding proteins, we also found upregulation of CAP, a highly conserved monomeric actin binding protein that regulates the cellular G-actin/F-actin ratio and the dynamic equilibrium of actin polymerization and depolymerization in response to extracellular signals. Experiments in several model systems indicate that the perturbation of CAP levels influences actin dynamics and cellular morphology in developmental processes that involve migration, invasion, and polarity (17). Interestingly, increasing cellular CAP levels by microinjection promoted the formation of actin filaments (11).
Together with the observed upregulation of ß-actin itself, the increased expression of these genes suggests that they may contribute to the formation of the characteristic branched actin-containing filopodial protrusion in MafB-deficient macrophages by stimulating actin reorganization. Macrophages undergo rapid morphological changes in response to M-CSF that involve both lamellopodial and filopodial extensions (29), which are under the control of communicating but distinct signaling pathways (2). It is possible that the increased expression of actin remodeling genes in MafB–/– macrophages alters these signaling pathways in ways that lead to aberrant interpretation of M-CSF signaling. Alternatively our results are also consistent with the hypothesis that MafB deficiency may change the intracellular sensitivity to M-CSF and thus lead to a grossly exaggerated but in principle normal response to M-CSF.
In summary, whereas MafB function in macrophage differentiation can unexpectedly be completely compensated for by other family members, it appears to be specifically required for the control of M-CSF-induced changes in macrophage morphology and actin organization.
. . . . . .
|
ACKNOWLEDGMENTS |
|---|
A. Aziz was supported by the Kind Philipp Stiftung für Leukämieforschung; P. Mohideen, C. Otto, and L. Vanhille by the French Ministère de l'éducation nationale, de l'enseignement supérieur et de la recherche; C. Otto by La Ligue Nationale contre le Cancer; Y. Bakri by the Centre National de la Recherche Scientifique (CNRS) and the Fondation pour la Recherche Médicale (FRM); L. M. Kelly by the Association pour la Recherche sur le Cancer (ARC); and S. Sarrazin by ARC, the Societé Francaise d'Hématologie (SFH), and the Fondation de France (FdF). The work was supported by the ATIPE program of the CNRS; an installation grant from FRM; grant 2004004150 from FdF; and grants 5387, 8453, and 3422 from ARC.
|
FOOTNOTES |
|---|
Present address: Millennium Pharmaceuticals, 40 Landsdowne St., Cambridge, MA 02139.
Present address: Laboratoire de Biochimie-Immunologie, JER3012 associée à l'Agence Universitaire Francophone, Faculté des Sciences, Rabat, Morocco.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Allen, W. E., G. E. Jones, J. W. Pollard, and A. J. Ridley. 1997. Rho, Rac and Cdc42 regulate actin organization and cell adhesion in macrophages. J. Cell Sci. 110:707-720.[Abstract]
3. Bakri, Y., S. Sarrazin, U. P. Mayer, S. Tillmanns, C. Nerlov, A. Boned, and M. H. Sieweke. 2005. Balance of MafB and PU.1 specifies alternative macrophage or dendritic cell fate. Blood 105:2707-2716.
4. Blanchi, B., L. M. Kelly, J. C. Viemari, I. Lafon, H. Burnet, M. Bevengut, S. Tillmanns, L. Daniel, T. Graf, G. Hilaire, and M. H. Sieweke. 2003. MafB deficiency causes defective respiratory rhythmogenesis and fatal central apnea at birth. Nat. Neurosci. 6:1091-1100.[CrossRef][Medline]
5. Blanchi, B., and M. H. Sieweke. 2005. Mutations of brainstem transcription factors and central respiratory disorders. Trends Mol. Med. 11:23-30.[CrossRef][Medline]
6. Blank, V., and N. C. Andrews. 1997. The Maf transcription factors: regulators of differentiation. Trends Biochem. Sci. 22:437-441.[CrossRef][Medline]
7. Bonifer, C., N. Faust, H. Geiger, and A. M. Muller. 1998. Developmental changes in the differentiation capacity of haematopoietic stem cells. Immunol. Today 19:236-241.[CrossRef][Medline]
8. Cordes, S. P., and G. S. Barsh. 1994. The mouse segmentation gene kr encodes a novel basic domain-leucine zipper transcription factor. Cell 79:1025-1034.[CrossRef][Medline]
9. de Chastellier, C., and P. Berche. 1994. Fate of Listeria monocytogenes in murine macrophages: evidence for simultaneous killing and survival of intracellular bacteria. Infect. Immun. 62:543-553.
10. Eichmann, A., A. Grapin-Botton, L. Kelly, T. Graf, N. M. Le Douarin, and M. Sieweke. 1997. The expression pattern of the mafB/kr gene in birds and mice reveals that the kreisler phenotype does not represent a null mutant. Mech. Dev. 65:111-122.[CrossRef][Medline]
11. Freeman, N. L., and J. Field. 2000. Mammalian homolog of the yeast cyclase associated protein, CAP/Srv2p, regulates actin filament assembly. Cell Motil. Cytoskelet. 45:106-120.[CrossRef][Medline]
12. Gemelli, C., M. Montanari, E. Tenedini, T. Zanocco Marani, T. Vignudelli, M. Siena, R. Zini, S. Salati, E. Tagliafico, R. Manfredini, A. Grande, and S. Ferrari. 3 February 2006. Virally mediated MafB transduction induces the monocyte commitment of human CD34+ hematopoietic stem/progenitor cells. Cell Death Differ. [Online.] doi:10.1038/sj.cdd.4401860.
13. Hamada, M., T. Moriguchi, T. Yokomizo, N. Morito, C. Zhang, and S. Takahashi. 2003. The mouse mafB 5'-upstream fragment directs gene expression in myelomonocytic cells, differentiated macrophages and the ventral spinal cord in transgenic mice. J. Biochem. (Tokyo) 134:203-210.
14. Hedge, S., J. Zhao, R. Ashmun, and L. Shapiro. 1999. c-Maf induces monocytic differentiation and apoptosis in bipotent myeloid progenitors. Blood 94:1578-1589.
15. Hedge, S. P., A. Kumar, C. Kurschner, and L. H. Shapiro. 1998. c-Maf interacts with c-Myb to regulate transcription of an early myeloid gene during differentiation. Mol. Cell. Biol. 18:2729-2737.
16. Ho, I. C., M. R. Hodge, J. W. Rooney, and L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973-983.[CrossRef][Medline]
17. Hubberstey, A. V., and E. P. Mottillo. 2002. Cyclase-associated proteins: CAPacity for linking signal transduction and actin polymerization. FASEB J. 16:487-499.
18. Kataoka, K., K. T. Fujiwara, M. Noda, and M. Nishizawa. 1994. MafB, a new Maf family transcription activator that can associate with Maf and Fos but not with Jun. Mol. Cell. Biol. 14:7581-7591.
19. Kataoka, K., M. Noda, and M. Nishizawa. 1994. Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol. Cell. Biol. 14:700-712.
20. Kelly, L. M., U. Englmeier, I. Lafon, M. H. Sieweke, and T. Graf. 2000. MafB is an inducer of monocytic differentiation. EMBO J. 19:1987-1997.[CrossRef][Medline]
21. Kerppola, T. K., and T. Curran. 1994. A conserved region adjacent to the basic domain is required for recognition of an extended DNA binding site by Maf/Nrl family proteins. Oncogene 9:3149-3158.[Medline]
22. Kerppola, T. K., and T. Curran. 1994. Maf and Nrl can bind to AP-1 sites and form heterodimers with Fos and Jun. Oncogene 9:675-684.[Medline]
23. Li, M. A., J. D. Alls, R. M. Avancini, K. Koo, and D. Godt. 2003. The large Maf factor Traffic Jam controls gonad morphogenesis in Drosophila. Nat. Cell Biol. 5:994-1000.[CrossRef][Medline]
24. Lichanska, A. M., C. M. Browne, G. W. Henkel, K. M. Murphy, M. C. Ostrowski, S. R. McKercher, R. A. Maki, and D. A. Hume. 1999. Differentiation of the mononuclear phagocyte system during mouse embryogenesis: the role of transcription factor PU.1. Blood 94:127-138.
25. Motohashi, H., F. Katsuoka, J. A. Shavit, J. D. Engel, and M. Yamamoto. 2000. Positive or negative MARE-dependent transcriptional regulation is determined by the abundance of small Maf proteins. Cell 103:865-875.[CrossRef][Medline]
26. Motohashi, H., T. O'Connor, F. Katsuoka, J. D. Engel, and M. Yamamoto. 2002. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene 294:1-12.[CrossRef][Medline]
27. Naito, M., S. Umeda, T. Yamamoto, H. Moriyama, H. Umezu, G. Hasegawa, H. Usuda, L. D. Shultz, and K. Takahashi. 1996. Development, differentiation, and phenotypic heterogeneity of murine tissue macrophages. J. Leukoc. Biol. 59:133-138.[Abstract]
28. Onodera, K., J. A. Shavit, H. Motohashi, M. Yamamoto, and J. D. Engel. 2000. Perinatal synthetic lethality and hematopoietic defects in compound mafG::mafK mutant mice. EMBO J. 19:1335-1345.[CrossRef][Medline]
29. Pixley, F. J., and E. R. Stanley. 2004. CSF-1 regulation of the wandering macrophage: complexity in action. Trends Cell Biol. 14:628-638.[CrossRef][Medline]
30. Revenu, C., R. Athman, S. Robine, and D. Louvard. 2004. The co-workers of actin filaments: from cell structures to signals. Nat. Rev. Mol. Cell Biol. 5:635-646.[CrossRef][Medline]
31. Ross, R., H. Jonuleit, M. Bros, X. L. Ross, S. Yamashiro, F. Matsumura, A. H. Enk, J. Knop, and A. B. Reske-Kunz. 2000. Expression of the actin-bundling protein fascin in cultured human dendritic cells correlates with dendritic morphology and cell differentiation. J. Investig. Dermatol. 115:658-663.[CrossRef][Medline]
32. Sadl, V., F. Jin, J. Yu, S. Cui, D. Holmyard, S. Quaggin, G. Barsh, and S. Cordes. 2002. The mouse Kreisler (Krml1/MafB) segmentation gene is required for differentiation of glomerular visceral epithelial cells. Dev. Biol. 249:16-29.[CrossRef][Medline]
33. Schirenbeck, A., T. Bretschneider, R. Arasada, M. Schleicher, and J. Faix. 2005. The Diaphanous-related formin dDia2 is required for the formation and maintenance of filopodia. Nat. Cell Biol. 7:619-625.[CrossRef][Medline]
34. Sieweke, M. H., H. Tekotte, J. Frampton, and T. Graf. 1996. MafB is an interaction partner and repressor of Ets-1 that inhibits erythroid differentiation. Cell 85:49-60.[CrossRef][Medline]
35. Svitkina, T. M., E. A. Bulanova, O. Y. Chaga, D. M. Vignjevic, S. Kojima, J. M. Vasiliev, and G. G. Borisy. 2003. Mechanism of filopodia initiation by reorganization of a dendritic network. J. Cell Biol. 160:409-421.
36. Yayoshi-Yamamoto, S., I. Taniuchi, and T. Watanabe. 2000. FRL, a novel formin-related protein, binds to Rac and regulates cell motility and survival of macrophages. Mol. Cell. Biol. 20:6872-6881.
37. Yoshida, T., T. Ohkumo, S. Ishibashi, and K. Yasuda. 2005. The 5'-AT-rich half-site of Maf recognition element: a functional target for bZIP transcription factor Maf. Nucleic Acids Res. 33:3465-3478.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
