Dynamic Interactions between Pit-1 and C/EBP{alpha} in the Pituitary Cell Nucleus

The homeodomain (HD) transcription factors are a structurallyconserved family of proteins that, through networks of interactionswith other nuclear proteins, control patterns of gene expressionduring development. For example, the network interactions ofthe pituitary-specific HD protein Pit-1 control the developmentof anterior pituitary cells and regulate the expression of thehormone products in the adult cells. Inactivating mutationsin Pit-1 disrupt these processes, giving rise to the syndromeof combined pituitary hormone deficiency. Pit-1 interacts withCCAAT/enhancer-binding protein alpha (C/EBP ${alpha}$ ) to regulate prolactintranscription. Here, we used the combination of biochemicalanalysis and live-cell microscopy to show that two differentpoint mutations in Pit-1, which disrupted distinct activities,affected the dynamic interactions between Pit-1 and C/EBP ${alpha}$ indifferent ways. The results showed that the first ${alpha}$ -helix ofthe POU-S domain is critical for the assembly of Pit-1 withC/EBP ${alpha}$ , and they showed that DNA-binding activity conferred bythe HD is critical for the final intranuclear positioning ofthe metastable complex. This likely reflects more general mechanismsthat govern cell-type-specific transcriptional control, andthe results from the analysis of the point mutations could indicatean important link between the mislocalization of transcriptionalcomplexes and disease processes.

INTRODUCTION

Top

Introduction

The activation of transcription during development or in responseto cell signals involves the transient assembly of multiproteincomplexes at specific gene enhancers and promoters. The dynamicassembly of these complexes occurs through networks of proteininteractions that are coordinated by sequence-specific DNA-bindingfactors (8, 25). It is through these combinatorial interactionsthat tissue-specific transcription factors orchestrate eukaryoticgene expression (35). These activities are typified by the homeodomain(HD) transcription factors, a family of structurally conservedproteins that play critical roles in directing cell differentiationpathways during development and in the regulation of programsof gene expression in the differentiated cell types. The centralrole of these proteins is illustrated by many human diseases,from developmental defects to metabolic disorders that are linkedto mutations affecting the HD transcription factors (5). Forexample, the pituitary-specific HD transcription factor Pit-1(also called GHF-1 and POU1F1) is a member of the POU familyof transcription factors that directs the development of theanterior pituitary lactotrope, somatotrope, and thyrotrope celllineages (9, 16). Many different point mutations have been identifiedin the gene encoding Pit-1, and all three Pit-1-dependent celltypes fail to develop in patients with inactivating mutations.This results in the syndrome of combined pituitary hormone deficiency(CPHD), a disease characterized by the lack of prolactin (PRL),growth hormone (GH), and thyroid-stimulating hormone beta producedby these cells (6, 31). A clear understanding of how these disease-causingpoint mutations affect protein activities can provide uniqueinsight into protein structure and function.

In addition to its role in directing pituitary cell differentiation,Pit-1 also controls the transcription of the genes encodingthe hormone products of the mature cell types (9, 22). Throughits interactions with specific DNA elements in target gene promoters,Pit-1 recruits coregulatory proteins that alter histone acetylationand modify the chromatin structure, providing either a permissiveor repressive environment for transcription (15, 37, 38, 42,43, 45). In the permissive environment, Pit-1 mediates the transductionof cell signals at target promoters, but the direct phosphorylationof Pit-1 does not appear to play a critical role in these events(19, 30). Rather, precise homeostatic control is achieved througha network of interactions between Pit-1 and several differentclasses of transcription factors, including the nuclear receptors(10), other homeodomain proteins (14), Ets family proteins (2),and basic region-leucine zipper (B-Zip) transcription factors(37). The goal of our study was to determine how specific pointmutations in Pit-1 affected its dynamic network interactionswith other transcription factors.

Our earlier studies showed that Pit-1 and the B-Zip transcriptionfactor C/EBP ${alpha}$ cooperated in the regulation of pituitary geneexpression (18, 37), and the present studies define the dynamicinteractions between these transcription factors in the pituitarycell nucleus. C/EBP ${alpha}$ acts to direct programs of cell differentiationand plays key roles in the regulation of genes involved in energymetabolism (24). Paradoxically, several studies showed thatC/EBP family proteins localized to regions of centromeric heterochromatin(37, 40) which are typically associated with gene silencing(32). In an earlier study we showed that Pit-1 could recruitC/EBP ${alpha}$ from the regions of centromeric heterochromatin to theintranuclear sites occupied by Pit-1 (18). These observationsindicated a potential role for the HD transcription factor inorganizing other gene regulatory proteins in transcriptionallypermissive regions of the pituitary cell nucleus. In this study,we use the combination of biochemical analysis and live-cellmicroscopy to show that two different point mutations in Pit-1linked to CPHD which disrupt distinct activities affect thedynamic interactions of Pit-1 with C/EBP ${alpha}$ in different ways.Our studies emphasize that the interactions between transcriptionfactors that regulate cell-specific gene expression are a dynamicprocess. Moreover, these studies show that the probability ofthese proteins assembling in a particular region of the cellnucleus is related to the dominant chromatin-binding activitiesof the different protein partners, supporting the view thatthe repositioning of transcription factors represents an importantmechanism for directing changes in cell-specific gene expression.

MATERIALS AND METHODS

Top

Materials and Methods

Construction of expression vectors, transfection of cell lines, and reporter gene assays. The construction of plasmids encoding Pit-1 and C/EBP ${alpha}$ was describedpreviously (18). The fluorescent protein (FP) fusion proteinswere generated using expression vectors encoding the monomeric(A206K [44]) forms of the enhanced yellow or cyan fluorescentproteins (EYFP and ECFP; Clontech Takara Bio, Mountain View,CA). The mutations in Pit-1 were generated by site-directedmutagenesis (QuikChange; Stratagene, La Jolla, CA), and allexpression and reporter vectors were verified by automated nucleotidesequencing. The mouse GHFT1 (27) or human HeLa (ATCC CCL-2)cell lines were maintained as monolayer cultures in Dulbecco'smodified Eagle's medium containing 10% fetal calf serum. Theharvested cells were transfected with the indicated plasmidDNA(s) by electroporation as described previously (12). Thetotal amount of DNA was kept constant by using the empty plasmidDNA. For reporter gene analysis, the transfected cells weretransferred to 35-mm dishes and maintained in culture. Extractswere prepared from the cells after 24 h, and luciferase (Luc)activity was determined as described by the manufacturer (PromegaCorporation, Madison, WI). Each experiment was performed a minimumof three times, and Luc activity, corrected for total protein,was expressed as the mean ± standard error of the mean(SEM).

Western blotting, electrophoretic mobility shift assay, immunocytochemical staining, and immunoprecipitation. The Western blot analysis of the expressed proteins was describedpreviously (11, 18). The electrophoretic mobility shift assays(EMSAs) were performed on whole-cell extracts prepared fromtransiently transfected HeLa cells as described previously (11).A duplex oligonucleotide corresponding to a consensus Pit-1-bindingsite, 5'-GATCCGATTACATGAATATTC, was end labeled using [ ${gamma}$ -³²P]ATPand T4 polynucleotide kinase, purified, and used as a probe.Simon Rhodes (Indiana University School of Medicine) providedthe Pit-1 antibody used in the EMSAs. Indirect immunocytochemicaldetection of endogenous Pit-1 protein in fixed GHFT1 cells wasperformed as reported earlier (42). For the coimmunoprecipitationassays, Pit-1 and the mutated variants were epitope tagged withhemagglutinin (HA). HeLa cells were transfected with CFP-C/EBP ${alpha}$ alone or in combination with HA-Pit-1, HA-Pit-1^W261C, or HA-Pit-1^F135C.The whole-cell lysates were prepared after 24 h and preclearedwith agarose beads, followed by incubation with an HA-specificantibody conjugated to agarose beads (Santa Cruz Biotechnology,Santa Cruz, CA). The beads were washed several times by centrifugation,and the bound proteins were eluted with denaturing sample buffer(Invitrogen Life Technologies, Carlsbad, CA) and analyzed byWestern blotting. The chemiluminescence detection was performedusing anti-green fluorescent protein (GFP) primary antibody(Molecular Probes, Invitrogen Life Technologies, Carlsbad, CA)and a horseradish peroxidase-conjugated anti-rabbit secondaryantibody (Pierce Biotechnology, Rockford, IL).

ChIP. Two days following transfection with FuGENE (Roche, Indianapolis,IN) with the HA-Pit-1 expression plasmid, approximately 5 x10⁷ GHFT1 cells in 150-mm dishes were incubated in Dulbecco'smodified Eagle's medium containing 1% formaldehyde for 10 min.The cells were then rinsed with phosphate-buffered saline, andthe cross-linking was stopped by the addition of 0.125 M glycinefor 5 min. The cells were washed twice with ice-cold phosphate-bufferedsaline and then collected by scraping and pooled by centrifugation.The cell pellet was resuspended in ice-cold lysis buffer supplementedwith protease inhibitors and Dounce homogenized. The nucleiwere recovered by centrifugation, and the genomic DNA was sheeredto an average length of 500 bp by enzymatic digestion as describedfor the ChIP-It kit (Active Motif, Carlsbad, CA). The efficiencyof chromatin shearing was verified by gel electrophoresis. Thechromatin was precleared by treatment with protein G beads,and the chromatin immunoprecipitation (ChIP) assays were thenperformed with the indicated antibodies. Following immunoprecipitation,cross-linking was reversed by incubation at 65°C, the proteinswere removed by treatment with proteinase K, and the DNA waspurified. ChIP DNA was detected using standard PCR with thefollowing primer pairs: mouse Pit-1 enhancer (E) at kb –10.4,GCCTGTTGTGACATATACTTCAG and GGAGATTAACATGTAAGCACCG; Pit-1 interveningsequence at kb –4.7 (C), CCTGAAGCTGCGAGAGAAGC and GCCTGAGTAACTGAAGAACAG;Pit-1 promoter (P) at kb –0.2, GCCTGCTCCTCACTTTGTACG andGACCCGCTGCTTGCCAGTTCAC; mouse c-fos serum response element (SRE)at kb –0.35, GCGAGCTGTTCCCGTCAATC and GGATGGACTTCCTACGTCAC.The ChIP results were analyzed by ethidium bromide stainingof 3% agarose gels containing the PCR-amplified DNA and comparedto reactions containing 5% of the input DNA.

Live-cell microscopy and FRAP. Pituitary GHFT1 cells were transfected with the indicated plasmidDNA(s) encoding the FP fusion proteins and inoculated into culturedishes containing a 42-mm cover glass (ProSciTech, Queensland,Australia). On the following day, the cover glass with the monolayerof cells was transferred to a medium-filled chamber fitted tothe microscope stage (12). The temperature of the stage wasmaintained between 35 and 37°C using a Nevtek airstreamstage incubator (Nevtek, Burnsville, VA). The fluorescence recoveryafter photobleaching (FRAP) experiments were performed usinga Zeiss LSM 510 confocal microscope equipped with a 25-mW diodelaser generating the 405-nm line. For these experiments, prebleachimages were collected using 1.5-µW laser power, followedby a 500-ms bleach pulse at 135-µW laser power deliveredto a 2-µm-diameter spot. The shape and size of the bleachspot were kept constant for all experiments. Single images werethen collected with the 405-nm laser line (at 1.5-µW power)every 500 ms for 20-s-duration experiments or every 2 s for80-s-duration experiments. The fluorescence intensity in thebleached area was normalized to the initial fluorescence inthat same area (intensity of 1). Typically, a second cell inthe same field of view was used to correct for any bleachingthat occurred during the repetitive scanning. The individualexperiments involved the analysis of 5 to 10 different cells,and each experiment was repeated at least three times. The Studentt test was used to determine significance.

FRET microscopy and image analysis. The Förster resonance energy transfer (FRET) data werecollected with a wide-field Olympus inverted IX-70 microscopeequipped with a 60x 1.2-numerical-aperture water-immersion objectivelens. The filter combinations were 500/20-nm excitation, 515-nmbeam splitter, and 535/30-nm emission for YFP and 436/20-nmexcitation, 455-nm beam splitter, and 470/30-nm emission forCFP (Chroma Technology Corporation, Brattelboro, VT). The 12-bit-depthimages with no saturated pixels were obtained using a cooleddigital interline camera (Orca-200; Hamamatsu, Bridgewater,NJ). All images were collected at a similar gray-level intensityby controlling the excitation intensity using neutral densityfiltration and by varying the on-camera integration time. Theacceptor photobleaching FRET (apFRET) method used here was describedin detail previously (12, 13). To quantify the changes in donorfluorescence after acceptor photobleaching in specific regionsof the nucleus, an intensity profile comparison between thepre- and postacceptor bleach donor images was obtained and plottedas the pixel-by-pixel efficiency of donor dequenching (E%).For cell population analysis, the ISee graphical software wasused to integrate a series of computerized image analysis functionsinto a single algorithm that could be applied to sets of imagesin a consistent and unbiased way. First, a histogram-based statisticalmethod was used to determine the optimal threshold of the acquiredimages. The mean intensity of a defined area outside the whole-nucleusregion of interest (ROI) was measured to define the backgroundfluorescence, and this value was subtracted from each particularimage. The algorithm then measured the mean intensity of background-subtractednucleus ROI. All values measured were then exported for furtheranalysis using the Excel spreadsheet software (Microsoft, Redmond,WA). This method automatically corrected for donor bleachingand calculated the donor/acceptor ratio and the efficiency ofdonor dequenching for each set of images acquired from the populationof transfected cells.

For the printed images, the background was subtracted and theresulting image files were processed for presentation usingCanvas 8.0 (Deneba, Inc., Miami, FL) and rendered at 300 dotsper inch.

RESULTS

Top

Results

In this study, we used the mouse pituitary GHFT1 cell line asa model to determine how specific point mutations in Pit-1 affectits dynamic network interactions with other transcription factors.These cells have the characteristics of a pituitary somatotropeprogenitor cell that expresses low levels of Pit-1. Unlike maturepituitary somatolactotrope cells, GHFT1 cells do not expressendogenous C/EBP ${alpha}$ and have not differentiated to the point ofexpressing the hormone products PRL and GH (27, 37). Immunocytochemicalstaining of the endogenous Pit-1 protein in the mouse GHFT1cells showed that it was distributed in a reticular patternthroughout the nucleus (Fig. 1A), and we showed earlier thatexogenous Pit-1 expressed in these cells has a similar pattern(18). Although some Pit-1-dependent gene promoters, includingthe PRL and GH promoters, are inactive in GHFT1 cells, Pit-1does regulate its own transcription (36) as well as transcriptionof the c-fos gene (21) (Fig. 1B). We used ChIP to demonstratethat the expressed Pit-1 protein occupied the regulatory regionsof these specific target genes in GHFT1 cells. The results shownin Fig. 1C demonstrate that the expressed HA-Pit-1 bound tothe endogenous mouse Pit-1 enhancer, located –10 kb upstreamof the transcription initiation site, as well as to the Pit-1promoter. Importantly, no HA-Pit-1 binding was detected at asequence between the enhancer and promoter regions at kb –5(Fig. 1C). An earlier study showed that Pit-1 also interactedwith the SRE of the c-fos gene and that it could induce transcriptionof that gene (21). We show here that Pit-1 activated expressionof a Luc reporter gene under the control of the c-fos SRE, andthe ChIP analysis demonstrated that HA-Pit-1 occupied the endogenousDNA element (Fig. 1D). These results indicated that althoughPit-1 is distributed throughout the pituitary cell nucleus,it occupies the enhancer and promoters of specific target genes.

View larger version (32K):
[in this window]
[in a new window]
FIG. 1. (A) Subnuclear distribution of the endogenous Pit-1 protein in mouse GHFT1 cells. The GHFT1 cells were fixed and permeabilized and then incubated with an anti-Pit-1 antibody followed by a Texas Red-conjugated secondary antibody. (B) Diagrams of the Pit-1 and c-fos gene regulatory regions, showing the binding sites for Pit-1 (vertical bars) and the annealing sites for the different primer sets used in the ChIP assays (dashes). For the Pit-1 5'-flanking sequence, the primers annealed to the enhancer (E) and the promoter (P) regions, as well as an intermediate region (C) as a negative control. For the c-fos 5'-flanking region, the primers annealed to sequences that encompassed the Pit-1-responsive SRE. (C) ChIP analysis was done using GHFT1 cells transfected with HA-tagged Pit-1 (lanes 1 to 3, 6, and 7) or the empty HA vector (Vec; lanes 4 and 5). The nuclear extracts were incubated with an anti-HA antibody ( ${alpha}$ -HA; lanes 1 to 5) or a control immunoglobulin G (IgG; lanes 6 and 7), and the precipitated DNA was amplified by PCR with the Pit-1-specific primers indicated in panel B. The bottom panel shows the reaction controls using 5% of the input DNA. Note that the input for the IgG control and the ${alpha}$ -HA was the same (lanes 1 to 3). (D) Pit-1 activates transcription from the c-fos SRE. HeLa cells were transfected with a c-fos SRE-Luc construct in the absence or presence of a Pit-1-carrying plasmid (top panel). The results are plotted as fold activation of Luc expression ± SEM, determined for two independent experiments, each done in triplicate. ChIP analysis showed that HA-Pit-1 binds to the endogenous c-fos SRE region (bottom panel). The PCR used the SRE-specific primers indicated in panel B, and the precipitated DNA (lanes 1 to 3) or the input DNA (lanes 4 and 5) from the ChIP assay are shown as described for panel C.

We next determined how specific point mutations in either thePOU-HD or the POU-S domain of Pit-1 (Fig. 2A) affected its activity,subnuclear distribution, and interactions with another transcriptionfactor. A mutation located in the DNA recognition helix of thePit-1 HD, W261C, is responsible for the Snell dwarf mouse phenotype(28). In agreement with this earlier report (28), we demonstratehere that the binding of Pit-1 to a consensus response elementwas prevented by the Pit-1^W261C mutation (Fig. 2B, top panel).Pit-1^W261C was also deficient in the transcriptional activationof a Luc reporter gene under the control of the Pit-1-dependentPRL promoter (Fig. 2B). A second CPHD mutation, Pit-1^F135C,which disrupts the first ${alpha}$ -helix of the POU-S domain (Fig. 2A),was shown earlier to bind to DNA (41). Here, we showed thatPit-1^F135C retained the DNA-binding activity (Fig. 2C, top panel),but the mutated protein was greatly impaired in its abilityto activate the Pit-1-dependent PRL promoter (Fig. 2C).

View larger version (46K):
[in this window]
[in a new window]
FIG. 2. (A) Schematic representation of the Pit-1 and the CPHD proteins; the positions of the mutations are indicated by arrows. The relative DNA-binding activity and activation of PRL transcription for each protein are shown on the right. (B) DNA-binding and reporter gene activities of Pit-1 and the CPHD mutant Pit-1^W261C. The top panel shows an EMSA using a consensus Pit-1 element. The DNA-protein complexes for Pit-1 (arrowhead) and an Ets protein were observed, but no complex was formed by Pit-1^W261C (lane 5). Binding specificity was demonstrated by competition with two different concentrations of the unlabeled oligonucleotide (wedge; lanes 2, 3, 6, and 7), and the presence of Pit-1 in the complex was verified by the addition of an antibody specific for Pit-1 that cleared the protein from the reaction mixture (lane 4). The reporter gene analysis (lower panel) showed that Pit-1^W261C was inactive. The results are plotted as fold activation of Luc expression ± SEM, determined for three independent experiments, each done in triplicate. Western blot analysis showed that Pit-1 and Pit-1^W261C were expressed at similar levels in the HeLa cells (inset). (C) DNA-binding and reporter gene activities of the CPHD mutant Pit-1^F135C. The top panel shows an EMSA demonstrating that the F135C mutation retained DNA-binding activity (lane 5) similar to Pit-1 (arrowhead). Binding specificity was demonstrated by competition with unlabeled oligonucleotide, and the presence of Pit-1 or Pit-1^F135C was verified by the addition of an antibody specific for Pit-1 to clear the proteins (lanes 4 and 8). Western blot analysis showed that Pit-1 and Pit-1^F135C were expressed at similar levels in the HeLa cells (inset). The reporter gene analysis (lower panel) showed that Pit-1^F135C retained some transcriptional activity.

The effects of these two different CPHD mutations on the intranucleardistribution of Pit-1 in the GHFT1 pituitary cells were thencharacterized. The results showed that YFP-labeled Pit-1 expressedin the mouse GHFT1 cells adopted a pattern of subnuclear distributionsimilar to that of the endogenous protein (compare Fig. 1A and3A). In contrast, the YFP-labeled CPHD mutation, Pit-1^W261C,which failed to bind to specific DNA elements (Fig. 2B), didnot adopt this pattern of subnuclear distribution (Fig. 3B,intensity profile), while Pit-1^F135C, which has DNA-bindingactivity (Fig. 2C), distributed similarly to the wild-type Pit-1(Fig. 3C, intensity profile). These results argued that theDNA-binding activity of Pit-1 directs its positioning withinthe nucleus. The FRAP approach was then used to characterizethe effects of the Pit-1 CPHD mutations on the intranuclearmobility of Pit-1 in the pituitary cell nucleus. Pituitary GHFT1cells expressing the different CFP fusion proteins were identifiedusing low-intensity illumination with the 405-nm laser line.Sharp and colleagues (39) showed that the mobility of GFP-Pit-1in HeLa cells was not significantly different over a broad rangeof expression levels, but it is recognized that the level ofprotein expression can influence protein mobilities. We comparedthe relative expression levels of CFP-Pit-1 to the endogenousPit-1 in GHFT1 cells (Fig. 3E). GHFT1 cells express Pit-1 atlevels about 10 to 30% of that present in mature, PRL-secretingpituitary cells (37). Electroporation typically yields 40 to60% transfection efficiency, determined by comparison fluorescenceand bright-field images (data not shown). The expressed CFP-Pit-1,detected with an antibody directed against Pit-1, was similarin abundance to the endogenous Pit-1 protein in the GHFT1 cellextracts (Fig. 3E, compare endogenous Pit-1 in lane 1 with expressedPit-1 in lane 2). Although there is cell-to-cell variation inthe expression level of the CFP fusion proteins, these resultsshowed that, on average, the fusion proteins were not grosslyoverexpressed relative to the endogenous Pit-1 protein. Becauseof this concern, however, only cells expressing low levels ofthe CFP-labeled proteins were selected for FRAP measurements.The results of the FRAP analysis, summarized in Fig. 3D andTable 1, show that the time necessary for the recovery of fluorescencefor CFP-Pit-1 in the bleached region, represented as 50% recovery(t₅₀) and 80% recovery (t₈₀), was about 20 s and 97 s, respectively.The CPHD mutation Pit-1^W261C, in contrast to the wild-type protein,had significantly higher mobility (t₅₀ = 1.6s) than the wild-typeprotein, indicating that Pit-1 mobility is strongly affectedby its DNA-binding activity (Fig. 3D; Table 1). When comparedto the mobility of unfused CFP (t₅₀ $~$ 0.4 s) (Fig. 3D), Pit-1^W261Cmoved significantly slower, suggesting that this mutant maystill be interacting with either chromatin or other nuclearproteins to some degree. Interestingly, the mobility of theother CPHD mutation, Pit-1^F135C, which retains DNA-binding activity,was intermediate between Pit-1 and Pit-1^W261C (Fig. 3D; Table1). These protein mobilities represent the averages of manydifferent interactions, including the transient binding to chromatinand the cooperative interactions with other protein partners.

View larger version (49K):
[in this window]
[in a new window]
FIG. 3. The W261C mutation disrupts the intranuclear organization of Pit-1. Wide-field microscope images show the nuclei of pituitary GHFT1 cells that expressed YFP-Pit-1 (A), YFP-Pit-1^W261C (B), or YFP-Pit-1^F135C (C). In each case, the cells were stained briefly with the cell-permeant DNA dye H33342 before imaging. The profile plots quantify the relative intensities of the YFP-labeled proteins and the H33342-stained chromatin at the position along the red line in each overlay image. (D) Effects of the different CPHD mutants on intranuclear mobility of Pit-1. GHFT1 cells expressing the indicated CFP-labeled proteins were subjected to FRAP analysis. The recovery plots show the mean change in relative fluorescence intensity over a 90-second time frame, normalized to the prebleach levels. The results are the averages for 12 to 15 different cells, and the arrows indicate the t₅₀ recoveries for each group. (E) Western blot analysis of proteins extracted from GHFT1 cells (lane 1) or from GHFT1 cells transfected with 10 µg of a CFP-Pit-1 expression plasmid (lane 2). Equal amounts of total protein were loaded, and the resulting blot was probed with an antibody against Pit-1. The endogenous Pit-1 is the doublet running at 31 and 33 kDa (double arrowhead), and the expressed CFP-Pit-1 ran at 60 kDa (full arrowhead). NS (open arrowhead) indicates a nonspecific band detected by the Pit-1 antibody.

View this table:
[in this window]
[in a new window]
TABLE 1. Intranuclear mobilities of Pit-1, CPHD mutants, and C/EBP ${alpha}$ , expressed alone and in combinations in pituitary cells

The next studies were designed to determine how the cooperativeinteractions between Pit-1 and C/EBP ${alpha}$ were affected by the twodifferent CPHD point mutations. Earlier studies had shown thatthe endogenous C/EBP family proteins were localized to regionsof centromeric heterochromatin in mouse cells (18, 29, 34, 37,40, 46). When YFP-labeled C/EBP ${alpha}$ was expressed in GHFT1 cells,it accumulated in regions of centromeric heterochromatin, hereidentified by the preferential staining with the cell-permeantDNA dye H33342 (18). We used FRAP analysis to characterize themobility of CFP-labeled C/EBP ${alpha}$ in both the heterochromatin andareas of the nucleus outside the heterochromatin. This analysisdemonstrated that CFP-C/EBP ${alpha}$ had similar mobility kinetics inboth regions of the nucleus (t₅₀ = 4.5 s; t₈₀ = 20.7 s), indicatingthat there is an exchange of C/EBP ${alpha}$ between heterochromatic andeuchromatic regions (Table 1). In earlier studies we showedthat Pit-1 and C/EBP ${alpha}$ cooperated in the activation of both PRLand GH transcription (18, 37). In agreement with these earlierobservations, we show here that a Pit-1-dependent PRL-promoterluciferase reporter gene (–2.5 PRL-Luc), which has minimalactivity in HeLa cells, was induced 20-fold by the expressionof Pit-1 (Fig. 2 and 4A). Whereas expression of C/EBP ${alpha}$ aloneinduced the reporter gene activity less than 5-fold, the combinationof Pit-1 and C/EBP ${alpha}$ resulted in approximately 100-fold activation,demonstrating the cooperativity of these factors at the PRLgene promoter (Fig. 4A and B). The CPHD mutation Pit-1^W261C,which had no detectable transcriptional activity on its own,also had no activity when coexpressed with C/EBP ${alpha}$ (Fig. 4A).The CPHD mutation Pit-1^F135C, in contrast, retained some transcriptionalactivity at the PRL promoter, although it was significantlyimpaired compared to the wild-type protein (Fig. 4B). Importantly,Pit-1^F135C failed to cooperate with C/EBP ${alpha}$ at the PRL promoter(Fig. 4B). Since the mutated protein retained some transcriptionalactivity (Fig. 2C) but was defective in cooperativity with C/EBP ${alpha}$ (Fig. 4B), this result raised the question of whether the F135Cpoint mutation disrupted the interactions between Pit-1 andC/EBP ${alpha}$ .

View larger version (35K):
[in this window]
[in a new window]
FIG. 4. Cooperative interactions between Pit-1 and C/EBP ${alpha}$ in activation of the PRL promoter are prevented by the CPHD mutations. (A and B) HeLa cells were transfected with the reporter gene alone or with expression vectors encoding Pit-1, Pit-1^W261C, Pit-1^F135C, or C/EBP ${alpha}$ or in the indicated combinations. The Luc activity, corrected for total cellular protein, was normalized to the activity of the reporter alone, and errors are the SEM for five independent experiments, each done in triplicate. (C) Coimmunoprecipitation analysis showed that Pit-1 and C/EBP ${alpha}$ assemble in the same macromolecular complex. The lysates from cells coexpressing the indicated HA-tagged Pit-1 or Pit-1^W261C and CFP-C/EBP ${alpha}$ were incubated with an HA-specific antibody conjugated to agarose beads. The bound proteins were eluted, and the CFP-labeled C/EBP ${alpha}$ was detected by Western blotting; the left panel shows the input reaction. (D) In contrast to HA-Pit-1, HA-Pit-1^F135C failed to pull down CFP-C/EBP ${alpha}$ .

To address this question, we characterized the effect of theCPHD mutations on the interactions between Pit-1 and C/EBP ${alpha}$ bycoimmunoprecipitation. The results demonstrated that the CFP-C/EBP ${alpha}$ protein coprecipitated with the HA-tagged Pit-1 (Fig. 4C and D),indicating that these proteins associate as part of a metastablemacromolecular complex. Similarly, C/EBP ${alpha}$ was also pulled downas part of a macromolecular complex with the CPHD mutation Pit-1^W261C(Fig. 4C). This result indicated that despite the lack of bindingto specific DNA elements, Pit-1^W261C retained the ability toassociate with the protein complex that contained C/EBP ${alpha}$ . Onthe contrary, C/EBP ${alpha}$ was not coimmunoprecipitated with Pit-1^F135C(Fig. 4D). This result demonstrated that the F135C point mutationdisrupted the ability of Pit-1 to interact with the proteincomplex that included C/EBP ${alpha}$ .

When C/EBP ${alpha}$ and Pit-1 were coexpressed in the GHFT1 cells, weobserved that Pit-1 recruited C/EBP ${alpha}$ from the heterochromaticregions (18), and this activity is demonstrated here (Fig. 5,compare panels A and B). We then used the FRAP approach to determinewhether the coexpression of Pit-1 influenced the intranuclearmobility of CFP-C/EBP ${alpha}$ . Here, we show that when Pit-1 recruitedC/EBP ${alpha}$ from the heterochromatic regions, the mobility of CFP-C/EBP ${alpha}$ was significantly reduced, as demonstrated by an increase inthe average recovery time (t₅₀) for CFP-C/EBP ${alpha}$ from approximately4.5 s to 15 s (P < 0.05) (Fig. 5C; Table 1). The mobilityof CFP-Pit-1, however, was not affected by the coexpressionof C/EBP ${alpha}$ , and the average recovery time was not significantlychanged (17 s compared to 22 s alone) (Table 1). This resultcould indicate that the stochastic association of C/EBP ${alpha}$ withPit-1 was stabilized by the interaction of Pit-1 with its chromatin-bindingsites, thereby reducing the mobility of C/EBP ${alpha}$ . This view wassupported by the observation that C/EBP ${alpha}$ , which interacts atheterochromatic sites, significantly reduced the mobility ofthe DNA-binding-deficient CFP-Pit-1^W261C (P < 0.05) (Table1), whereas the mobility of CFP-C/EBP ${alpha}$ was not significantlychanged by Pit-1^W261C (Fig. 5D; Table 1). In contrast, therewas no effect of C/EBP ${alpha}$ on the mobility of the CFP-Pit-1^F135Cmutation (Table 1), which was consistent with their failureto associate. Together, these results indicate that dynamicprocesses drive the assembly of these proteins and that theinteractions of these transcription factors with chromatin stabilizethe protein complexes at those sites.

View larger version (47K):
[in this window]
[in a new window]
FIG. 5. When C/EBP ${alpha}$ and Pit-1 were coexpressed in pituitary cells, C/EBP ${alpha}$ was recruited from the heterochromatic regions to the intranuclear regions occupied by Pit-1. (A and B) Nucleus of a GHFT1 cell that coexpressed YFP-C/EBP ${alpha}$ and mRFP-Hp1 ${alpha}$ (A) or YFP-C/EBP ${alpha}$ and mRFP-Pit-1 (B) and was stained with H33342 just before imaging. (C) FRAP analysis of cells that expressed CFP-C/EBP ${alpha}$ alone or with YFP-Pit-1. The results compare the average recovery after photobleaching for CFP-C/EBP ${alpha}$ alone or for CFP-C/EBP ${alpha}$ that was coexpressed with YFP-Pit-1, and the arrows indicate the t₅₀ recoveries for each group. (D) FRAP analysis of cells that coexpressed CFP-C/EBP ${alpha}$ alone or with YFP-labeled Pit-1^W261C or Pit-1^F135C. Neither of the CPHD mutants affected the mobility kinetics of C/EBP ${alpha}$ , as indicated by the t₅₀ recoveries for each group (arrows).

The coimmunoprecipitation studies (Fig. 4C and D) demonstratedthat C/EBP ${alpha}$ and Pit-1 could associate in a common macromolecularcomplex, but what was missed by the in vitro analysis was wherethe proteins were assembled within the cell nucleus. To definethe spatial relationships between Pit-1 and C/EBP ${alpha}$ in the nucleiof living cells, we used the technique of apFRET microscopy,which provides sensitive and consistent measurements that donot require the correction for spectral cross talk (12, 26).This approach uses specific photobleaching of the acceptor fluorophorein the entire field of view and then measures the change inthe donor fluorophore signal after destruction of the acceptorfluorophore. An increase or dequenching of the donor fluorophoresignal provided a direct measure of FRET, demonstrating thatthe average distance between the fluorophores was less thanabout 80 Å.

Figure 6A shows that when CFP-C/EBP ${alpha}$ was recruited by using YFP-Pit-1,the proteins were in close proximity in specific regions ofthe pituitary cell nucleus, confirming our earlier studies (13).Here, images of the YFP-labeled Pit-1 (Acc1) and the colocalizedCFP-C/EBP ${alpha}$ (not shown) were acquired, and then the YFP labelingPit-1 was selectively bleached in the entire field of view.A second image of CFP-C/EBP ${alpha}$ (Don2) was acquired under identicalconditions to the first, and the change in the donor signalwas measured using an intensity profile to characterize theefficiency of donor dequenching (Fig. 6A, E% profile). In addition,Fig. 6B shows that C/EBP ${alpha}$ and Pit-1^W261C were also in close proximityin the intact pituitary cell nucleus (Fig. 6B, E% profile).However, these results also clearly show that the intranuclearpositioning of the protein assembly involving Pit-1^W261C wasdifferent from that of the wild-type protein (compare Fig. 6A and B).The apFRET revealed that the interactions between Pit-1^W261Cand C/EBP ${alpha}$ occur in regions of heterochromatin (Fig. 6B). Theseresults, supported by the FRAP analysis (Fig. 5; Table 1), suggestthat the chromatin-binding activities of these transcriptionfactors stabilized the association of these transcription factorsin particular regions of the cell nucleus. In striking contrast,when the CPHD mutation Pit-1^F135C was coexpressed with CFP-C/EBP ${alpha}$ ,there was no evident recruitment of either protein, and CFP-C/EBP ${alpha}$ remained localized to sites of heterochromatin (Fig. 6C). Althoughthe proteins were colocalized in many regions of the cell nucleus,the selective bleaching of the YFP labeling Pit-1^F135C did notlead to dequenching of the CFP labeling C/EBP ${alpha}$ (Fig. 6C, E% profile).

View larger version (34K):
[in this window]
[in a new window]
FIG. 6. Acceptor photobleaching FRET analysis in GHFT1 cells expressing YFP-Pit-1 and CFP-C/EBP ${alpha}$ (A), YFP-Pit-1^W261C and CFP-C/EBP ${alpha}$ (B), or YFP-Pit-1^F135C and CFP-C/EBP ${alpha}$ (C). The images were acquired in the YFP (acceptor) and CFP (donor) channels before and after selective photobleaching of the YFP (see Materials and Methods). Here, the images of the acceptor before photobleaching (Acc 1) and of the donor after photobleaching of the acceptor (Don2) are shown. Bar, 10 µm. Changes in relative CFP intensity after selective acceptor photobleaching were measured along the yellow lines, and the results were plotted as the efficiency of donor dequenching (E%) as a function of the relative pixel position (right panels). (D) FRET analysis in GHFT1 cell populations. Data were collected as described for panels A to C. Twenty cells expressing different YFP/CFP intensity ratios were picked for each combination of expression vectors, and the analysis was done in an automated way, as described in Materials and Methods. E% for the whole-nuclei ROI was plotted as a function of the YFP/CFP intensity ratio for each DNA condition.

Because these FP-labeled proteins were expressed from independentplasmids, the ratio of donor and acceptor proteins varied betweencells within the transfected cell population. The efficiencyof donor dequenching, which is proportional to FRET efficiency,is influenced by the ratio of donor- to acceptor-labeled proteins.When FRET occurs, the efficiency of donor dequenching will increasewith increasing amounts of available acceptor until the donorpopulation is saturated. If FRET does not occur, there willbe no donor dequenching, regardless of the acceptor concentration.Therefore, quantitative measurements of the spatial relationshipsbetween C/EBP ${alpha}$ and Pit-1 or the CPHD mutations required the analysisof populations of transfected cells. To collect apFRET measurementsfrom cell populations, we developed an automated computer algorithmthat provided consistent and unbiased measurements from populationsof cells (see Materials and Methods).

Here, the apFRET analysis determined the average donor dequenchingefficiency within the nucleus of each cell in the population,and this was plotted as a function of the acceptor-to-donorratio within those cells (Fig. 6D). The results showed a similarrelationship of donor dequenching to the acceptor-to-donor ratiofor the cell populations that coexpressed CFP-C/EBP ${alpha}$ with eitherYFP-Pit-1 or YFP-Pit-1^W261C (Fig. 6D), with maximum averagedequenching efficiencies of about 15%. In contrast, there wasno significant donor dequenching at any of the donor/acceptorratios tested for the pituitary cells that coexpressed CFP-C/EBP ${alpha}$ and YFP-Pit-1^F135C. The cell population results validated thoseshown for the representative cells (Fig. 6A, B, and C) and demonstratedthat both Pit-1 and Pit-1^W261C were closely associated in theintact cell nucleus. It is important to point out, however,that the value of the representative cell images is that theyillustrate the differences in the subnuclear locations of theassociated proteins. The apFRET analysis of the cell populationsalso confirmed the in vitro analysis, demonstrating that theCPHD mutation Pit-1^F135C failed to interact with C/EBP ${alpha}$ in theintact pituitary cell nucleus. Taken together, these resultsshowed that the first ${alpha}$ -helix of the POU-S domain is criticalfor the interactions of Pit-1 with C/EBP ${alpha}$ and showed that DNA-bindingactivity conferred by the HD is critical for the final intranuclearpositioning of this protein complex.

DISCUSSION

Top

Discussion

In sum, our findings have provided new insight into the dynamicinteractions between transcription factors in the cell nucleus.Aside from the core histone proteins, most chromatin-associatedproteins are dynamic within the nuclear compartment, and theirmobilities reflect their transient interactions with chromatinand with a variety of different protein partners (for example,see reference 33). Here, we showed that two different transcriptionfactors that function together in the control of pituitary cell-specificgene expression interacted as part of a metastable protein complex.The results indicate that the assembly of the protein complexis stabilized by the chromatin-binding activities of these transcriptionfactors, which position those proteins in particular regionsof the cell nucleus. Our study emphasizes how disease-causingpoint mutations can affect these processes, showing that a pointmutation disrupting DNA-binding activity of one partner shiftedthe intranuclear location where the proteins assembled. Althoughour studies focused on the protein interactions involving thepituitary-specific HD transcription factor Pit-1, they are germaneto understanding the molecular mechanisms that control the intranuclearorganization of different classes of transcription factors.

The three-dimensional structure of the HD protein family isremarkably conserved, indicating the importance of this structurefor DNA site recognition and the interactions with protein partners.The DNA-binding domain of Pit-1 is formed by both the POU-Sand POU-HD, which are separated by a flexible linker regionthat allows them to adopt various conformations on DNA (23,38). The Pit-1^W261C mutation, which causes the Snell dwarf mousephenotype, disrupts DNA binding by the POU-HD (28). The DNA-contactingsurface within the third ${alpha}$ -helix of the HD is formed by the highlyconserved V260 and C263 residues, and the ability of this surfaceto hydrogen bond with nucleotides of the target DNA elementsis prevented by the W261C mutation (23). The failure of themutated protein to bind specific DNA elements might adequatelyexplain the lack of transcriptional activity, but there areexamples of transcription factors with important functions thatdo not require their typical binding to specific DNA elements.For instance, the steroid hormone receptors, including the estrogenreceptor, can regulate gene expression without binding to DNAelements through their interactions with other classes of transcriptionfactors. Therefore, it was important to characterize the intranucleardynamics and interactions of the Pit-1^W261C mutation.

Our findings indicated that disruption of the DNA-binding surfacein the Pit-1 HD prevented the mutated protein from adoptingthe subnuclear organization associated with the wild-type protein.This result argues that the DNA-binding activity of the HD specifiesthe organization of Pit-1 in the cell nucleus. Furthermore,the FRAP analysis showed that the Pit-1^W261C mutation had significantlyhigher intranuclear mobility than the wild-type protein. Thisresult generally agreed with an earlier study in nonpituitarycells (39), although the mobilities we observed here in pituitarycells were much slower than those reported for the HeLa cells.Since the FRAP results represent the averages of many differentinteractions, including specific interactions with chromatinand the cooperative associations with protein partners, it seemslikely that the slower mobilities observed here could reflectthese pituitary-specific interactions.

The slower mobility of the wild-type Pit-1 compared to Pit-1^W261Ccannot be explained on the sole basis of DNA binding, however,since the second CPHD mutation, Pit-1^F135C, which can bind toDNA elements, had an intermediate mobility. In an earlier study,Vallette-Kasic et al. (41) showed that the substitution of thebulky phenylalanine for cysteine at position 135 filled a cavitybetween the first and fourth helices that is normally presentin the POU-S domain. It was suggested that this cavity mightfunction to mediate the interactions with other proteins. Earlierstudies showed that Pit-1 interacts with several different coregulatoryproteins, including the CREB-binding protein (CBP/p300) coactivatorcomplex (43, 45). Recently, Cohen et al. (7) showed that thePit-1^F135C protein bound to DNA was still capable of recruitingCBP, indicating that the cavity in the POU-S domain was unimportantfor the interaction with that coactivator protein. However,similar to our results, they observed that the transcriptionalresponses conferred by the mutated protein were impaired inpituitary cells, suggesting that interactions with other nuclearproteins might be prevented by the F135C mutation (7).

The activation of Pit-1-dependent transcription requires thecombinatorial interactions of Pit-1 with several different transcriptionfactors, including the B-Zip protein C/EBP ${alpha}$ . Surprisingly, severalstudies have shown that some C/EBP family proteins preferentiallylocalize to regions of centromeric heterochromatin (29, 34,37, 40, 46), regions that are typically associated with transcriptionalsilencing (32). For example, the ß-globin gene islocated in regions of heterochromatin in cell types where itis not expressed, but during erythroid cell differentiationit is repositioned outside the heterochromatin to nuclear regionsthat contain the erythroid-specific transcription factor NF-E2(3, 20). Here, in an analogous mechanism at the protein level,we showed that Pit-1 functioned to reposition C/EBP ${alpha}$ from sitesof heterochromatin to the intranuclear sites occupied by Pit-1.The recruitment activity correlated with the cooperative transcriptionalresponses conferred by the coexpressed proteins, suggestingthat the recruitment may be essential for this activity at thePRL gene promoter.

Using FRAP analysis, we demonstrated that C/EBP ${alpha}$ was very mobilein both heterochromatic and euchromatic regions of the pituitarycell nucleus, suggesting a dynamic equilibrium between thesetwo regions. Importantly, the coexpression of Pit-1, which ledto the recruitment of C/EBP ${alpha}$ to the intranuclear sites occupiedby Pit-1, resulted in a significant reduction in the mobilityof CFP-C/EBP ${alpha}$ . This result could indicate that the interactionof Pit-1 with chromatin-binding sites functions to stabilizethe complex with C/EBP ${alpha}$ , reducing its mobility. This activityappears predominant, since C/EBP ${alpha}$ had little effect on the mobilityof Pit-1 (Table 1). This view was supported further by the observationthat C/EBP ${alpha}$ , which interacts at heterochromatic sites, significantlyreduced the mobility of the DNA-binding-deficient CFP-Pit-1^W261C.These results suggest that the transient interactions of thesetranscription factors with chromatin are the dominant activityand that dynamic processes drive the assembly of these proteinsin metastable complexes at those sites. These observations supporta model where proteins move independently within the nuclearcompartment and stochastically assemble at specific intranuclearsites, as was used to describe the network of interactions betweenhistone H1 and high-mobility-group (HMG) proteins (4). Anotherrecent study describing the interaction between HMGB1 and theglucocorticoid receptor found that the residence time of theglucocorticoid receptor bound to chromatin was increased inthe presence of HMGB1 (1), suggesting that kinetic cooperativityof transcription factors may be a common feature in transcriptionalactivation. Finally, a similar model was also used to describethe assembly of the RNA polymerase I complex, which was envisionedas a series of sequential intermediate subunit interactionsthat give rise to progressively more stable complexes (17).

Our observations indicate that the assembly process is highlyspecific, since the Pit-1^F135C mutation failed to associatewith C/EBP ${alpha}$ (Table 1). The failure of the mutated protein toassociate with C/EBP ${alpha}$ was borne out by the coimmunoprecipitationand reporter gene studies. Moreover, the apFRET studies demonstratedthat, although Pit-1^F135C and C/EBP ${alpha}$ were colocalized in manyregions of the cell nucleus, there was no evidence for the interactionof these proteins. This contrasted with the apFRET results forPit-1 and C/EBP ${alpha}$ , which provided direct evidence that, on average,less than 80 Å separated the fluorophores that labeledthese proteins. The assembled proteins were not distributeduniformly in the nucleus, but rather occurred in discrete regions.These studies also confirmed the coimmunoprecipitation resultsdemonstrating the interactions between C/EBP ${alpha}$ and Pit-1^W261Cbut, importantly, extended the results to show that the interactionsinvolving Pit-1^W261C and C/EBP ${alpha}$ occur at heterochromatic sites.Further, the association of Pit-1^W261C and C/EBP ${alpha}$ in heterochromaticregions, also confirmed by the population analysis, may providea clue to the dominant inhibitory activity of the CPHD mutation.It is likely that other proteins that normally associate withPit-1 were similarly positioned to transcriptionally silentregions of heterochromatin. Together, the results demonstratea network of dynamic interactions between Pit-1 and C/EBP ${alpha}$ inthe intact pituitary cell nucleus and indicate that the DNA-bindingactivity of Pit-1 directs the intranuclear positioning of theprotein assemblies. In the absence of this dominant activity,as with the Pit-1^W261C mutation, the proteins assemble at theheterochromatic sites bound by C/EBP ${alpha}$ .

Changes in the nuclear distribution of proteins are known toaccompany stages in cell differentiation, suggesting that nuclearorganization may participate in establishing transcriptionalnetworks that lead to cell-specific patterns of gene expression(20). The identification of the protein-protein interactionnetworks that govern these processes will be critical for understandinggene expression control at the structural level (35). This goalis being achieved through the application of in vitro and insilico approaches, but these studies must be supported by thequantitative analysis of protein-protein interactions in livingcells. Furthermore, the analysis of how these protein-proteininteraction networks are disrupted by disease-causing mutationswill be crucial for understanding these complex processes. Here,we used kinetic and quantitative microscopy approaches to confirmand extend the biochemical analysis of protein-protein interactionsin the cell nucleus. The example we provide here likely reflectsmore general mechanisms that govern cell-type-specific transcriptionalcontrol, and the results obtained with the CPHD mutations couldindicate an important link between the mislocalization of transcriptionfactors or transcriptional complexes and disease processes.

ACKNOWLEDGMENTS

This work was supported by NIH DK47301 (R.N.D.) and F32 DK60315-01(T.C.V.).

We thank S. Rhodes (Indiana University School of Medicine) forthe Pit-1 antibodies, F. Schaufele (University of California,San Francisco) for providing critical feedback, and M. Logsdonand J. Parelli for technical assistance. We also thank A. Periasamyand Y. Chen from the Keck Center for Cellular Imaging, as wellas J. Redick and C. Davis from the Advanced Microscopy Facilityfor help with the microscopy.

FOOTNOTES

* Corresponding author. Mailing address: Department of Medicine, Box 800578 HSC, University of Virginia Health Services, Charlottesville, VA 22908-0578. Phone: (434) 982-3623. Fax: (434) 982-0088. E-mail: rnd2v{at}virginia.edu.

Published ahead of print on 14 August 2006.

Present address: Laboratory of Receptor Biology and Gene Expression,Bldg. 41, Room B602, National Cancer Institute, NIH, Bethesda,MD 20892-5055.

REFERENCES

Top