Molecular and Cellular Biology, January 2006, p. 389-401, Vol. 26, No. 2
0270-7306/06/$08.00+0 doi:10.1128/MCB.26.2.389-401.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Nina Marie Pedersen,
Ketil Winther Pedersen,
Inger Helene Madshus,* and
Espen Stang
Institute of Pathology, University of Oslo, Rikshospitalet, N-0027 Oslo, Norway
Received 18 March 2005/ Returned for modification 3 May 2005/ Accepted 26 October 2005
| ABSTRACT |
|---|
|
|
|---|
subunit or by transient overexpression of an AP2 sequestering mutant of Eps15, endocytosis of the transferrin receptor (TfR) was strongly inhibited. However, epidermal growth factor (EGF)-induced endocytosis of the EGF receptor (EGFR) was inhibited only in cells where the
subunit had been knocked down. By immunoelectron microscopy, we found that in AP2-depleted cells, the number of clathrin-coated pits was strongly reduced. When such cells were incubated with EGF, new coated pits were formed. These contained EGF, EGFR, clathrin, and Grb2 but not the TfR. The induced coated pits contained the
subunit, but labeling density was reduced compared to control cells. Induction of clathrin-coated pits required EGFR kinase activity. Overexpression of Grb2 with inactivating point mutations in N- or C-terminal SH3 domains or in both SH3 domains inhibited EGF-induced formation of coated pits efficiently, even though Grb2 SH3 mutations did not block activation of mitogen-activated protein kinase (MAPK) or phosphatidylinositol 3-kinase (PI3K). Our data demonstrate that EGFR-induced signaling and Grb2 are essential for formation of clathrin-coated pits accommodating the EGFR, while activation of MAPK and PI3K is not required. | INTRODUCTION |
|---|
|
|
|---|
The demonstration that nerve growth factor (NGF) increased the number of coated pits at the plasma membrane of sympathetic neurons (9) and that NGF signaled through tyrosine kinase receptor A to increase clathrin at the plasma membrane and in this way enhanced clathrin-mediated membrane trafficking (2) could argue that NGF would induce formation of new clathrin-coated pits at the plasma membrane. It was also demonstrated that ligand-binding to the EGFR, the T cell receptor, and the B cell receptor through Src-induced phosphorylation of clathrin influenced the distribution of clathrin at the plasma membrane (10, 37, 41). Induced formation of coated pits at the plasma membrane was recently demonstrated in the case of viruses, where influenza viruses taking the clathrin pathway were demonstrated to enter cells via de novo formation of clathrin-coated pits at sites of virus binding (30).
We have recently demonstrated that overexpression of Grb2 with inactivating point mutations in both SH3 domains (d.n.Grb2), as well as overexpression of human Sprouty 2, inhibiting the enzymatic activity of Cbl, inhibited the EGF-induced transport of the EGFR to clathrin-coated pits. Furthermore, we demonstrated that ubiquitin binding proteins played a role in recruiting the activated EGFR to clathrin-coated pits. We thus concluded that a macromolecular complex containing Grb2 and Cbl as well as ubiquitin-ubiquitin-interacting motif interactions played a role in recruitment of activated EGFR to clathrin-coated pits (36). We have extended studies of localization of the EGFR to clathrin-coated pits, and we now demonstrate that upon efficient knock-down of AP2, endocytosis of the EGFR was partly inhibited, while endocytosis of the TfR was blocked. Upon sequestering of functional AP2 or small interfering RNA (siRNA)-mediated knock-down of AP2, EGF was found to induce formation of a large number of new clathrin-coated pits. Formation of these coated pits depended on the EGFR kinase activity and was blocked by d.n.Grb2, as well as by Grb2, with single point mutations in either of the SH3 domains. This confirmed the requirement for Grb2. The TfR was excluded from EGF-induced coated pits, even though the new coated pits still contained AP2, with a labeling density inside coated pits approximately half that in control cells. The new coated pits further contained Grb2 but not Eps15. Altogether, these data suggest that upon EGF-induced signal transduction, AP2 and clathrin form EGFR-containing coated pits. Our findings further suggest that the requirement for AP2 is mechanistically different in endocytosis of the TfR compared to in endocytosis of the EGFR.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and treatment. HeLa cells were grown in Dulbecco's modified Eagle's medium (3.7 g/liter sodium bicarbonate) (BioWittaker) containing 1x penicillin-streptomycin mixture (17-603; BioWittaker) and 2 mM L-glutamine (BioWittaker) and supplemented with 5% (vol/vol) fetal bovine serum (FBS) (PAA Innovations). Porcine aortic endothelial (PAE) cells (provided by Carl-Henrik Heldin, The Ludwig Institute, Uppsala, Sweden) were grown in Ham's F-12 (BioWhittaker) medium supplemented with 10% (vol/vol) FBS and 1x penicillin-streptomycin mixture. PAE.B2 cells (PAE cells stably transfected with human wild-type EGFR) (provided by Alexander Sorkin, University of Colorado Health Sciences Center, Denver, CO) were grown in Ham's F-12 medium supplemented with 10% (vol/vol) FBS, 1x penicillin-streptomycin mixture, and 400 µg/ml G418 sulfate (Invitrogen). The cells were plated at a density of 15,000 cells/cm2 48 h prior to experiments. For inhibition of EGFR kinase activity, Src kinase activity, PI 3-kinase (PI3K) activity, or MEK activity, cells were preincubated with PD153035 (100 nM) (Tocris Cookson, Inc.) for 1 h at 37°C, SU6656 (2 µM) (Calbiochem, Merck Biosciences) for 1 h at 37°C, wortmannin (500 nM) for 10 min at 37°C, or PD98059 (50 µM) (Tocris Cookson, Inc.) for 1 h at 37°C, respectively, in Eagle minimal essential medium (MEM) without HCO3 (Gibco/ Invitrogen Corporation) before the experiments were carried out in the presence of the inhibitors.
Plasmids and transient transfection of cells.
Enhancend green fluorescent protein (EGFP)-tagged
95/295-Eps15 (pEGFP-EH95, where EH95 refers to the construct
95/295-Eps15 lacking Eps15 homology [EH] domains 2 and 3) was provided by Alexandre Benmerah (Institut Cochin, Paris, France). Wild-type and kinase-negative (K721A) EGFR in the pRK5 vector was provided by Andrew Chantry (University of East Anglia, Norwich, United Kingdom). pEGFP-C2 was from BD Biosciences. Myc-tagged d.n.Grb2 (W36, 193K; nonfunctional N- and C-terminal SH3 domains) (pRK5Myc-d.n.Grb2) has been described previously (36). Plasmids encoding wild-type Grb2, N-SH3 Grb2 (W36K; nonfunctional N-terminal SH3 domain) and SH2 Grb2 (R86K; nonfunctional SH2 domain) were provided by Robin M. Scaife (University of Western Australia, Nedlands, Australia). Wild-type Grb2, N-SH3 Grb2, and SH2 Grb2 were amplified by PCR, and Myc fusion proteins of these Grb2 constructs were constructed by subcloning into a pRK5Myc vector provided by Alan Hall (UCL, London, United Kingdom). Myc-tagged C-SH3 Grb2 (G203R; nonfunctional C-terminal SH3 domain) was constructed by site-directed mutagenesis of Myc-tagged wild-type Grb2, using a QuikChange XL kit (Stratagene) according to the manufacturer's procedures. HeLa, PAE, and PAE.B2 cells were transiently transfected with plasmids 24 h prior to experiments using FuGene in accordance with procedures provided by the manufacturer. Transfection efficiency was approximately 30% for HeLa cells, 30% for PAE cells, and 15% for PAE.B2 cells, as estimated by counting fluorescing cells either directly (pEGFP-EH95) or upon immunocytochemical labeling either for the Myc tag (Grb2 constructs) using mouse anti-Myc antibody or for the EGFR using sheep anti-EGFR antibody. When HeLa cells were transfected with two different plasmids, approximately 25% of the cells were found to be cotransfected.
siRNA knockdown of µ2- and
-adaptin.
HeLa cells were treated twice with siRNA directed against µ2-adaptin (target sequence, AAGUGGAUGCCUUUCGGGUCA) or
-adaptin (target sequence, AAGAGCAUGUGCACGCUGGCCA) essentially as described by Motley et al. (22). Due to problems with detaching cells, the following changes were made to the protocol: 1 x 106 cells were seeded in a T75 flask the day before the first transfection. Four to six hours after each transfection, the transfection solution containing siRNA was replaced with ordinary growth medium without antibiotics. Twenty-four hours after the last transfection, the cells were plated for experiments at a density of 30,000 cells/cm2. All siRNAs including negative scrambled control siRNA (#4613) were synthesized and annealed by Ambion. When immunofluorescence was performed on siRNA-treated cells, siRNA was conjugated to Cy3 using a Silencer siRNA Labeling Kit-Cy3 (Ambion) according to manufacturer's procedures. Transfection efficiency was approximately 100% as measured by immunofluorescence of Cy3-conjugated siRNA.
Antibodies.
Mouse anti-
-adaptin antibody, rabbit anti-Grb2 antibody, rabbit anti-EGF antibody, and mouse anti-EGFR (sc-120) antibody were from Santa Cruz Biotechnology, Inc. Sheep anti-EGFR antibody was from Fitzgerald. Rabbit anti-clathrin light chain antibody was a gift from Frances Brodsky, University of California, San Francisco, Calif. Mouse anti-clathrin heavy chain, anti-ß-adaptin, anti-µ2-adaptin, anti-Grb2, and anti-early endosome antigen 1 antibodies were from BD Biosciences. Mouse anti-Myc antibody was from the 9E10 hybridoma (11). Rabbit anti-Myc antibody and rabbit anti-GFP antibodies were from Abcam Ltd. Mouse anti-EGFR (Ab-3) antibody was from Neomarkers, and rabbit anti-human TfR antibody was from HybriDomus. Rabbit anti-phospho p44/p42 mitogen-activated protein kinase (MAPK) (Thr 202/Thr 204) and rabbit anti-phospho Akt (Ser 473) antibodies were from Cell Signaling Technology. Rabbit anti-Eps15 antibody was from BAbCO. Peroxidase-conjugated anti-mouse immunoglobulin G (IgG) and peroxidase-conjugated anti-rabbit IgG antibodies were from Jackson ImmunoResearch Laboratories, Inc. Rabbit anti-mouse IgG antibody was from Cappel, ICN Biomedicals.
Immunocytochemistry and confocal microscopy. HeLa cells were plated on 12-mm coverslips in 24-well microtiter plates and treated as described in the legends of the figures. The cells were either incubated with Rh-Tf (20 µg/ml), Alexa 633-Tf (20 µg/ml), Alexa 488-EGF (2.4 nM), or Rh-EGF (2.4 nM) in MEM without HCO3 containing 0.1% (wt/vol) bovine serum albumin (BSA) for 15 min at 37°C; 2.4 nM EGF corresponds to 15 ng/ml EGF. The cells were then washed three times with ice-cold phosphate-buffered saline (PBS) and fixed in paraformaldehyde (4% [wt/vol] in Soerensen's phosphate buffer) for 20 min on ice. Cells were mounted using fluorescent mounting medium with 15 mM NaN3 (Dako Corporation). The cells were examined using a TCS XP confocal microscope (Leica Microsystems).
Immunoelectron microscopy (immuno-EM).
Cells treated as described in the figure legends were incubated with or without EGF in MEM without HCO3 containing 0.1% (wt/vol) BSA. Subsequently, the cells were fixed using paraformaldehyde (4%, wt/vol) and glutaraldehyde (0.1%, wt/vol) in Soerensen's phosphate buffer and processed as described by Griffiths et al. (13). Immunocytochemical labeling of thawed cryosections was performed essentially as described by Griffiths et al. (14) using protein A gold (purchased from G. Posthuma, Utrecht, The Netherlands) or gold coated with donkey anti-mouse or donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.). EGFR was labeled using a mixture of mouse anti-EGFR (sc-120) and mouse anti-EGFR (Ab-3); clathrin was detected using the rabbit anti-clathrin light chain antibody, while cells transfected with the different Grb2-constructs were detected using either the rabbit or the mouse anti-Myc antibody. Sections were examined using a Philips CM120 transmission electron microscope with a Megaview II TEM Soft Imaging System and a Philips Tecnai 12 transmission electron microscope with a Megaview III TEM Soft Imaging System. To estimate the number of coated pits per micrometer of plasma membrane, randomly oriented sections were scanned in a systematic random fashion. The length of the plasma membrane on randomly chosen cells was measured using a 500-nm lattice overlay to score intersections with the plasma membrane. No less than 300 µm of plasma membrane was measured in each of the three independent parallel experiments. To estimate the number of EGFR-positive coated pits and the distribution of the EGFR at the plasma membrane, no less than 50 coated pits and 100 gold particles were counted for each of the three independent labeling experiments. To measure the labeling density for
-adaptin in coated pits, the length of the coated membrane was measured using a 100-nm lattice overlay to score intersections with the coated membrane. The results represent the mean of at least three independent labeling experiments ± standard deviation (SD).
Western blotting. Cells in 12-well microtiter plates were treated as indicated in the figure legends before being subjected to Western blot analysis as previously described (33). The reactive proteins were detected using enhanced chemiluminescence (Amersham Biosciences).
Internalization of 125I-Tf.
Iron-saturated human Tf was iodinated with Na125I, as previously described (36). HeLa cells in 24-well microtiter plates were incubated with 70 ng/ml of 125I-Tf in MEM without HCO3 with 0.1% (wt/vol) BSA at 37°C for the times indicated in the figures. In the control (time point 0), the cells were incubated with 125I-Tf on ice for 1 min. The cells were washed three times with ice-cold PBS before being incubated with 3% Pronase E (wt/vol) in MEM without HCO3 for 1 h on ice. The cell suspension was transferred to Eppendorf tubes and centrifuged at 6,000 x g for 5 min at 4°C. The supernatant fraction was removed and counted in a
-counter (1470 Wallac WIZARD; Perkin Elmer, Inc.). The pellet fraction was washed in cold PBS before analysis by
-counting. Internalized 125I-Tf was measured as the ratio of cpm in the pellet to the supernatant fraction.
Internalization of 125I-EGF.
HeLa cells in 24-well microtiter plates were incubated with 1 ng/ml of 125I-EGF in MEM without HCO3 with 0.1% (wt/vol) BSA at 37°C for the times indicated. In the control (time point 0), the cells were incubated with 125I-EGF on ice for 1 min. The cells were washed three times with ice-cold PBS before surface-bound 125I-EGF was removed by incubating the cells twice with 0.2 M acetate buffer (pH 2.8) containing 0.5 M NaCl for 10 min on ice. The radioactivity released from the cell surface was subsequently measured in a
-counter. The cells were hydrolyzed with 1 M NaOH on ice for 60 min before the internalized 125I-EGF was measured in a
-counter. Internalized 125I-EGF was measured as the ratio of internalized to surface-localized cpm.
| RESULTS |
|---|
|
|
|---|
95/295-Eps15 (EH95) caused redistribution of AP2 from the plasma membrane to the cytoplasm, as detected by immunofluorescence, using an antibody to the
-adaptin subunit of AP2 (data not shown). Upon overexpression of EH95 in HeLa cells, we further found that endocytosis of Tf was strongly inhibited, consistent with previous findings (3) (Fig. 1A and B). However, in contrast to what was previously reported (4), ligand-induced endocytosis of the EGFR was unaffected (Fig. 1C and D). This was demonstrated both by immunofluorescence using Rh-EGF (2.4 nM) (Fig. 1C) and by an internalization assay with low and nonsaturating concentrations of 125I-EGF (1 ng/ml) (21, 42) (Fig. 1D). The internalization assay was performed by continuous incubation at 37°C in order to avoid saturating coated pits by binding EGF to cells on ice for long time periods (16). Internalized EGF further localized to early endosome antigen 1-positive vesicles both in nontransfected cells and in cells overexpressing EH95 (data not shown).
|
Immuno-EM was further used to study the localization of EGF/EGFR and TfR to coated pits at the plasma membrane. In nontransfected cells incubated with EGF on ice (Fig. 2A and D), both EGF and the TfR could be found in coated pits. Upon overexpression of EH95 and incubation of cells with EGF on ice, EGF and EGFR were found in coated pits (Fig. 2B and C, respectively). While less than 2% of the coated pits in control cells not incubated with EGF were EGFR positive (Table 1), incubation with EGF resulted in a more than 10-fold increase in the number of EGFR-positive coated pits both in control cells and in cells overexpressing EH95. The plasma membrane distribution of the EGFR changed correspondingly. No TfR was found in coated pits in cells overexpressing EH95 (Fig. 2E and F), and no endocytosis of Tf was observed even when Tf was added to the cells together with EGF at 37°C (results not shown). These results are consistent with the notion that the TfR is unable to internalize through the clathrin-coated pits used by the EGFR upon removal of AP2 from the plasma membrane and could potentially confirm the contention that the EGFR does not depend on AP2 for internalization from clathrin-coated pits (8, 22).
|
|
subunit of AP2, as previously described (22). Figure 3A demonstrates down-regulation of the µ2 and
subunits of AP2 in cells transfected with siRNA to knock down either µ2 or
. Partial down-regulation of the
and ß subunits of AP2, but not of the clathrin heavy chain, was observed upon treatment with siRNA to the µ2 subunit. Similarly, partial down-regulation of the µ2 and ß subunits of AP2 was observed with siRNA to the
subunit. This is consistent with the findings of Motley et al. (22). It should be noted that the
subunit was most efficiently down-regulated by siRNA to the
subunit (Fig. 3A). Scrambled negative control siRNA had no effect on the expression of µ2 or
(data not shown). We confirmed that uptake of 125I-Tf was fully blocked, while the uptake of 125I-EGF (1 ng/ml) at 37°C was not affected by siRNA to the µ2 subunit (Fig. 3B and C, respectively). However, upon knock-down of the
subunit, 125I-Tf uptake was completely inhibited, and the uptake of 125I-EGF (1 ng/ml) at 37°C was significantly inhibited (Fig. 3B and C). By immuno-EM, the number of coated pits found in µ2 and
siRNA-treated cells not incubated with EGF was strongly reduced compared to control cells. However, the number of coated pits increased approximately 10 times upon incubation of the siRNA-treated cells with EGF (Fig. 3D). Slightly more coated pits were induced in cells that had been incubated with siRNA to the µ2 subunit than in cells that had been incubated with siRNA to the
subunit (Fig. 3D). The labeling for EGFR within EGF-induced coated pits in cells treated with siRNA to the µ2 subunit was comparable to control cells incubated with EGF (compare Table 1 and Table 2). However, in agreement with the results on endocytosis of 125I-EGF, the EGF-induced increase in localization of EGFR to coated pits was less pronounced in cells that had been incubated with siRNA to the
subunit.
|
|
|
|
|
subunit of AP2, and Tf was not endocytosed even when added together with EGF (data not shown). The size of the EGF-induced coated pits was the same as in control cells and showed normal labeling for clathrin (data not shown). However, compared to control cells, the labeling for
-adaptin inside coated pits was reduced in density in cells overexpressing EH95 and in cells treated with siRNA to the µ2 or
subunit of AP2 (Fig. 7). Quantification showed that in cells overexpressing EH95, the labeling density was reduced by approximately 50%, and in cells treated with siRNA to the µ2 or
subunits of AP2, the reduction of labeling for
-adaptin inside coated pits was almost 80% (results not shown).
|
|
|
Functional importance of Grb2 in EGF-induced formation of coated pits. We have recently demonstrated that Grb2 is recruited to the rim of EGFR-positive coated pits (36). This could imply that the EGF-induced formation of clathrin-coated pits directly results from recruitment of Grb2 to the activated EGFR. This would be consistent with the recent results by Jiang et al. (18), demonstrating that Grb2 is required for endocytosis of the EGFR. We therefore investigated the effect of d.n.Grb2 (inactivating mutations in both SH3 domains), incapable of binding proline-rich sequences, on EGF-induced formation of coated pits. As demonstrated in Fig. 8D, EGF was found not to increase the number of coated pits when cells were cotransfected with d.n.Grb2 and EH95. As the two SH3 domains of Grb2 are responsible for recruitment of different signaling molecules, we further explored the effect of overexpression of the N-SH3 domain or the C-SH3 domain individually mutated within the context of full-length Grb2. As demonstrated, Grb2 mutated in the N-SH3 domain inhibited EGF-induced formation of coated pits almost as efficiently as did the d.n.Grb2 and more efficiently than did Grb2 mutated in the C-SH3 domain (Fig. 8D). It should be noted that even upon overexpression of Grb2 with an inactivating point mutation in the SH2 domain and upon overexpression of wild-type Grb2, the EGF-induced formation of coated pits was inhibited (Fig. 8D). The inhibiting effect of the SH2 mutant and of wild-type Grb2 can probably be explained by binding of proline-rich proteins to the functional SH3 domains, thereby sequestering such proteins away from the activated EGFR-Grb2 complex.
It has been reported that the Ras guanine nucleotide exchange factor Sos mainly interacts with the N-terminal SH3 domain of Grb2 (31, 32, 38), while Gab1 interacts with the C-terminal SH3 domain of Grb2 (20, 26). Accordingly, activation of MAPK in most cells requires a functional N-SH3 domain (43), while activation of PI3K usually requires recruitment of p85 to Gab1, and consequently a functional C-SH3 domain. To correlate the blocked recruitment of Sos and Gab1 to activation of MAPK and PI3K, we investigated the effect of overexpressing Grb2 with inactivating single and double point mutations on activation of MAPK and on activation of PI3K (assayed indirectly as phosphorylation of Akt). To increase the fraction of cells expressing the Grb2 mutants, the cells were cotransfected with pEGFP and subsequently subjected to fluorescence-based cell sorting. As demonstrated in Fig. 9, we found that Grb2 with mutations in N- or C-terminal SH3 domains or with mutations in both SH3 domains did not blunt activation of MAPK or of PI3K, arguing that redundant pathways exist. As reported by Huang and Sorkin, it should further be noted that extracellular signal-regulated kinase 1 and 2 (ERK1/2) activity was inhibited only by 50% in cells depleted of Grb2 and also fully rescued by Grb2-yellow fluorescent protein in HeLa cells. As discussed (17), the significant activation of ERK1/2 in cells with very low MEK1/2 activity can probably be explained by the substantial molar excess of MEK1/2 over ERK1/2 in the cells and a 1,000-fold increase of ERK kinase activity by MEK1/2, allowing dramatic signal amplification at this step of the ERK activation cascade. We thus conclude that the inhibitory effect on EGF-induced formation of coated pits by point mutations in either the N-SH3 or the C-SH3 of Grb2 cannot be explained by blunted MAPK or PI3K activity. The contention that PI3K is not involved in coated pit formation is consistent with our immuno-EM experiments demonstrating EGF-induced formation of coated pits in Wortmannin-treated HeLa cells transfected with siRNA to µ2 (data not shown). Since the ubiquitin ligase Cbl has been demonstrated to be required for endocytosis of the EGFR (19, 36), we investigated recruitment of Cbl to the Grb2 variants described above. Consistent with previously described findings (18), we found that both SH3 domains were required to efficiently recruit Cbl to Grb2 (data not shown).
|
|
| DISCUSSION |
|---|
|
|
|---|
subunit of AP2 could we clearly observe inhibition of EGF/EGFR endocytosis in HeLa cells. By overexpressing Eps15 with a deletion of EH domains (EH95), thereby sequestering AP2 in the cytosol, we found that endocytosis of the TfR but not endocytosis of the EGFR was inhibited. This finding is inconsistent with the findings of Benmerah et al., describing inhibitory effects on both endocytosis of EGF and Tf upon overexpressing Eps15 with deleted EH domains (4). It is likely that overexpression of Eps15 sequesters AP2 with different efficiency in different cell lines. This is consistent with our unpublished findings that knocking down the µ2 subunit inhibited endocytosis of the EGFR in A431 cells but not in HeLa cells. Our finding that more efficient knockdown of AP2 is required to block endocytosis of the EGFR than of the TfR argues that AP2 plays a different role in clathrin-mediated endocytosis of the EGFR than in endocytosis of the TfR. It has been established that µ2 directly interacts with the cytoplasmic tail of membrane-bound receptors marked for internalization by tyrosine-based sorting signals (24). Phosphorylation of µ2 has further been demonstrated to increase the binding affinity of AP2 for tyrosine-based internalization motifs (29), and phosphorylation of µ2 has been demonstrated to be required for sequestration of TfR into coated pits (25). Our results suggest that interaction between µ2 and the EGFR is not important for recruitment of the EGFR to clathrin-coated pits. Instead, we suggest that AP2 plays a more catalytic role in endocytosis of the EGFR by assembling required adaptor and effector proteins around AP2 appendage domains, which are protein interaction hubs in the formation of clathrin-coated pits (27). This is consistent with the reported findings that an EGFR deficient in high-affinity binding to AP2 (Y974F) was endocytosed as efficiently as was wild-type EGFR when expressed at low levels and that this endocytosis was inhibited upon K+-depletion of the cells (34). Furthermore, overexpression of a doubly mutated µ2 (D176A/W421A), which was fully incorporated into AP2 and was incapable of interacting with tyrosine-based internalization motifs, resulted in impaired endocytosis of the TfR, while endocytosis of the EGFR was unaffected (23).
Importantly, we found that overexpressing Eps15 with a deletion of EH domains (EH95), as well as knocking down the
or µ2 subunit of AP2, strongly reduced the number of clathrin-coated pits in the absence of EGF. However, when cells functionally depleted of AP2 were incubated with EGF, the number of clathrin-coated pits increased dramatically. While coated pits were hardly detectable in cells overexpressing EH95 or lacking the
or µ2 subunit of AP2 in the absence of EGF, the number of coated pits in EGF-treated cells increased to approximately 70% of the number of coated pits in control cells. This, together with the finding that lack of EGFR kinase activity completely inhibited coated pit formation, demonstrates that clathrin assembly is induced upon activating the EGFR kinase.
Our findings thus argue that EGF-induced activation of the EGFR induces recruitment or rearrangement of AP2 and clathrin through signaling downstream of the activated EGFR. The formation of coated pits was blunted by overexpression of Grb2 with point mutations in both SH3 domains and thus incapable of recruiting proteins with proline-rich domains. Also, single point mutations in either SH3 domain inhibited EGF-induced formation of coated pits. Grb2 with an inactivating point mutation in N-SH3 was slightly more inhibitory than Grb2 with an inactivating point mutation in C-SH3. This argues that recruitment of signaling proteins to both SH3 domains is important. Our findings that none of the single SH3 point mutations separately blunted activation of MAPK or PI3K argue that neither MAPK nor PI3K is essential for formation of clathrin-coated pits upon EGFR activation. Consistent with previous findings (18), we found that the ubiquitin ligase Cbl was not efficiently recruited to Grb2 unless both SH3 domains were intact. As the ubiquitin ligase activity of Cbl has been demonstrated to be critical for clathrin-dependent endocytosis of the EGFR (17, 36), our data are compatible with the model that EGF-induced formation of coated pits only happens upon recruitment of the Grb2-Cbl complex to the EGFR and subsequent activation of Cbl's catalytic activity. The potential importance of ubiquitin-ubiquitin-interacting motif interactions in the process of coated pit assembly will be addressed more closely in future studies.
By comparing antibody labeling of coated pits in EGF-treated control cells with EGF-treated AP2-depleted cells, we found a significant increase in the proportion of Grb2-positive coated pits in AP2-depleted EGF-treated cells. This strongly suggests that Grb2 has an important function in EGF-induced formation of coated pits. Grb2 was consistently found to localize at the rim of the coat, as previously reported (36). New coated pits induced upon adding EGF to cells treated with siRNA to the µ2 or
subunit of AP2 did not contain TfR, even though
-adaptin was present in the coats and µ2 was detectable upon Western blotting in both cases. This could be explained by either too little µ2 at the plasma membrane or a lack of phosphorylation of the µ2 subunit of AP2. This could potentially mean that even though AP2 is localized to the plasma membrane upon activation of the EGFR, kinases responsible for phosphorylation of µ2 are not recruited to EGF-induced coated pits upon knock-down of the µ2 or
subunit of AP2. This should be addressed in future studies. On incubation with EGF, the proportion of EGFR-positive coated pits was similar whether or not the coated pits were preexisting or induced in AP2-depleted cells.
Normally, there will be AP2-positive coated pits at the plasma membrane available for entry of the EGFR. However, there is reason to believe that formation of new coated pits is important in controlling endocytosis of the EGFR both under physiological and pathological conditions. Consistently, our present data demonstrate that also in serum-starved HeLa cells harboring normal levels of AP2 new coated pits are induced upon incubation with EGF. We have further demonstrated that cells strongly overexpressing ErbB2 do not significantly induce new coated pits upon incubation with EGF, in contrast to isogenic cells lacking ErbB2. The lack of EGF-induced formation of coated pits in cells overexpressing ErbB2 was found to coincide with a strongly reduced rate of endocytosis and down-regulation of the EGFR, while the endocytosis of the TfR was not affected by overexpression of ErbB2 (15).
| ACKNOWLEDGMENTS |
|---|
This work was supported by The Research Council of Norway (including the functional genomics program [FUGE]), The Norwegian Cancer Society, Medinnova, NOVO Nordic Foundation, Anders Jahre's Foundation for the Promotion of Science, Torsted's Legacy, Blix Legacy, and Bruun's Legacy.
| FOOTNOTES |
|---|
L.E.J. and N.M.P. contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Beattie, E. C., C. L. Howe, A. Wilde, F. M. Brodsky, and W. C. Mobley. 2000. NGF signals through TrkA to increase clathrin at the plasma membrane and enhance clathrin-mediated membrane trafficking. J. Neurosci. 20:7325-7333.
3. Benmerah, A., M. Bayrou, N. Cerf-Bensussan, and A. Dautry-Varsat. 1999. Inhibition of clathrin-coated pit assembly by an Eps15 mutant. J. Cell Sci. 112:1303-1311.[Abstract]
4. Benmerah, A., C. Lamaze, B. Begue, S. L. Schmid, A. Dautry-Varsat, and N. Cerf-Bensussan. 1998. AP-2/Eps15 interaction is required for receptor-mediated endocytosis. J. Cell Biol. 140:1055-1062.
5. Benmerah, A., V. Poupon, N. Cerf-Bensussan, and A. Dautry-Varsat. 2000. Mapping of Eps15 domains involved in its targeting to clathrin-coated pits. J. Biol. Chem. 275:3288-3295.
6. Blake, R. A., M. A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, and S. A. Courtneidge. 2000. SU6656, a selective Src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell. Biol. 20:9018-9027.
7. Cao, T. T., R. W. Mays, and M. von Zastrow. 1998. Regulated endocytosis of G-protein-coupled receptors by a biochemically and functionally distinct subpopulation of clathrin-coated pits. J. Biol. Chem. 273:24592-24602.
8. Conner, S. D., and S. L. Schmid. 2003. Differential requirements for AP-2 in clathrin-mediated endocytosis. J. Cell Biol. 162:773-779.
9. Connolly, J. L., S. A. Green, and L. A. Greene. 1981. Pit formation and rapid changes in surface morphology of sympathetic neurons in response to nerve growth factor. J. Cell Biol. 90:176-180.
10. Crotzer, V. L., A. S. Mabardy, A. Weiss, and F. M. Brodsky. 2004. T cell receptor engagement leads to phosphorylation of clathrin heavy chain during receptor internalization. J. Exp. Med. 199:981-991.
11. Evan, G. I., G. K. Lewis, G. Ramsay, and J. M. Bishop. 1985. Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell. Biol. 5:3610-3616.
12. Fry, D. W., A. J. Kraker, A. McMichael, L. A. Ambroso, J. M. Nelson, W. R. Leopold, R. W. Connors, and A. J. Bridges. 1994. A specific inhibitor of the epidermal growth factor receptor tyrosine kinase. Science 265:1093-1095.
13. Griffiths, G., A. McDowall, R. Back, and J. Dubochet. 1984. On the preparation of cryosections for immunocytochemistry. J. Ultrastruct. Res. 89:65-78.[CrossRef][Medline]
14. Griffiths, G., K. Simons, G. Warren, and K. T. Tokuyasu. 1983. Immunoelectron microscopy using thin, frozen sections: application to studies of the intracellular transport of Semliki Forest virus spike glycoproteins. Methods Enzymol. 96:466-485.[Medline]
15. Haslekas, C., K. Breen, K. W. Pedersen, L. Johannessen, E. Stang, and I. H. Madshus. 2005. The inhibitory effect of ErbB2 on EGF-induced formation of clathrin-coated pits correlates with retention of EGFR-ErbB2 oligomeric complexes at the plasma membrane. Mol. Biol. Cell 16:5832-5842.
16. Huang, F., A. Khvorova, W. Marshall, and A. Sorkin. 2004. Analysis of clathrin-mediated endocytosis of epidermal growth factor receptor by RNA interference. J. Biol. Chem. 279:16657-16661.
17. Huang, F., and A. Sorkin. 2005. Growth factor receptor binding protein 2-mediated recruitment of the RING domain of Cbl to the epidermal growth factor receptor is essential and sufficient to support receptor endocytosis. Mol. Biol. Cell 16:1268-1281.
18. Jiang, X., F. Huang, A. Marusyk, and A. Sorkin. 2003. Grb2 regulates internalization of EGF receptors through clathrin-coated pits. Mol. Biol. Cell 14:858-870.
19. Jiang, X., and A. Sorkin. 2003. Epidermal growth factor receptor internalization through clathrin-coated pits requires Cbl RING finger and proline-rich domains but not receptor polyubiquitylation. Traffic 4:529-543.[Medline]
20. Lewitzky, M., C. Kardinal, N. H. Gehring, E. K. Schmidt, B. Konkol, M. Eulitz, W. Birchmeier, U. Schaeper, and S. M. Feller. 2001. The C-terminal SH3 domain of the adapter protein Grb2 binds with high affinity to sequences in Gab1 and SLP-76 which lack the SH3-typical P-x-x-P core motif. Oncogene 20:1052-1062.[CrossRef][Medline]
21. Lund, K. A., L. K. Opresko, C. Starbuck, B. J. Walsh, and H. S. Wiley. 1990. Quantitative analysis of the endocytic system involved in hormone-induced receptor internalization. J. Biol. Chem. 265:15713-15723.
22. Motley, A., N. A. Bright, M. N. Seaman, and M. S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162:909-918.
23. Nesterov, A., R. E. Carter, T. Sorkina, G. N. Gill, and A. Sorkin. 1999. Inhibition of the receptor-binding function of clathrin adaptor protein AP-2 by dominant-negative mutant mu2 subunit and its effects on endocytosis. EMBO J. 18:2489-2499.[CrossRef][Medline]
24. Ohno, H., J. Stewart, M. C. Fournier, H. Bosshart, I. Rhee, S. Miyatake, T. Saito, A. Gallusser, T. Kirchhausen, and J. S. Bonifacino. 1995. Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 269:1872-1875.
25. Olusanya, O., P. D. Andrews, J. R. Swedlow, and E. Smythe. 2001. Phosphorylation of threonine 156 of the mu2 subunit of the AP2 complex is essential for endocytosis in vitro and in vivo. Curr. Biol. 11:896-900.[CrossRef][Medline]
26. Ong, S. H., Y. R. Hadari, N. Gotoh, G. R. Guy, J. Schlessinger, and I. Lax. 2001. Stimulation of phosphatidylinositol 3-kinase by fibroblast growth factor receptors is mediated by coordinated recruitment of multiple docking proteins. Proc. Natl. Acad. Sci. USA 98:6074-6079.
27. Praefcke, G. J., M. G. Ford, E. M. Schmid, L. E. Olesen, J. L. Gallop, S. Y. Peak-Chew, Y. Vallis, M. M. Babu, I. G. Mills, and H. T. McMahon. 2004. Evolving nature of the AP2 alpha-appendage hub during clathrin-coated vesicle endocytosis. EMBO J. 23:4371-4383.[CrossRef][Medline]
28. Puri, C., D. Tosoni, R. Comai, A. Rabellino, D. Segat, F. Caneva, P. Luzzi, P. P. Di Fiore, and C. Tacchetti. 2005. Relationships between EGFR signaling-competent and endocytosis-competent membrane microdomains. Mol. Biol. Cell 16:2704-2718.
29. Ricotta, D., S. D. Conner, S. L. Schmid, K. von Figura, and S. Honing. 2002. Phosphorylation of the AP2 mu subunit by AAK1 mediates high affinity binding to membrane protein sorting signals. J. Cell Biol. 156:791-795.
30. Rust, M. J., M. Lakadamyali, F. Zhang, and X. Zhuang. 2004. Assembly of endocytic machinery around individual influenza viruses during viral entry. Nat. Struct. Mol. Biol. 11:567-573.[CrossRef][Medline]
31. Sastry, L., W. Lin, W. T. Wong, P. P. Di Fiore, C. A. Scoppa, and C. R. King. 1995. Quantitative analysis of Grb2-Sos1 interaction: the N-terminal SH3 domain of Grb2 mediates affinity. Oncogene 11:1107-1112.[Medline]
32. Simon, J. A., and S. L. Schreiber. 1995. Grb2 SH3 binding to peptides from Sos: evaluation of a general model for SH3-ligand interactions. Chem. Biol. 2:53-60.[CrossRef][Medline]
33. Skarpen, E., L. E. Johannessen, K. Bjerk, H. Fasteng, T. K. Guren, B. Lindeman, G. H. Thoresen, T. Christoffersen, E. Stang, H. S. Huitfeldt, and I. H. Madshus. 1998. Endocytosed epidermal growth factor (EGF) receptors contribute to the EGF-mediated growth arrest in A431 cells by inducing a sustained increase in p21/CIP1. Exp. Cell Res. 243:161-172.[CrossRef][Medline]
34. Sorkin, A., M. Mazzotti, T. Sorkina, L. Scotto, and L. Beguinot. 1996. Epidermal growth factor receptor interaction with clathrin adaptors is mediated by the Tyr974-containing internalization motif. J. Biol. Chem. 271:13377-13384.
35. Sorkina, T., F. Huang, L. Beguinot, and A. Sorkin. 2002. Effect of tyrosine kinase inhibitors on clathrin-coated pit recruitment and internalization of epidermal growth factor receptor. J. Biol. Chem. 277:27433-27441.
36. Stang, E., F. D. Blystad, M. Kazazic, V. Bertelsen, T. Brodahl, C. Raiborg, H. Stenmark, and I. H. Madshus. 2004. Cbl-dependent ubiquitination is required for progression of EGF receptors into clathrin-coated pits. Mol. Biol. Cell 15:3591-3604.
37. Stoddart, A., M. L. Dykstra, B. K. Brown, W. Song, S. K. Pierce, and F. M. Brodsky. 2002. Lipid rafts unite signaling cascades with clathrin to regulate BCR internalization. Immunity 17:451-462.[CrossRef][Medline]
38. Vidal, M., J. L. Montiel, D. Cussac, F. Cornille, M. Duchesne, F. Parker, B. Tocque, B. P. Roques, and C. Garbay. 1998. Differential interactions of the growth factor receptor-bound protein 2 N-SH3 domain with son of sevenless and dynamin. Potential role in the Ras-dependent signaling pathway. J. Biol. Chem. 273:5343-5348.
39. Warren, R. A., F. A. Green, and C. A. Enns. 1997. Saturation of the endocytic pathway for the transferrin receptor does not affect the endocytosis of the epidermal growth factor receptor. J. Biol. Chem. 272:2116-2121.
40. Warren, R. A., F. A. Green, P. E. Stenberg, and C. A. Enns. 1998. Distinct saturable pathways for the endocytosis of different tyrosine motifs. J. Biol. Chem. 273:17056-17063.
41. Wilde, A., E. C. Beattie, L. Lem, D. A. Riethof, S. H. Liu, W. C. Mobley, P. Soriano, and F. M. Brodsky. 1999. EGF receptor signaling stimulates SRC kinase phosphorylation of clathrin, influencing clathrin redistribution and EGF uptake. Cell 96:677-687.[CrossRef][Medline]
42. Wiley, H. S., M. F. Woolf, L. K. Opresko, P. M. Burke, B. Will, J. R. Morgan, and D. A. Lauffenburger. 1998. Removal of the membrane-anchoring domain of epidermal growth factor leads to intracrine signaling and disruption of mammary epithelial cell organization. J. Cell Biol. 143:1317-1328.
43. Xie, Y., A. M. Pendergast, and M. C. Hung. 1995. Dominant-negative mutants of Grb2 induced reversal of the transformed phenotypes caused by the point mutation-activated rat HER-2/Neu. J. Biol. Chem. 270:30717-30724.
This article has been cited by other articles:
| |||