![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Afzal M. Dogar,
Catherine Kuntz,
Barbara Grisoni-Neupert,
Larry Richman, and
Lukas C. Kühn*
Swiss Institute for Experimental Cancer Research (ISREC), Genetics Unit, CH-1066 Epalinges, Switzerland
Received 27 June 2006/ Returned for modification 1 August 2006/ Accepted 25 August 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) (27). Its expression must be carefully controlled, as high IL-6 levels are associated with various autoimmune diseases and tumor growth (27, 60). IL-6 overexpression in mice causes polyclonal plasmacytosis, which may evolve to malignant monoclonal plasmacytoma (25, 57). High IL-6 expression is also associated with other advanced tumors (60). Notably, in multiple myeloma, there exists evidence for autocrine growth due to IL-6 overexpression (28). Both transcriptional and posttranscriptional regulation appears to be involved, as IL-6 mRNA stability is modulated by external stimuli that activate the MAP kinase and other signaling pathways (12, 42, 44, 65). IL-6 mRNA shares with mRNAs of several cytokines (IL-2, IL-3, IL-8, and TNF-), growth factors (granulocyte colony-stimulating factor [G-CSF], granulocyte-macrophage CSF [GM-CSF], and vascular endothelial growth factor), and growth-related transcription factors (c-myc, c-fos, and c-jun) the feature of being very unstable, thus keeping protein levels low. The 3' untranslated region (3'UTR) of IL-6 mRNA is sufficient to confer a short half-life to reporter RNA (3, 44, 56). Human and mouse IL-6 3'UTRs comprise six conserved AUUUA sequences that resemble AU-rich elements (AREs) and are assumed to be important for mRNA instability. However, no detailed analysis has been carried out.
AREs are among the best-characterized mRNA-destabilizing determinants. Their deletion typically provokes increased mRNA levels and, sometimes, as in c-fos mRNA, oncogenic cell transformation (41). In certain cases, AREs are sufficient to confer instability when grafted into the 3'UTR of an otherwise stable mRNA (50, 59). Initially described as AUUUA repeats, they were later defined as tandem repeats of an UUAUUUA(U/A)(U/A) sequence (31, 71). However, microarray studies found that about 5% of all mRNAs in HepG2 and primary fibroblast cell lines are unstable, with half-lives of less than 2 h (69), and that many of them have 3'UTR sequences that do not conform to classical AREs (47, 69). Moreover, the prediction of AUUUA repeats in 3'UTRs correlated in only 15 to 30% of cases with a short mRNA half-life (34, 47, 69). This suggests that many individual mRNAs comprise either unpredicted ARE variants or other unknown destabilizing sequences. Even classical AREs are usually imbedded in neighboring sequence elements that are conserved in evolution but differ for each gene (11), and in several cases, such as G-CSF (46), TNF- (53), and endothelin-1 (40), adjacent regions contribute to rapid mRNA degradation.
The precise mechanism by which AREs or other destabilizing elements induce rapid mRNA degradation is not fully understood. AREs induce a rapid shortening of the poly(A) tail, which precedes 3'-5' degradation and is thought to be a prerequisite for decay (20, 63, 67). Recently, however, other mechanisms, including 5'-3' degradation (14, 54) or endonucleolytic cleavage (29), have been postulated. Several proteins interact with AREs and promote or impede mRNA degradation. Best documented among degradation-promoting proteins are KSRP (15), the tristetraprolin (TTP) family members (6, 32, 52), and AUF1 (also known as hnRNP D) (70). AUF1 exists in four alternative splice variants of exons 2 and 7 (61). p45 has both the 19 amino acids of exon 2 and 49 amino acids of exon 7, whereas p37 has neither sequence. p40 and p42 comprise the exon 2 and exon 7 sequences, respectively. Although AUF1 is mostly nuclear, it shuttles to the cytoplasm, possibly attached to AREs (9). Evidence for destabilizing or stabilizing effects of AUF1 is contradictory and may vary depending on the cell line or isoforms analyzed. Ectopically expressed AUF1 p37 and p42 increased the instability of an ARE-containing mRNA in a hemin-treated differentiating human erythroleukemia cell line, K562 (38). In contrast, overexpression of each of the four myc-tagged AUF1 isoforms in NIH 3T3 cells stabilized ß-globin constructs with either GM-CSF or c-fos AREs (68). Another study using similar conditions of transiently overexpressed flag-tagged AUF1 concluded, however, that p37 was limiting in cells when an ARE-mRNA reporter construct was at saturating levels for the decay machinery. Under such conditions, overexpression of p37 could overcome the saturation and accelerate ARE mRNA decay in the NIH 3T3, HeLa, 293T, and COS-1 cell lines, suggesting a destabilizing function (49). Recently, RNA interference (RNAi) was used to define the role of AUF1 in rapid mRNA decay. Targeting exon 2 with small interfering RNA (siRNA), which reduced the levels of p40 and p45, increased the half-life of a green fluorescent protein (GFP)-GM-CSF construct, but no such effect was seen after targeting all four isoforms or only p42 and p45 (48). The authors concluded that the relative ratio of isoforms might be important and that p40 had a destabilizing function in HT1080 cells. Others, however, found that siRNA targeting of all isoforms increased the half-lives of p21 and cyclin D1 mRNA (33). Whether AUF1 plays a role in IL-6 mRNA stability has not been investigated.
In view of the probable importance of posttranscriptional regulation in IL-6 mRNA expression, we have investigated which cis-acting elements in the human IL-6 3'UTR are essential for conferring instability on a GFP reporter mRNA. As expected, ARE sequences stand out as important, but they do not fully account for the overall instability. We have newly identified a 3'UTR sequence with a potential stem-loop structure that is equally required. We have further tested whether AUF1 plays a role in IL-6 mRNA stability by lowering or increasing its level. These assays were performed in stably transfected NIH 3T3 cells using newly designed retroviral vectors for RNAi and inducible expression of AUF1 isoforms. In parallel, we have carried out coimmunoprecipitation (IP) of myc-tagged AUF1 with the mRNA. We conclude that AUF1 p37 and p42 bind to the destabilizing ARE sequences in vivo and promote mRNA decay solely under conditions of adequate protein expression.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids and retroviral vectors for GFP fusion constructs.
For expression of GFP, an EcoRV-BamHI fragment of pcD-TR1-
322 (45) was replaced by the NheI-BamHI fragment of pEGFP-C1 (Clontech, Mountain View, CA). All three reading frames were blocked at the end of the GFP cDNA by insertion of the sequence CGTTAATTAATTAACG into the BspEI site after fill-in. This vector is referred to as pcDTR-GFPst or the GFP control vector. The wild-type human IL-6 3'UTR was amplified by PCR from expressed sequence tag (EST) AI085963 using as the forward primer CGCGGATCCGGTACCTAGCATGGGCACCACCTCAG and the reverse primer CCGGAATTCTTAAAATGCCATTTATTGGTAT. This fragment was cut with BamHI and EcoRI and cloned into the BglII-EcoRI sites behind the stop codon of pcDTR-GFPst. The plasmid was named pcDTR-GFPst-IL-6 and transcribes into GFP-IL-6 mRNA.
Deletion clones of the IL-6 3'UTR were PCR amplified with appropriate primers and subcloned by the same procedure. We adopted the nucleotide numbering for human IL-6 mRNA of GenBank entry M54894. The wild-type and mutant constructs extended over the following nucleotide positions: positions 687 to 1106 (wild type), 687 to 1008 (1), 687 to 910 (2), 687 to 810 (3), 793 to 1106 (4), 888 to 1106 (5), 991 to 1106 (6), 793 to 1008 (7), 793 to 910 (8), and 888 to 1008 (9).
Linker scanning mutagenesis of pcDTR-GFPst-IL-6_2 was carried out such that a linker with the sequence CGCAGATCTACAATTGGGA replaced the 3'UTR sequence every 15 bp. This was achieved by PCR amplification with appropriate primers. Fragments to the left or the right of the linker were first amplified separately. The reverse primer of fragment 1 and forward primer of fragment 2 were designed such that they could hybridize to create the linker. The separately amplified fragments were then mixed and reamplified with terminal primers, recreating a 224-base 3'UTR fragment that was cloned into the pcDTR-GFPst vector. Point mutations in the IL-6_2 construct were introduced by PCR with appropriate primers, as for the scanning mutants.
For measurements by the Tet-Off system in NIH 3T3 and COS-7 cells, two retroviral vectors based on pBabe were devised. The details of these constructs will be reported elsewhere (B. Grisoni-Neupert et al., unpublished data). In short, the first vector, pZPCTHG, comprised the 7x Tet operator (17) next to a heterologous minimal promoter (26) and a cloning site for insertion of GFP-3'UTR constructs. The cloning site was followed by a polyadenylation signal of bovine growth hormone from pCDNA3 (Invitrogen). The same 7x Tet operator was used in the opposite orientation to drive the transcription of the puromycin resistance gene behind the cytomegalovirus (CMV) minimal promoter. The second vector, pBHTTA, comprised the tetracycline-sensitive trans-activator protein (17) under the control of the long terminal repeat promoter. The GFP-IL-6 fusion constructs were inserted into pZPCTHG as AgeI-BamHI fragments from pcDTR-GFPst-IL-6 or from mutants thereof. The human GM-CSF 3'UTR was amplified from EST AI655452 with forward (CGCGGATCCGGTACCGAGACCGGCCAGATGAG) and reverse CCGGAATTCAGAAGCATATTTTTAATAATAATT) primers. It was subcloned as an EcoRI-BamHI fragment into pcDTR-GFPst and from there into pZPCTHG. c-myc sequences were amplified from plasmid pACmyc11 (gift from Andreas Trumpp, ISREC) containing the mouse c-myc cDNA. The c-myc coding sequence with its 3'UTR was PCR amplified with the forward primer CCGGAATTCTGTACATGCCCCTCAACGTGAAC and reverse primer CCGGAATTCGCGGCCGCCTGTTATAAACGTTTTATTAAAG and cloned into the BsrGI and EcoRI sites of pEGFP-C1 (Clontech), resulting in the loss of the GFP stop codon. The GFP-myc fusion was subsequently cloned into the AgeI and NotI sites of pZPCTHG.
RNAi against mouse AUF1 in NIH 3T3 cells. The retroviral expression vector pRetro Super carrying the human histone H1 polymerase III promoter was obtained from T. R. Brummelkamp (4). pSMLH1 was constructed by replacement of the puromycin resistance gene by the blasticidin resistance gene. Three different oligonucleotides overlapping exon 4 or 5 of the AUF1 coding region were inserted into pSMLH1 such that they formed RNA hairpin structures (in boldface in the sequences below) once transcribed from the H1 promoter. Oligonucleotide 299 had the sequence GATCCCCTAAGAGAGTACTTTGGTGGTTCAAGAGACCACCAAAGTACTACTCTCTTATTTTTGGAAA and gave rise to a processed RNAi sequence corresponding to coding region positions 593 to 613 in exon 4 of mouse AUF1. Oligonucleotide 300 had the sequence GATCCCCGACCAATAAGAGGCGTGGGTTCAAGAGACCCACGCCTCTTATTGGTCTTTTTGGAAA, corresponding to the mouse AUF1 exon 5 sequence from positions 654 to 674, and oligonucleotide 301 had the sequence GATCCCCTAAGAGGCGTGGGTTCTGTTTCAAGAGAACAGAACCCACGCCTCTTATTTTTGGAAA, overlapping the mouse AUF1 exon 5 sequence from positions 660 to 680. The oligonucleotides were annealed with the appropriate opposite strand and ligated into pSMLH1 at HindIII and BglII sites. The control vector was without an insert.
mRNA isolation and half-life measurements.
Total or cytoplasmic RNA from cell cultures at 70% confluence and RNA from immunoprecipitation assays were isolated with the RNeasy mini kit (QIAGEN, Hilden, Germany). For RNA half-life measurements, actinomycin D (Sigma) was added at 6 µg/ml at 0, 30, 60, 120, and 180 min prior to RNA extraction. For Northern blots, 10 µg cytoplasmic RNA was separated in 1.2% agarose-2% formaldehyde gels. RNA was transferred to Immobilon Ny+ membranes (Millipore) and cross-linked by UV light (1.2 x 105 µJ) in a Stratalinker (Stratagene, La Jolla, CA). Hybridizations were carried out with cDNA fragments of the complete coding region of GFP or human GAPDH (glyceraldehyde-3-phosphate dehydrogenase). The radioactive probe was synthesized by random priming using 50 to 100 ng template DNA in the presence of 30 µCi [-32P]dCTP (3,000 Ci/mmol). The incorporation of label was at least 20%. Filters were prehybridized for 3 h at 42°C in hybridization buffer (50% formamide, 1% sodium dodecyl sulfate [SDS], 3.4x SSC buffer [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 10% dextran sulfate) with 200 µg/ml sonicated salmon sperm DNA. For hybridization, the probe was heat denatured, added to hybridization buffer, and incubated with the membranes for 17 h at 42°C. Membranes were washed twice for 30 min at 65°C in 0.2x SSC, 0.1% SDS. For autoradiography, Biomax films (Kodak) were exposed. Quantification was done with a model BAS-MP 2040S imaging plate (Fujifilm, Tokyo, Japan). For sequential hybridizations, membranes were stripped by boiling them twice for 5 min in 0.1x SSC, 0.5% SDS.
Real-time PCR measurements were carried out with the Applied Biosystems GeneAmp 5700 in conjunction with the Eurogentec quantitative PCR core kit or the Roche LightCycler in conjunction with either Roche FastStart DNA MasterPLUS hybridization probes or master SYBR green I according to the manufacturer's recommendations (Roche Diagnostics, Rotkreuz, Switzerland). The primer set for GFP was ACTACAACAGCCACAACGTCTATATCAT (forward) and ATGTTGTGGCGGATCTTGAAG (reverse), and the probe was 6-carboxyfluorescein (FAM)-CCTTGATGCCGTTCTTCTGCTTGTCG-6-carboxytetramethylrhodamine (TAMRA). The primer set for mouse acidic ribosomal protein P0 (mARP0) was CTTTGGGCATCACCACGAA (forward) and GCTGGCTCCCACCTTGTCT (reverse), and the probe was FAM-ATCAGCTGCACATCACTCAGAATTTCAATGGT-TAMRA. The primate ß-actin SYBR green primer set was CGCGAGAAGATGACCCAGAT (forward) and GCGAGAAGATGACCCAGATCA (reverse).
Mifepristone-inducible protein expression system. For inducible protein expression, we constructed two retroviral vectors based on the commercially available GeneSwitch system (Invitrogen). The first vector, pBSwitch, permits the constitutive expression of the trans-acting mifepristone-inducible Switch protein (5). To construct pBSwitch, we modified pBabeBleo (43) by removing the SV40 promoter and bleomycin resistance gene and inserting the sequence encoding the Switch protein of pSwitch (Invitrogen) behind the viral LTR promoter.
For the construction of mouse AUF1 isoforms with an amino-terminal myc tag, the vector pSBCMYC was derived from pZPCTHG. First, the CMV promoter from pCIneo (Promega, Madison, WI) was PCR amplified with the forward primer GCCCCGTCGACTCAATATTGGCCATTAGCCATA and a reverse primer containing the myc tag sequence (underlined), CCCCGCGGCCGCACGTGGATCCCGTACGGAATTCCAGATCCTCTTCAGAGATGAGTTTCTGCTCCATGGTGGTTCGAAGCTTCTCGAGCCCTATAGTGAGTCGTATTAAGT, and digested with NotI and SalI. Second, the SV40 promoter/bleomycin resistance gene cassette was isolated from pBabeBleo by digestion with SalI and ClaI. Third, the two above-named fragments were ligated into pZPCTHG after digestion with ClaI and NotI, which removes the puromycin resistance and GFP genes. The AUF1 p45 cDNA was amplified by PCR of an EST from the NIH using the forward primer GGGTACCATGTCGGAGGAGCAGTTC and the reverse primer GGGGATATCTTAGTATGGTTTGTAGCTATTT. The product was digested with Asp718I and EcoRV and cloned into pSBCMYC digested with BbuPI and BswiWI. This places p45 in frame with the myc tag.
This myc-tagged AUF1 p45 cDNA was subcloned into a Switch-regulated expression vector, pSLHGCG. pSLHGCG was derived from pZPCTHG by replacing the puromycin resistance coding sequence with the blasticidin resistance gene from pcDNA6-E (Invitrogen). The bidirectional Tet operator was replaced by another bidirectional promoter composed of the heterologous minimal promoter Gal4/Adeno/CMV/intron from pGene/V5-His A (Invitrogen) and the minimal promoter comprising the TATA box of the adenovirus major late promoter and the initiator of the terminal deoxynucleotidyl transferase from 5x GTTI-Gal4-VV (26). pSLHGCG was digested with HindIII and SphI. A fragment containing the myc-tagged AUF1 p45 cDNA and bovine growth hormone poly(A) signal was isolated from pSBCMYC-AUF1 p45 with HindIII and SphI and ligated to the above-named vector fragment. This produced pSLHGC-MYC AUF1 p45.
To obtain pSLHGC-MYC AUF1 p40, a deletion of exon 7 was made in p45 by PCR-mediated mutagenesis. First, exons 1 to 6 of pSLHGC-MYC AUF1 p45 were amplified with the forward primer GGGAATTCCGTACCATGTCGGAGGAGCAGTTCG and reverse primer CCATAACCACTCTGCTGATCTCCACCTCTTCCGCGAGCT. Second, exons 8 and 9 were amplified with the forward primer CGCGGAAGAGGTGGAGATCAGCAGAGTGGTTATGGGAAAGTATCCAGGC and reverse primer GAATAGGGCGGCCGC. Third, the above-described products were ligated due to complementary regions (in bold) using PCR with the forward primer at exon 1 and reverse primer at exon 9. The final PCR product was digested with BglII and NotI and subcloned into the corresponding region of pSLHGC-MYC AUF1 p45. pSLHGC-MYC AUF1 p42 was constructed from pSLHGC-MYC AUF1 p45 by replacing the region encompassing exon 2 with the corresponding region of EST AA154631, in which exon 2 is absent. pSLHGC-MYC AUF1 p45 was digested with EcoRI and BglII to remove the exon 2 region and ligated to an EcoRI/NcoI fragment from the same vector and the corresponding NcoI/BglII fragment from EST AA154631. In order to construct pSLHGC-MYC AUF1 p37, a deletion of both exons 2 and 7 was obtained by ligation of the exon 7 deletion PCR fragment used to obtain p40 and the exon 2 deletion fragment used to obtain p42. All expression constructs of AUF1 isoforms were sequenced.
Protein extracts, SDS-polyacrylamide gel electrophoresis, and Western blotting.
For total protein extracts, cells were lysed in CelLytic-M cell lysis reagent (C2978; Sigma). Protein concentration was determined with a protein assay reagent of Bio-Rad (Hercules, CA). SDS-polyacrylamide gel electrophoresis was performed with 12.5% polyacrylamide gels. For Western blots, proteins were transferred onto nitrocellulose ECL membranes (Amersham, Buckinghamshire, United Kingdom) with the Bio-Rad system. Membranes were preincubated in 1x TEN (20 mM Tris-HCl [pH 8], 1 mM EDTA, 140 mM NaCl), 5% milk powder three times for 15 min each time. Membranes were incubated with the first antibody for 2 h at room temperature or overnight at 4°C. Dilutions used were 1:1,000 for mouse monoclonal anti-myc tag antibody 9E10 (Roche Diagnostics) and 1:5,000 for monoclonal anti-
-tubulin immunoglobulin G (IgG) (T-6557; Sigma). Membranes were subsequently washed three times for 20 min each time in 1x TEN, 5% milk powder. Except for the anti-myc tag antibody, which was directly linked to peroxidase, membranes were incubated with a horseradish peroxidase-coupled goat anti-mouse IgG antibody (A-9044; Sigma) at a 1:20,000 dilution for 1 h at room temperature. Following two 10-min washes in 1x TEN, 5% milk powder, membranes were further washed twice for 10 min each time with 1x TEN, 0.1% Triton X-100, 1.4 M NaCl. Endogenous AUF1 was measured with polyclonal rabbit anti-mouse AUF1 antiserum (07-260; Upstate Biotechnology, Charlottesville, VA) and horseradish peroxidase-coupled goat anti-rabbit IgG (W4011; Promega). Detection was performed with the Amersham ECL kit, and membranes were exposed for different times to a Fuji X-ray film.
Coimmunoprecipitation of mRNA. To perform IP of mRNA with AUF1, 0.5 x 106 to 1 x 106 NIH 3T3 cells stably expressing myc-tagged AUF1 isoforms and GFP mRNA constructs were lysed in 400 µl CelLytic-M cell lysis reagent (C-2978; Sigma). Extracts were divided into two portions of 200 µl each. Of the first 200 µl (before IP), one-eighth (25 µl) was used for Western blot analysis of myc-AUF1 and the rest for RNA preparation (RNA-total). The second 200 µl was incubated at 4°C for 4 h with anti-c-myc agarose beads (A-7470; Sigma) according to the manufacturer's protocol. After a 15-s centrifugation at 10,000 x g, the 200-µl supernatant was collected, and again one-eighth (25 µl) was used for Western blots and the rest for RNA preparation (RNA-sup). The pellet of beads (IP) was washed twice with 1x IP buffer (I-5779; Sigma) and resuspended in 100 µl of 0.1x IP buffer. One-eighth of the pellet was used for Western blot analysis, and the rest of the sample was used for RNA preparation (RNA-IP). The Western blot analysis served as a control to show that all myc-tagged AUF1 was precipitated. Real-time PCR quantification of GFP and mARP0 mRNAs was performed with the LightCycler (Roche). The recovery of mRNA in the procedure was determined with the formula (RNA-IP + RNA-sup)/RNA-total and was generally between 30 and 80%. Experiments with lower rates of recovery were not considered. The efficiency of the IP of any mRNA was calculated as 100% x RNA-IP/(RNA-IP + RNA-sup).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
2) (Fig. 2), between positions 687 and 910 (numbering is as in GenBank entry M54894). However, a further subdivision of this region revealed a marked loss in its destabilizing capacity (compare mutants 3 and 8 with mutant 2). It suggested either more than one determinant in the 224-nucleotide 3'UTR of mutant 2 or the disruption of an essential element at the boundary of mutants 3 and 8. The result was unexpected, as all four ARE-like sequences of the GFP-IL-6_2 cluster between nucleotides 825 and 885 and were present in the 8 construct. Yet, the finding was confirmed with mutant 4, which comprised all six AREs but was only very partially destabilized. Consequently, nucleotides 687 to 825 must contain an element that contributes to rapid mRNA decay and does not belong to the AU-rich class.
|
2. This was achieved by PCR-mediated mutagenesis replacing every 15 nucleotides by a constant linker sequence. The resulting 15 mutants, A to O, were tested in stably transfected COS-7 cells by measuring their mRNA half-lives by Northern blot hybridization after the addition of actinomycin D (Fig. 3). Compared to the wild-type construct or to mutants with low half-lives (C, D, I, J, or N), several mutants showed increased half-lives. Notably, mRNA of mutants F, G, H, and L was significantly more stable than wild-type GFP-IL-6 mRNA. We conclude that the 3'UTR of human IL-6 mRNA has at least two separate destabilizing regions, only one of which, region L, comprises an ARE. Both regions need to be present to obtain full destabilization.
|
2 mutant construct with only the first 224 nucleotides of the 3'UTR was also strongly destabilized, although its decay was slightly slower than in COS-7 cells. Like in COS-7 cells, mutants G and L were partially stabilized compared to mutant 2, whereas the double mutant GL was slightly more stable. This shows that elements of both regions are necessary for destabilization in NIH 3T3 cells (Fig. 4). By extending linker region L, which covers a conserved ARE (Fig. 5), to the adjacent region M, comprising another conserved ARE-like sequence, we did not observe a notable increase in RNA stability (mutant IL-6_LM in Fig. 4). However, the IL-6_11 construct, with only the first 140 nucleotides of the IL-6 3'UTR and lacking all sequences resembling AREs, was more stable, similar to the 3 construct in COS-7 cells (Fig. 2). Further deletion of the FGH region (construct IL-6_12) increased the half-life to a value equal to that of GFP mRNA without IL-6 3'UTR (Fig. 4). This result suggests a moderate contribution of the FGH region in mutant IL-6_11 to the instability. A similar observation was made with mutant IL-6_13 without additional determinants outside the FGH region. Overall, we conclude that results from COS-7 and NIH 3T3 cells are qualitatively similar.
|
|
|
2 construct (Fig. 2) by using the retroviral vectors and Tet-Off analysis system in COS-7 cells. All three mutants showed a degradation rate similar to that of mutant G (Fig. 3) and were significantly more stable than the 2 construct (Fig. 6C). Notably, the complementary mutations in IL-6_m3 did not restore rapid mRNA decay, suggesting that not just structure, but probably also sequence, is important in this putative stem-loop region. Overexpression of AUF1 and its interaction with IL-6 3'UTR. In order to test whether specific proteins bind to the cis elements of IL-6 mRNA, we carried out in vitro binding assays with radiolabeled RNA probes encompassing either the first 224 bases of the IL-6 3'UTR or a specific probe with the putative stem-loop region and cytoplasmic extracts from COS-7 or NIH 3T3 cells. Invariably, with or without UV cross-linking, weakly appearing complexes were observed on nondenaturing gels but had to be considered nonspecific since they were easily competed with 0.5 mg/ml heparin or 5 µg/ml tRNA (data not shown).
As a consequence, we tested the importance of AUF1, a candidate protein known to interact with AREs that might be important for IL-6 degradation. Several recent studies using RNAi or overexpression of AUF1 have come to conflicting conclusions as to whether AUF1 stabilizes or destabilizes ARE-containing mRNAs (see the introduction). We first analyzed the effect of the overexpression of different AUF1 isoforms on the stability of the GFP-IL-6 construct. For this, we constructed retroviral vectors based on the commercially available GeneSwitch system (Invitrogen). It uses a trans-activating fusion protein with the Gal4 DNA binding domain, the activation domain of p65 of the NF-
B complex, and a mutated progesterone receptor ligand-binding domain (5). In the presence of the progesterone antagonist mifepristone, the chimeric trans-activator binds to the Gal4 promoter and induces target gene transcription. We determined that AUF1 protein was maximally expressed 24 h after induction with 1 nM mifepristone. Under these conditions, all four isoforms were strongly expressed (Fig. 7A). We estimated by Western blotting that the level of induced protein was between 10- and 30-fold that of endogenous AUF1 (not shown). The effect of AUF1 isoforms on the mRNA half-life was tested in stably transfected cell populations with the GFP-IL-6 construct under the control of the Tet-regulated promoter. AUF1 was induced (or not) for 24 h and then doxycycline added to block transcription of the GFP construct. Both AUF1 p37 and p42 increased the half-life of GFP-IL-6 mRNA by factors of 2.6- and 2.3-fold, respectively. In contrast, p40 and p45 failed to show any stabilization (Fig. 7B).
|
Taking advantage of the mutants described in Fig. 4, we next investigated which part of the IL-6 3'UTR is required for stabilization by AUF1. The GFP-IL-6_2 construct was also 2.9-fold induced by p37 overexpression, indicating the presence of critical sequences in first half of the 3'UTR (Fig. 7C). Similarly, the scanning mutant GFP-IL-6_G lacking the putative stem-loop but with its AREs intact showed a 2.0-fold-prolonged half-life with p37. However, with mutant GFP-IL-6_L, which lacks one of the ARE-like sequences, no enhancement of the mRNA stability by p37 was observed (Fig. 7C). This result indicates the importance of this ARE for the stability change and suggests that AUF1 may directly interact with this ARE.
In order to test whether the different AUF1 isoforms bind to the 3'UTR of IL-6 mRNA, we immunoprecipitated the proteins through their myc tag and measured the amount of coprecipitated GFP-IL-6 mRNA. In three independent experiments, between 25 and 65% of the mRNA coprecipitated with myc-tagged AUF1 p37 and p42 but not with p40 or p45 (Fig. 8A). Coprecipitations of GFP-IL-6 mRNA without AUF1 induction and of mARP0 mRNA served as controls to assess the nonspecific background. This was usually less than 10%. We next investigated which part of the mRNA was essential for coprecipitation. We found that in the presence of the ARE at site L (mutants GFP-IL-6_2 and GFP-IL-6_G), the mRNA was well coprecipitated (Fig. 8B). In contrast, the GFP vector alone or mutant GFP-IL-6_L, which lacks this ARE, was not coprecipitated.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A 3'UTR with multiple destabilizing elements may have evolved to make IL-6 mRNA more robust against mutations that abolish the short half-life. Each element may also respond to separate RNA-protein interactions, and this might augment the versatility of potential posttranscriptional regulation by signaling cascades. While prototype AREs, as in GM-CSF mRNA, reside in a narrow region (50), the more complex situation of IL-6 mRNA is not unique. Studies of G-CSF mRNA identified a destabilizing element adjacent to AREs that forms a stem-loop and prevents mRNA stabilization by the calcium ionophore A23187 (3, 46). The sequence and folding of the putative IL-6 mRNA stem-loop are clearly distinct from those in G-CSF mRNA. A second instability element outside AREs was also identified in TNF- mRNA (53). It destabilizes TNF- mRNA in a mutant cell line lacking the ARE-binding protein Tis-11b. Again, we see no similarity between this element and our putative stem-loop. Recently, an auxiliary HuR binding element was identified in the vicinity of the main destabilizing AREs of IL-8 mRNA (64). In endothelin-1 mRNA, two destabilizing regions were found, of which at least one functions as an ARE (40). Moreover, in c-fos and c-myc mRNA there exists good evidence for destabilizing sequences both in the coding region and the 3'UTR (21, 22, 24, 66).
As we could not identify any stable RNA-protein complex with the IL-6 3'UTR in vitro, we investigated whether the known trans-acting protein AUF1 plays a role in IL-6 mRNA instability. This was also motivated by the prevalent uncertainty as to whether AUF1 is stabilizing or destabilizing (see the introduction). We show in a single cell line and for a defined target mRNA that both exogenous overexpression of p37 and p42 (Fig. 7) and strongly diminished expression of all four endogenous AUF1 isoforms by RNAi (Fig. 10) enhance mRNA stability two- to threefold. Thus, our results reconcile apparently opposite views of the role of AUF1. It appears that destabilizing or stabilizing effects of AUF1 are essentially linked to the level of its expression. Under normal conditions, the AUF1 concentration seems optimal to ensure rapid IL-6 mRNA degradation. When AUF1 is suppressed, however, its destabilizing function disappears and RNA stability increases. These results are in agreement with siRNA targeting of total AUF1 in HeLa cells, where it stabilized p21 and cyclin D mRNA (33), and in endothelial cells, where the endothelin 1 mRNA level increased (40). They differ slightly from a study of HT1080, in which targeting of all four isoforms had no effect, and the targeting of only AUF1 exon 2, and hence p40 and p45, increased the half-life of a GFP-ARE reporter mRNA (48). Nonetheless, all these studies conclude that at least certain AUF1 isoforms have a destabilizing function in cells, a conclusion that was anticipated by in vitro studies (2, 70).
Most intriguing is the fact that certain AUF1 isoforms also stabilize ARE-containing mRNA when they are overexpressed (Fig. 7). Several groups have reported on the overexpression of AUF1 with quite different results. Thus, in the special case of hemin-treated K562 cells, ARE-containing mRNAs were found to be more stable in the first place and overexpression of AUF1, notably the p37 and p42 isoforms, promoted RNA degradation (38). The same group, using NIH 3T3 cells, found overexpressed p37 and p42 to stabilize mRNA with AREs from GM-CSF and TNF-, and even with a c-fos coding region determinant (68). Our results with IL-6 and GM-CSF 3'UTR constructs agree entirely with this study. However, unlike with c-fos mRNA (68), we see no stability change with a GFP-c-myc mRNA construct. Probably the instability determinant of the c-myc coding region cannot be inhibited by excess AUF1, and its dominance may have masked effects of AUF1 at AREs in the c-myc 3'UTR. Others reported more-complex changes in transgenic mice, when exogenous p37 was expressed from a ß-actin promoter (18). It upregulated c-myc, c-fos, and c-jun mRNA in the muscles and livers of certain mice but had little effect in other tissues or even downregulated GM-CSF and TNF- mRNA in the spleen. This suggests that relative levels of endogenous AUF1 and possibly other tissue-specific factors influenced the outcome. It was also shown that p37 can be limiting when an ARE target mRNA was overexpressed (49). Increased p37 expression could overcome the limitation and promote mRNA decay. The effect of the proteasome inhibitor MG132 on the IL-6 mRNA half-life (Fig. 9) is in line with results of previous studies of other ARE-containing mRNAs (35, 36). The modulation of AUF1 isoform levels through ubiquitination (37) supports the idea that AUF1 levels control mRNA degradation rates.
We can think of various models of how excess AUF1 might interfere with its function as a degradation-promoting protein. First, its interaction with AREs may become more extensive due to the higher cytoplasmic concentration and the mass law governing molecular interactions. Thus, fewer AREs would remain unoccupied, and a possible exchange for other ARE-binding proteins that also promote RNA degradation might be diminished. Several other proteins, notably TTP (6, 32, 55), the TTP family member Tis-11B (BRF1) (7, 52), and KSRP (15), were documented to bind to AREs and to promote mRNA decay. However, competition for ARE-binding sites, maybe already in the nucleus (9), would resemble stabilization by excess HuR (8, 13) and would not explain why AUF1 is a destabilizing protein in the first place. Second, ARE-bound AUF1 might serve as a platform for binding of a protein with enzymatic activity in RNA decay. Overexpressed unbound AUF1 might compete away such a protein and prevent the activity from reaching its target mRNA. Third, ARE-bound AUF1 interacts with other proteins on mRNA (22, 39). Its overexpression might alter these interactions through the formation of AUF1 dimers or multimers on the 3'UTR (62) such that the degradation-promoting function gets lost. This would imply that IL-6 mRNA degradation depends on the nature and stoichiometry of protein-protein complexes on the RNA.
Our experiments favor the third model, because mRNA stabilization by overexpressed AUF1 p37 as well as destabilization of GFP-IL-6 mRNA requires the presence of the same critical ARE identified by linker-scanning mutant L (Fig. 3 and 7C). Precipitation of up to 65% of the GFP-IL-6 mRNA with myc-tagged p37 or p42 indicates that the ARE at L is the binding site for AUF1 in vivo (Fig. 8B). In addition, only the two AUF1 isoforms with the highest affinity for AREs (62), p37 and p42, stabilize GFP-IL-6 mRNA, suggesting that stabilization requires AUF1 binding. We propose that endogenous AUF1 also binds preferentially to site L, as both the ARE at L and the expression of a minimum amount of AUF1 (Fig. 10) are required for rapid mRNA decay. A central problem for future experiments will be to find out how natural AUF1 at site L initiates deadenylation and mRNA instability and how AUF1 overexpression prevents this process. The major protein that needs to be removed from the poly(A) tail during its shortening is the poly(A)-binding protein 1 (PABP1). In this context it is interesting that two RNA recognition motives of PABP1 show a high affinity for AREs (51) and that PABP1 interacts with AUF1 on c-fos mRNA (22) and in vitro (39). Maybe the role of AUF1 bound to site L is to facilitate the binding of PABP1 to adjacent AU-rich sequences, and these interactions might be required for subsequent removal of PABP1 from poly(A) tails. As shown recently, AUF1 interacts also with eIF-4G in vitro, and translation might contribute to the removal of AUF1-PABP1 complexes from the 3'UTR (39). AUF1 overexpression, however, might promote AUF1 oligomerization on the RNA (62) at regions adjacent to site L and interfere with PABP1 binding.
A short mRNA half-life triggered by specific cis elements is a feature of several hundred different transcripts per cell (69). In spite of each 3'UTR being unique in sequence, rapid degradation converges probably in a limited number of pathways. Thus, if just a few specific proteins recognize instability elements and activate mRNA degradation, we may wonder whether these proteins show redundancy or specialize for certain mRNAs. Our RNAi experiments with NIH 3T3 cells suggest that no other protein can replace AUF1. It should be interesting to analyze whether candidate proteins, notably of the TTP family, are actually present and interact with IL-6 mRNA. Experiments will also be needed to explore how the stem-loop region contributes to the recruitment of destabilizing proteins in vivo. Finally, it remains to be tested whether signaling events that stabilize IL-6 mRNA require precise sequence elements and regulate the IL-6 mRNA-AUF1 interaction.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grant 3100-065435 from the Swiss National Science Foundation.
|
FOOTNOTES |
|---|
Published ahead of print on 5 September 2006.
S.P. and A.M.D. contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Brewer, G. 1991. An A+U-rich element RNA-binding factor regulates c-myc mRNA stability in vitro. Mol. Cell. Biol. 11:2460-2466.
3. Brown, C. Y., C. A. Lagnado, and G. J. Goodall. 1996. A cytokine mRNA-destabilizing element that is structurally and functionally distinct from A+U-rich elements. Proc. Natl. Acad. Sci. USA 93:13721-13725.
4. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2:243-247.[CrossRef][Medline]
5. Burcin, M. M., G. Schiedner, S. Kochanek, S. Y. Tsai, and B. W. O'Malley. 1999. Adenovirus-mediated regulable target gene expression in vivo. Proc. Natl. Acad. Sci. USA 96:355-360.
6. Carballo, E., W. S. Lai, and P. J. Blackshear. 1998. Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science 281:1001-1005.
7. Chen, C. Y., R. Gherzi, S. E. Ong, E. L. Chan, R. Raijmakers, G. J. Pruijn, G. Stoecklin, C. Moroni, M. Mann, and M. Karin. 2001. AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107:451-464.[CrossRef][Medline]
8. Chen, C. Y., N. Xu, A. B. Shyu, and S. S. Peng. 1999. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. Methods 17:11-20.[CrossRef][Medline]
9. Chen, C. Y., N. Xu, W. Zhu, and A. B. Shyu. 2004. Functional dissection of hnRNP D suggests that nuclear import is required before hnRNP D can modulate mRNA turnover in the cytoplasm. RNA 10:669-680.
10. Cressman, D. E., L. E. Greenbaum, R. A. DeAngelis, G. Ciliberto, E. E. Furth, V. Poli, and R. Taub. 1996. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 274:1379-1383.
11. Duret, L., F. Dorkeld, and C. Gautier. 1993. Strong conservation of non-coding sequences during vertebrate evolution: potential involvement in post-transcriptional regulation of gene expression. Nucleic Acids Res. 21:2315-2322.
12. Elias, J. A., and V. Lentz. 1990. IL-1 and tumor necrosis factor synergistically stimulate fibroblast IL-6 production and stabilize IL-6 messenger RNA. J. Immunol. 145:161-166.[Abstract]
13. Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17:3448-3460.[CrossRef][Medline]
14. Fenger-Gron, M., C. Fillman, B. Norrild, and J. Lykke-Andersen. 2005. Multiple processing body factors and the ARE binding protein TTP activate mRNA decapping. Mol. Cell 20:905-915.[CrossRef][Medline]
15. Gherzi, R., K. Y. Lee, P. Briata, D. Wegmuller, C. Moroni, M. Karin, and C. Y. Chen. 2004. A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol. Cell 14:571-583.[CrossRef][Medline]
16. Gluzman, Y. 1981. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23:175-182.[CrossRef][Medline]
17. Gossen, M., and H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551.
18. Gouble, A., S. Grazide, F. Meggetto, P. Mercier, G. Delsol, and D. Morello. 2002. A new player in oncogenesis: AUF1/hnRNPD overexpression leads to tumorigenesis in transgenic mice. Cancer Res. 62:1489-1495.
19. Graham, F. L., and A. J. Van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456-467.[CrossRef][Medline]
20. Greenberg, M. E., A. B. Shyu, and J. G. Belasco. 1990. Deadenylylation: a mechanism controlling c-fos mRNA decay. Enzyme 44:181-192.[Medline]
21. Greenberg, M. E., E. B. Ziff, and S. C. Schiavi. 1984. Stimulation of NIH 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 311:433-438.[CrossRef][Medline]
22. Grosset, C., C.-Y. A. Chen, N. Xu, N. Sonenberg, H. Jacquemin-Sablon, and A. B. Shyu. 2000. A mechanism for translationally coupled mRNA turnover: interaction between the poly(A) tail and a c-fos RNA coding determinant via a protein complex. Cell 103:29-40.[CrossRef][Medline]
23. Henderson, B. R., E. Menotti, C. Bonnard, and L. C. Kühn. 1994. Optimal sequence and structure of iron-responsive elements. Selection of RNA stem-loops with high affinity for iron regulatory factor. J. Biol. Chem. 269:17481-17489.
24. Herrick, D. J., and J. Ross. 1994. The half-life of c-myc mRNA in growing and serum-stimulated cells: influence of the coding and 3' untranslated regions and role of ribosome translocation. Mol. Cell. Biol. 14:2119-2128.
25. Hilbert, D. M., M. Kopf, B. A. Mock, G. Kohler, and S. Rudikoff. 1995. Interleukin 6 is essential for in vivo development of B lineage neoplasms. J. Exp. Med. 182:243-248.
26. Imhof, M. O., P. Chatellard, and N. Mermod. 2000. A regulatory network for the efficient control of transgene expression. J. Gene Med. 2:107-116.[CrossRef][Medline]
27. Ishihara, K., and T. Hirano. 2002. IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine Growth Factor Rev. 13:357-368.[CrossRef][Medline]
28. Ishikawa, H., N. Tsuyama, S. Abroun, S. Liu, F. J. Li, K. Otsuyama, X. Zheng, and M. M. Kawano. 2003. Interleukin-6, CD45 and the src-kinases in myeloma cell proliferation. Leuk. Lymphoma 44:1477-1481.[CrossRef][Medline]
29. Jing, Q., S. Huang, S. Guth, T. Zarubin, A. Motoyama, J. Chen, F. Di Padova, S. C. Lin, H. Gram, and J. Han. 2005. Involvement of microRNA in AU-rich element-mediated mRNA instability. Cell 120:623-634.[CrossRef][Medline]
30. Krowczynska, A. M., M. Coutts, S. Makrides, and G. Brawerman. 1989. The mouse homologue of the human acidic ribosomal phosphoprotein P0: a highly conserved polypeptide that is under translational control. Nucleic Acids Res. 17:6408.
31. Lagnado, C. A., C. Y. Brown, and G. J. Goodall. 1994. AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A). Mol. Cell. Biol. 14:7984-7995.
32. Lai, W. S., E. A. Kennington, and P. J. Blackshear. 2003. Tristetraprolin and its family members can promote the cell-free deadenylation of AU-rich element-containing mRNAs by poly(A) ribonuclease. Mol. Cell. Biol. 23:3798-3812.
33. Lal, A., K. Mazan-Mamczarz, T. Kawai, X. Yang, J. L. Martindale, and M. Gorospe. 2004. Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J. 23:3092-3102.[CrossRef][Medline]
34. Lam, L. T., O. K. Pickeral, A. C. Peng, A. Rosenwald, E. M. Hurt, J. M. Giltnane, L. M. Averett, H. Zhao, R. E. Davis, M. Sathyamoorthy, L. M. Wahl, E. D. Harris, J. A. Mikovits, A. P. Monks, M. G. Hollingshead, E. A. Sausville, and L. M. Staudt. 2001. Genomic-scale measurement of mRNA turnover and the mechanisms of action of the anti-cancer drug flavopiridol. Genome Biol. 2:RESEARCH0041.
35. Laroia, G., R. Cuesta, G. Brewer, and R. J. Schneider. 1999. Control of mRNA decay by heat shock-ubiquitin-proteasome pathway. Science 284:499-502.
36. Laroia, G., B. Sarkar, and R. J. Schneider. 2002. Ubiquitin-dependent mechanism regulates rapid turnover of AU-rich cytokine mRNAs. Proc. Natl. Acad. Sci. USA 99:1842-1846.
37. Laroia, G., and R. J. Schneider. 2002. Alternate exon insertion controls selective ubiquitination and degradation of different AUF1 protein isoforms. Nucleic Acids Res. 30:3052-3058.
38. Loflin, P., C. Y. Chen, and A. B. Shyu. 1999. Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev. 13:1884-1897.
39. Lu, J.-Y., N. Bergman, N. Sadri, and R. J. Schneider. 2006. Assembly of AUF1 with eIF4G-poly(A) binding protein complex suggests a translation function in AU-rich mRNA decay. RNA 12:1-11.
40. Mawji, I. A., G. B. Robb, S. C. Tai, and P. A. Marsden. 2004. Role of the 3'-untranslated region of human endothelin-1 in vascular endothelial cells. Contribution to transcript lability and the cellular heat shock response. J. Biol. Chem. 279:8655-8667.
41. Meijlink, F., T. Curran, A. D. Miller, and I. M. Verma. 1985. Removal of a 67-base-pair sequence in the noncoding region of protooncogene fos converts it to a transforming gene. Proc. Natl. Acad. Sci. USA 82:4987-4991.
42. Miyazawa, K., A. Mori, H. Miyata, M. Akahane, Y. Ajisawa, and H. Okudair
