This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Yee, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Yee, A. S.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, November 2006, p. 8252-8266, Vol. 26, No. 22
0270-7306/06/$08.00+0     doi:10.1128/MCB.00604-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

The HBP1 Transcriptional Repressor Participates in RAS-Induced Premature Senescence{triangledown},{dagger}

Xiaowei Zhang,1 Jiyoung Kim,1,3 Robin Ruthazer,4 Michael A. McDevitt,5 David E. Wazer,2 K. Eric Paulson,1,2 and Amy S. Yee1*

Dept. of Biochemistry, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 02111,1 Dept. of Radiation Oncology, Tufts-New England Medical Center, 750 Washington St., Boston, Massachusetts 02111,2 School of Nutrition Science and Policy, Tufts University,Boston, Massachusetts,3 Institute for Clinical Research and Health Policy Studies, Tufts-New England Medical Center, 750 Washington St., Boston, Massachusetts 02111,4 Dept. of Medicine, Division of Hematology, Johns Hopkins University School of Medicine, 720 Rutland Ave, Ross Research Building, Room 1025, Baltimore, Maryland 212055

Received 7 April 2006/ Returned for modification 5 May 2006/ Accepted 17 August 2006


arrow
ABSTRACT
 
Oncogene-mediated premature senescence has emerged as a potential tumor-suppressive mechanism in early cancer transitions. Previous work shows that RAS and p38 MAPK participate in premature senescence, but transcriptional effectors have not been identified. Here, we demonstrate that the HBP1 transcriptional repressor participates in RAS- and p38 MAPK-induced premature senescence. In cell lines, we had previously isolated HBP1 as a retinoblastoma (RB) target but have determined that it functions as a proliferation regulator by inhibiting oncogenic pathways as a transcriptional repressor. In primary cells, the results indicate that HBP1 is a necessary component of premature senescence by RAS and p38 MAPK. Similarly, a knockdown of WIP1 (a p38 MAPK phosphatase) induced premature senescence that also required HBP1. Furthermore, HBP1 requires regulation by RB, in which few transcriptional regulators for premature senescence have been shown. Together, the data suggest a model in which RAS and p38 MAPK signaling engage HBP1 and RB to trigger premature senescence. As an initial step toward clinical relevance, a bioinformatics approach shows that the relative expression levels of HBP1 and WIP1 correlated with decreased relapse-free survival in breast cancer patients. Together, these studies highlight p38 MAPK, HBP1, and RB as important components for a premature-senescence pathway with possible clinical relevance to breast cancer.


arrow
INTRODUCTION
 
Senescence is a state of permanent growth arrest in which cells are refractory to mitogenic stimuli. Primary mammalian cells have finite proliferative potential. Normal cells undergo a limited number of population doublings (PD) before entering the natural process of replicative senescence, which is a consequence of telomere shortening due to repeated cell divisions. Premature senescence can be triggered by many stimuli, including oncogene imbalance, and has attracted considerable attention due to the latter. Several recent studies have shown that premature senescence occurred in early tumorigenic transitions, where oncogene imbalance is frequent. While an established phenomenon in cell culture, senescent cells have now been detected in premalignant stages in animal models and in human clinical specimens. The consistent observation is that no senescence was detected upon full malignant transformation. These studies suggest that senescence may be a stopgap mechanism in early cancer transitions that is abrogated in the transition to full malignancy (8, 15, 33; reviewed in references 13 and 20). The tumor suppressors retinoblastoma (RB) and p53 are central factors in both replicative and premature-senescence mechanisms. While oncogene imbalance signaling through p53 is relatively well defined, there is less knowledge of how RB functions in senescence, with the exception of the role of p16 cyclin-dependent kinase inhibitor (CDKI). The situation for RB in senescence contrasts with the wide knowledge of the roles of RB and E2Fs in proliferation control (16, 19). Similarly, the signaling pathways that lead into p53 and RB during senescence require further elaboration. Ultimately, an understanding of the players and mechanisms in oncogene-induced premature senescence will greatly help to identify targets for the design of therapeutic agents for the exploitation of these mechanisms in blocking tumorigenic progression.

In contrast to its well-known mitogenic activity in immortal cells, the expression of oncogenic RAS in normal primary cells induces premature senescence (see, e.g., reference 43). While RAF and extracellular signal-regulated kinase (ERK) signaling are necessary in both immortal and senescent cells, the p38 mitogen-activated protein kinase (MAPK) pathway is unique to RAS-induced senescence (22, 25, 51). While the p38 MAPK pathway is usually linked to apoptosis, several recent papers have highlighted p38 MAPK signaling in growth arrest and in premature senescence (11, 27, 53, 55). For RAS-induced senescence, MAPK kinase 6 (MKK6)/MKK3 and p38 MAPK are necessary components (51). MKK3 and MKK6 are the direct upstream kinases that activate p38 MAPK by phosphorylation (39). In addition, WIP1 is a phosphatase for p38 MAPK and also has a role in tumorigenicity (5). Previous studies have shown that WIP1 is amplified in breast tumors (31). In mouse models, abrogation of WIP1 prevents RAS- or erb2-mediated tumorigenesis, which could be restored by blocking p38 MAPK activity (10, 12). The role of WIP1 directly in senescence or in primary human cell has not been addressed. Together, the published data indicate that an active p38 MAPK pathway may be central to RAS-mediated senescence and to tumor suppression.

The downstream target(s) of the p38 MAPK pathway in premature senescence has not been identified. In this paper, we investigated whether HBP1 was a relevant downstream target in a RAS- and p38 MAPK-mediated senescence pathway. By work in our laboratory and several others, HBP1 was first identified as a target of the RB and p130 family members and was characterized as a transcriptional repressor and cell cycle inhibitor in cells and animals (29, 30, 44, 45, 47, 49, 54, 56, 57, 61). Other studies have highlighted HBP1 as a negative regulator of the Wnt and epidermal growth factor receptor (EGFR) pathways, which are both associated with poor prognosis in breast and other cancers (4, 41). In addition, recently completed work demonstrates that HBP1 mutations are associated with human breast cancer and further highlights the importance of understanding the signaling contexts for HBP1 (38). For the relationship to p38 MAPK, HBP1 was reisolated as an interactor with p38 MAPK. Consistently, HBP1 also contained p38 MAPK docking and phosphorylation sites. The inhibition of p38 MAPK activity triggered HBP1 instability and subsequently enhanced cell cycle progression. Together with another study, these data suggest that G1 progression (of immortal cells) can be controlled by p38 MAPK through regulation of the stabilities of HBP1, p21CDKI protein, and other proteins (53, 55).

In this work, we investigated the role of HBP1 in a premature senescence pathway. We find that HBP1 was necessary for premature senescence by RAS-p38 MAPK and that RB regulation was essential. To expand the role of the p38 MAPK signaling in premature senescence, we demonstrate that expression levels of p38 MAPK phosphatase WIP1 have a role in regulating senescence. HBP1 was also necessary for WIP1 knockdown (KD)-dependent premature senescence. HBP1 itself also induced premature senescence that required RB. Together, our results support a model in which HBP1 is a downstream effector of RAS, p38 MAPK, and RB and provide new insights into the signaling mechanisms that lead to premature senescence. The implications of a RAS/p38 MAPK/HBP1/RB network in premature senescence and in early human cancer transitions will be discussed.


arrow
MATERIALS AND METHODS
 
Cell proliferation. WI-38 human lung fibroblasts were purchased from the American Type Culture Collection at 10 PD (PD10) and cultured in Dulbecco's modified Eagle medium (Gibco) supplemented with 10% fetal bovine serum (HyClone, Utah), 1 mM nonessential amino acids (Gibco), 10 mM sodium pyruvate (Cambrex), 20 mM glutamine (Gibco), and 1% penicillin G-streptomycin sulfate (Sigma). Phoenix packaging cells were cultured under the same condition.

For growth curves, cells were plated at 1 x 104 per well in six-well plates. Every 3 days, cells were trypsinized from plates and cell numbers were counted. At each split, 104 cells were reseeded to each well in fresh plates and allowed to grow until the next split. PD levels were calculated with the formula PD = log (n2/n1)/log 2, where n1 is the number of cells seeded and n2 is the number of cells recovered. The day when drug selection was completed (day 14 after infection) was defined as day 0.

For BrdU incorporation in situ, cells were grown on coverslips and synchronized in 0.2% fetal bovine serum-Dulbecco's modified Eagle's medium for 24 h. The subconfluent cultures were incubated for 2 h in the presence of 10 µg BrdU and fixed, and nuclei incorporating BrdU were visualized by immunostaining using a commercially available kit (BrdU labeling and detection kit I, catalog no. 1296736; Roche). For visualization of all nuclei in a field, the coverslips were stained with Hoechst dye (final concentration of 25 µg/ml in phosphate-buffered saline [PBS]) for 1 min at 37°C. All coverslips were examined using fluorescence microscopy with the appropriate filters. At least 300 cells were counted in randomly chosen fields from each culture well.

Retroviral gene expression. pBabePuro-HBP1 and pBabePuro-delEX7 were constructed by cloning the respective human HBP1 fragment into pBabePuro(EcoRI). pBabePuro-pmHMG (with triple-point mutations in the high-mobility group [HMG] DNA binding domain of HBP1) was generated by overlapping PCR based on pBabePuro-HBP1. Point mutations were introduced at positions 434, 435, and 437, changing lysine-434 to glutamic acid (AAA to GAA), arginine-435 to glutamic acid (AGA to GAA), and methionine-437 to threonine (ATG to ACG). pBabePuro-pmLXC, pBabePuro-pmIXC, and pBabePuro-pmL/IXC were generated by overlapping PCR based on pBabePuro-HBP1. For pBabePuro-pmLXC, Cys-37 of the human HBP1 LXCXE motif was converted to Gly (TGT to GGT). For pBabePuro-pmIXC, Cys-325 of the human HBP1 IXCXE motif was converted to Gly (TGT to GGT). For pBabePuro-pmL/IXC, both Cys-37 and Cys-325 of the LXCXE and IXCXE motifs, respectively, were converted to Gly (TGT to GGT). pBabeHygro-MKK3A was constructed by inserting human MKK3(Ala) cDNA into pBabeHygro, and pBabeHygro-MKK6E was constructed by inserting the human MKK6(Glu) cDNA into pBabeHygro vector. pBabeBleo-RASV12 was a gift from Larry Feig. pSVE-RB was a gift from Phil Hinds.

Knockdown plasmids. pSM2-Wip1miRNA (catalog no. RHS1764-97181967) and pSM2-p130miRNA (catalog no. RHS1764-9099586) knockdown plasmids were purchased from OpenBiosystems. The following short hairpin RNA (shRNA) plasmids were constructed in the pSuper-retro background (Oligoengine): HBP1 knockdown #213 (GATCCCCACTGTGAGTGCCACTTCTCTTCAAGAGAGAGAAGTGGCACTCACAGTTTTTTGGAAA), targeting 19 residues from nucleotide 942 for human; HBP1 knockdown #022 (GATCCCCCACATGGAGCTTGATGACCTTCAAGAGAGGTCATCAAGCTCCATGTGTTTTTGGAAA), targeting 19 residues from nucleotide 343 for human; and RB knockdown (GATCCCCATGGAAGATGATCTGGTGATTCAAGAGATCACCAGATCATCTTCCATTTTTTGGAAA). Underlined sequences represent the hairpins. The HBP1 #213 construct was used for most experiments, but some results were verified with the HBP1 #022 construct.

Retroviral gene transduction was carried out as previously described, using Phoenix packaging cells. Cells were infected with retroviruses and then selected in 0.7 µg/ml puromycin, 100 µg/ml hygromycin B, 200 µg/ml zeocin, starting 1 day after infection. We typically achieved stable cell lines after 14 days of selection. Treatments with SB203580 (10 µM) or vehicle control usually started after 14 days of selection.

Immunoblots and antibodies. Cells at 70 to 80% confluence were lysed in radioimmunoprecipitation assaybuffer (phosphate-buffered saline containing 1% Triton X-100, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM Na3VO4, and complete protease inhibitor cocktail [Roche]). After the lysates were cleared by centrifugation, protein concentrations were determined by Bradford assays. Twenty to 50 µg of proteins was separated on a sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis gel and transferred to Trans-Blot nitrocellulose membranes (Bio-Rad). The primary antibodies used were for HBP1 (N-20X; Santa Cruz), p53 (FL-393; Santa Cruz), p16 (C-20; Santa Cruz), p38 (A-12; Santa Cruz), phospho-p38 (#9211; Cell Signaling), RB (#554136; BD Pharmingen), and p130 (sc-317; Santa Cruz). For the detection of transfected HBP1 and its mutants, the HA.11 antibody (Covance) was used at a 1:1,000 dilution.

SA-ß-Gal staining. Cells were washed twice in PBS, fixed for 3 to 5 min at room temperature in 3% formaldehyde, and washed with PBS again. Then, cells were incubated overnight at 37°C with freshly prepared senescence-associated (SA)-ß-galactosidase (ß-Gal) stain solution (1 mg/ml X-Gal [5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside], 40 mM citric acid-sodium phosphate, pH 6.0, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl2). At least 300 cells were counted in randomly chosen fields (21).

RT-PCR. RNA was isolated by using TRIzol reagent (Gibco-BRL). One microgram of RNA was analyzed by reverse transcription (RT)-PCR with an Access RT-PCR kit (Promega). The DNA sequences of the human HBP1 primers were 5'-ATCATCTCCTGTACACATCATAGC-3'and 5'-CATAGAAAGGGTGGTCCAGCTTAC-3'; these primers resulted in an RT-PCR product of 523 bp. The DNA sequences of the human Wip1 primers were 5'-GAACAAGTCTGGGGTGAATC-3' and 5'-ATAGGAAGGGCTGTCAGTCA-3'; these primers resulted in an RT-PCR product of 527 bp. To normalize the RT-PCR results, 18S primers and associated competimers (Ambion) were used at a 1:10 ratio. This protocol provided a linear signal for normalization of experimental results. The annealing temperature was 55°C. All products were analyzed by agarose gel electrophoresis and visualized by computerized gel documentation (Bio-Rad) (24).

Telomere length assay. Ten micrograms of genomic DNA per sample was digested by restriction enzymes HinfI and RsaI, electrophoresed on a 1% agarose gel, and transferred to nylon membrane by Southern blotting. The membrane was baked at 120°C for 20 min. The blotted DNA fragments are hybridized to a digoxigenin-labeled probe specific for telomeric repeats and incubated with a digoxigenin-specific antibody covalently coupled to alkaline phosphate. Finally, the immobilized telomere probe was visualized by virtue of alkaline phosphatase metabolizing CDP-Star, a sensitive chemiluminescent substrate. The average telomere restriction fragment (TRF) length can be determined by comparing the signals relative to a molecular weight standard, as described in the protocol. A TeloTAGGG telomere length assay kit (catalog no. 2209136; Roche) was used, but this method was similar to published methods (see, e.g., references 28 and 58).

Protein t1/2 measurements. We modified published conditions for half-life (t1/2) measurements by using a cycloheximide block (3). WI-38 cells were treated with 0.5 µg/ml cycloheximide and harvested in radioimmunoprecipitation assay lysis buffer at the time points indicated in Fig. 7. Protein levels were then examined by Western blotting for HBP1 as described above. The HBP1 protein was quantitated by densitometric analysis.


Figure 7
View larger version (45K):
[in this window]
[in a new window]
 
FIG. 7. HBP1 protein stability and levels increase, but do not contribute to, replicative senescence. (A) HBP1 protein and active p38 MAPK increase during replicative senescence. Western blots of WI-38 cells at different PD levels, with expression levels of endogenous HBP1 or p38 MAPK protein used as a control, are shown (top panel). Levels of active p38 MAPK (by anti-phospho p38 blot) at PD levels of 20 and 40 are shown (bottom panel). The level of p38 MAPK protein is used as a loading control. (B) HBP1 protein stability increases with replicative senescence. Levels of HBP1 were determined by Western blot analysis of WI-38 cells at PD20 or PD40, and the cells were treated with cycloheximide to block protein synthesis (top panel). {alpha}-Tubulin was used as the loading control for this turnover experiment. The slope of the decay line was calculated by standard linear regression and indicates the half-life (bottom right panel). (C) Knockdown of HBP1 in WI-38 cells. Upper panel, RT-PCR analysis of WI-38 cells infected at PD15 with pSuper.retro (vector control) or pSuper-HBP1.shRNA (HBP1shRNA). The level of HBP1 mRNA was determined 14 days after infection. 18S RNA is included as an internal control. Lower panel, Western blot analysis of WI-38 cells infected at PD15 with pSuper.retro (vector control) or pSuper-HBP1.shRNA (HBP1shRNA). Levels of endogenous HBP1 (HBP1 antibody) were determined 14 days after infection. p38 MAPK was used as an internal control. (D) HBP1 expression increases population doubling time, but HBP1 knockdown has no effect. WI-38 cells were infected at PD15 with control vectors (pSuper.retro or pBABE), HBP1shRNA, or HBP1 and PD measured in a time course experiment. Day 0 on the graph represents the 14th day postinfection. Values are means ± standard deviations for three independent experiments. (E) HBP1 knockdown does not affect replicative senescence. WI-38 cells at PD15 were infected with pSuper.retro or pHBP1shRNA, and the percentages of cells positive for SA-ß-Gal were determined at PD28 and PD42. Values are means ± standard deviations for three independent experiments. At least 300 cells were counted for each sample. (F) HBP1 knockdown shows normal telomere shortening in replicative senescence. WI-38 cells were infected at PD15 with retrovirus expressing HBP1shRNA or a vector control (pSuper.retro) and allowed to senesce. TRF lengths in kb were measured at different PD levels. Mean TRF sizes at different PD levels are shown in the table below. (G) HBP1 knockdown does not affect phospho-p38 expression. Levels of phospho-p38 and HBP1 were determined by Western blot analysis of WI-38 cells transfected with pSuper.retro and pHBP1shRNA at different PD levels.

Statistical analysis. For the clinical correlations regarding relapse, both the Oncomine and the GEO databases (NCBI) were used to compile a data file with Oncomine-normalized reduced HBP1 for each patient. Kaplan-Meier curves for relapse-free survival were created for each tertile of normalized HBP1 expression levels and statistically compared between tertiles by using the log rank test. Statmate and Instat (Graphpad) and the SAS System for Windows, V9.1.3 (Sas Institute, Cary, NC), were used for data analysis throughout this paper. An alpha level of 0.05 was used to determine statistical significance when interpreting results.


arrow
RESULTS
 
HBP1 and RAS-induced premature senescence. A first objective was to test whether HBP1 was necessary for premature senescence triggered by RAS and signaling, based on initial observations described here. RAS expression triggered the expected senescence, as demonstrated by three established senescence criteria: (i) p53 expression, (ii) p16 expression, and (iii) SA-ß-Gal staining (Fig. 1A, compare lanes 1 and 4; also Fig. 1B, bottom right panels). Numerous studies have highlighted that the increases in the p53 and p16 protein levels indicate engagement of the p53- and RB-mediated pathways in both replicative and premature senescence, respectively (reviewed in references 13 and 20). SA-ß-Gal staining (at pH 6.2) is a consistent senescence marker (21). These three criteria provide a good representation of senescence. Furthermore, we observed that HBP1 levels increased with RAS-induced senescence, consistent with a potential role for HBP1 in premature senescence. Therefore, we used retroviral shRNA strategies to knock down the HBP1 protein and to assess the consequences in RAS-induced premature senescence. As shown in Fig. 1A, there was a stable knockdown of HBP1 at the protein level which was also observed at the mRNA level (data not shown). In the presence of RAS, there was no evidence of premature senescence in the HBP1 knockdown cells (compare Fig. 1A, lanes 2 and 3, and Fig. 1B, top panels), with little to no expression of senescence markers (SA-ß-Gal, p53, and p16) in the HBP1 knockdown cells (Fig. 1A and B). As shown in Fig. 1A and consistent with previous reports, RAS expression activated p38 MAPK, as shown by increased phospho-p38 MAPK (relative to total p38 MAPK). Thus, the RAS-to-p38-MAPK signaling was intact, but full senescence was disrupted by HBP1 knockdown. Together, these data indicate that HBP1 may be required for RAS-induced premature senescence.


Figure 1
View larger version (56K):
[in this window]
[in a new window]
 
FIG. 1. HBP1 is required for RAS-induced premature senescence. (A) HBP1 knockdown prevents Ras-induced senescence markers. Levels of Ras, phospho-p38 (p-p38), HBP1, p53, p16, and p38 were determined by Western blot analysis of WI-38 cells at PD15 infected with pSuper.retro or pHBP1shRNA, with or without RAS transfection (pSuper.retro+Ras or HBP1shRNA+Ras, respectively), at day 14 after infection. (B) HBP1 knockdown prevents Ras-induced SA-ß-Gal expression. WI-38 cells (PD15) were infected with pSuper.retro or pHBP1shRNA, with or without RAS transfection (pSuper.retro+Ras or HBP1shRNA+Ras, respectively). Cells were then stained for SA-ß-Gal at day 14 after infection. The pSuper.retro and HBP1shRNA+Ras panels have sporadic SA-ß-Gal staining cells at these early passages. Significant SA-ß-Gal staining is apparent only in the pSuper.retro+Ras panel.

HBP1 and p38 MAPK-induced premature senescence. It has previously been shown that p38 MAPK activation is necessary for RAS-induced senescence and that p38 MAPK activation is sufficient to induce senescence (18, 51). Therefore, we asked whether HBP1 was also required for p38 MAPK-induced senescence. MKK3 and MKK6 represent redundant kinases that can activate p38 MAPK signaling (9, 39). MKK3A and MKK6E are frequently used as dominant-negative and dominant-positive forms, respectively. MKK6E is constitutively active for p38 MAPK activation due to glutamate substitutions at Ser207 and Thr211. MKK3A is dominant negative for p38 MAPK activation by alanine substitutions at Ser189 and Thr193. We expressed either MKK6E or MKK3A in low-passage WI-38 cells (PD15) and assessed the consequences for senescence. Consistent with previous work with immortalized cells, the constitutively active MKK6E activated p38 MAPK and triggered senescence, as shown by the expression of senescence-associated proteins p53 and p16, accompanied by increased HBP1 protein levels, consistent with our previous work (Fig. 2A) (47). In contrast, the dominant-negative MKK3A inhibited p38 MAPK, with an accompanying decrease in HBP1 levels, again consistent with our previous work (53). With MKK3A expression, there was no induction of senescence (Fig. 2B) and no accumulation of p53 or p16 (Fig. 2A). Similarly, the percentage of SA-ß-Gal staining in constitutively active MKK6E-expressing cells was fourfold higher than that in control cells or in MKK3A-expressing cells (Fig. 2B). We next asked whether HBP1 was required for p38 MAPK-induced premature senescence. In the presence of an HBP1 knockdown, premature senescence imposed by constitutively active MKK6E expression was abolished, as shown by loss of p53 and p16 induction (Fig. 2A, lanes 2 to 5) and of SA-ß-Gal expression (Fig. 2B). In sum, HBP1 appears functionally important for premature senescence induced by RAS and p38 MAPK activation.


Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. HBP1 is required for p38 MAPK-induced premature senescence. (A) HBP1 knockdown prevents activated p38 MAPK-induced senescence markers. Levels of phospho-p38 (p-p38), HBP1, p53, p16, p38, and FLAG-MKK3 or FLAG-MKK6 were determined by Western blot analysis as listed to the right of the figure. WI-38 cells at PD18 were infected with pSuper.retro or pHBP1shRNA and then transfected with or without constitutively active MKK6 (MKK6E) or dominant-negative MKK3 (MKK3A) as defined in the table above the Western blots. MKK6E increased p38 MAPK phosphorylation and induced HBP1, p53, and p16 protein in control (pSuper.retro) cells but failed to induce HBP1, p53, and p16 protein in HBP1 knockdown (HBP1shRNA) cells. MKK3A decreased p38 MAPK phosphorylation and prevented induction of HBP1, p53, and p16 protein in all cells. (B) HBP1 knockdown prevents activated p38 MAPK-induced SA-ß-Gal expression. The percentages of cells positive for SA-ß-Gal in WI-38 cells infected with pSuper.retro or pHBP1shRNA in the presence of constitutively active MKK6E or dominant-negative MKK3A were measured. Values are means ± standard deviations for triplicates. At least 300 cells were counted for each sample. MKK6E increased SA-ß-Gal expression in control (pSuper.retro) cells but failed to induce SA-ß-Gal in HBP1 knockdown (HBP1shRNA) cells. MKK3A prevented induction of SA-ß-Gal in all cells.

To provide a complementary test for p38 MAPK in senescence, we next asked whether WIP1 contributes to senescence. While WIP1 has been isolated in different contexts, its role as a p38 MAPK phosphatase likely contributes to tumorigenicity (10, 12, 23, 31, 35). In this section, we tested whether decreased WIP1 might trigger senescence, as a role for WIP1 in cellular senescence has not been directly addressed. As shown in Fig. 3A, the retroviral expression of a specific interfering micro-RNA was used to knock down WIP1. Recent studies have highlighted that micro-RNA-based RNA interference can be more effective than previous platforms (see, e.g., reference 46). As shown in Fig. 3B, there was an increase in phospho-p38 MAPK and in HBP1 protein levels upon WIP1 knockdown, again consistent with the role of WIP1 as a p38 MAPK phosphatase. There was also an increase in senescent cells, as evidenced by increased SA-ß-Gal staining (Fig. 3C), p53 expression, and p16 expression (Fig. 3B).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3. Wip1 knockdown induces premature senescence through the p38 MAPK-HBP1 pathway. (A) Wip1 knockdown cells. Wip1 mRNA levels were measured by RT-PCR with WI-38 cells (PD18) infected with Wip1miRNA or pSM2 (control). (B) Wip1 knockdown activates p38 MAPK and induces senescence protein markers. Levels of phospho-p38 (p-p38), HBP1, p53, p16, and p38 were determined by Western blot analysis of WI-38 cells at PD18 infected with Wip1miRNA or pSM2 vector (control). (C) Wip1 knockdown induces SA-ß-Gal expression. WI-38 cells at PD18 were infected with Wip1miRNA or pSM2 (control) and then stained for SA-ß-Gal 14 days after infection. (D) Wip1-HBP1 double-knockdown cells. Wip1 and HBP1 mRNA levels were measured by RT-PCR with WI-38 cells (PD18) coinfected with Wip1miRNA and HBP1shRNA or pSM2 (control). (E) Wip1-HBP1 double knockdown activates p38 MAPK but prevents induction of senescence markers. Levels of phospho-p38 (p-p38), HBP1, p53, p16, and p38 were determined by Western blot analysis of WI-38 cells at PD18 coinfected with Wip1miRNA or pSM2 vector (control).

To compare the senescences induced by WIP1 knockdown, Ras, and MKK6E expression, we asked whether HBP1 was also required. Thus, a double WIP1 and HBP1 knockdown was created in the human WI38 cells (Fig. 3D). As with senescence induced by RAS or MKK6E, HBP1 was also necessary for senescence upon WIP1 knockdown (Fig. 3E). A second HBP1 KD construct verified that HBP1 was required for WIP1 KD-induced senescence. Both constructs had near-identical levels of HBP1, although different regions of the HBP1 mRNA were targeted (data not shown; see Materials and Methods for details). This result is consistent with Fig. 1 to 3 and highlights that WIP1 can regulate senescence, albeit in a negative manner. Thus, reducing WIP1 expression increases p38 MAPK activity, increases HBP1 protein, and triggers senescence. As discussed below, the WIP1 result also provides additional evidence for the role of p38 MAPK signaling in senescence and in later tumor suppression. Finally, these experiments provide another independent way to test of the role of HBP1 in p38 MAPK-induced premature senescence.

RB binding and function are required for premature senescence induced by HBP1. Because HBP1 appeared to have a role in RAS- and p38 MAPK-induced premature senescence, we investigated whether HBP1 expression itself might trigger premature senescence. Stable cell lines expressing wild-type HBP1 and selected mutants were established by retroviral expression in WI-38 cells. The expression of HBP1 in these cell lines was evaluated by both RT-PCR (data not shown) and Western blot analysis (Fig. 4B). The expression of hemagglutinin (HA)-HBP1 was detected by anti-HA antibody. As shown in Fig. 4C, the expression of wild-type HBP1 induced a senescence-like morphology as determined by SA-ß-Gal staining. This was confirmed by analysis of p53 and p16 expression (Fig. 4B). More than 70% of wild-type, HBP1-expressing cells had accumulated SA-ß-Gal staining at low passage, which is the expected result for premature senescence.


Figure 4
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 4. Expression of human HBP1 induces premature senescence, for which RB interaction is required. (A) Diagram of HBP1 and RB interaction motif mutants. HBP1 functional domains are defined as follows: diagonal stripes, repression domain; vertical stripes, p38 MAPK interaction; black, HMG box DNA binding domain; white, LXCXE or IXCXE RB-interacting motif. Amino acids 1, 200, 431, and 513 are located as markers. Single mutation of the LXCXE site is designated with an X and the protein labeled pmLXC. Single mutation of the IXCXE site is designated with an X and the protein labeled pmIXC. Double mutation of the LXCXE and IXCXE sites is designated with two Xs and the protein labeled pmL/IXC. (B) HBP1 pmL/IXC fails to induce senescence. Levels of exogenous HBP1, pmLXC, pmIXC, and pmL/IXC (using anti-HA antibody) were determined by Western blot analysis 14 days after infection of WI-38 cells at PD18 with retrovirus expressing HBP1, pmLXC, pmIXC, pmL/IXC, or a vector control (pBabe). Levels of p53, p16, and p38 MAPK (control) were determined by Western blot analysis. (C) An HBP1 mutant that cannot bind RB (pmL/IXC) fails to induce premature senescence. WI-38 cells (PD18) infected with pBabe, pHBP1, pmLXC, pmIXC, or pmL/IXC were stained for SA-ß-Gal at day 14 after infection. The percentages of cells that were positive for SA-ß-Gal are plotted in the graph. Values are means ± standard deviations for three independent experiments. At least 300 cells were counted for each sample.

The next step was to use HBP1 mutants both to assess specificity and to delineate possible functional domains (Fig. 4A). In defining the required functional domains, we found that RB regulation of HBP1 was an essential feature. While HBP1 was initially isolated in an RB family screen (49), the results here uncover a previously unappreciated role for HBP1 as a possible RB effector in premature senescence. While p16 is associated with RB in senescence, few transcriptional effectors with relevant molecular properties have been identified (see Discussion). RB binding is necessary for the induction of senescence by HBP1. An HBP1 mutant that contains point mutations in both RB binding motifs (pmL/IXCE) was defective for inducing premature senescence, as shown by the lack of p53 and p16 induction (Fig. 4B) and SA-ß-Gal staining (Fig. 4C). In contrast, single mutations of either RB binding motif (Fig. 4A, pmIXCXE or pmLXCXE) (49) could still induce premature senescence. Previous studies showed that pmL/IXCXE for HBP1 was abrogated in RB binding but that both of the single RB motif mutants in HBP1 retained some RB binding (43).

We next asked whether RB was required for the induction of premature senescence by HBP1 (Fig. 5). Two complementary experiments were performed. The RB-negative SAOS-2 cell line has been used as a model for RB-dependent premature senescence (2). As shown in Fig. 5A, expression of HBP1 did not elicit premature senescence in this cell line, suggesting that a functional RB is required. As expected, reexpression of RB induced premature senescence in SAOS-2 cells (2). In a second approach, we knocked down either RB or p130 in the WI-38 cells and then assessed the consequences on premature senescence by HBP1. As shown in Fig. 5B, an RB knockdown, but not a p130 knockdown, abrogated premature senescence in response to HBP1 expression. Because HBP1 binds both p130 and RB, these data indicate that the RB-HBP1 interaction is necessary for premature senescence. Together, these experiments demonstrate that HBP1 requires full RB binding to trigger premature senescence. Because RB is a major player in senescence (reviewed in references 13 and 20), these experiments highlight that HBP1 is a plausible effector of RB in premature senescence.


Figure 5
View larger version (68K):
[in this window]
[in a new window]
 
FIG. 5. Expression of HBP1 induces premature senescence that requires a functional RB. (A) HBP1 and RB expression induces SA-ß-Gal, but HBP1 alone without RB fails to induce SA-ß-Gal in SAOS-2 cells. Left panel, levels of exogenous RB and HBP1 were determined by Western blot analysis 14 days after transfection of SAOS-2 cells with pSVE-Rb, pHBP1, or a vector control (pBabe). Right panel, SAOS-2 cells transfected with pBabe, pHBP1, and pSVE-Rb were stained for SA-ß-Gal at day 14 after transfection. (B) HBP1-induced premature senescence in WI-38 human fibroblasts requires RB but not p130. Upper left panel, levels of exogenous HBP1, endogenous RB, and p130 were determined by Western blot analysis 14 days after infection of WI-38 cells (PD20) with retrovirus expressing HBP1, RBshRNA, p130miRNA, or a vector control (pBabe). Bottom panels, WI-38 cells (PD20) infected with pBabe, pHBP1, RBshRNA, or p130miRNA were stained for SA-ß-Gal at day 14 after infection. Upper right panel, the percentages of cells that were positive for SA-ß-Gal are plotted in the graph. Values are means ± standard deviations for three independent experiments. At least 300 cells were counted for each sample.

The HBP1 DNA binding domain is also required for premature senescence. In addition to the RB binding motifs, we also tested the DNA binding domain of HBP1 with a synthetic and with a natural, breast cancer-associated HBP1 mutant (Fig. 6A). pmHMG carries a triple-point mutation in the HMG box DNA binding domain that abolishes DNA binding. The delEx7 mutant was isolated in our breast cancer study and represented a naturally occurring mutant of HBP1 that was associated with invasive breast cancer (33). The exon-skipping deletion in delEx7 creates a premature termination, resulting in the deletion of the DNA binding domain and much of the repression domain (Fig. 6A). delEx7 was defective in transcriptional, cell cycle, and Wnt signaling functions that are associated with HBP1. Our previous studies have shown that the DNA binding domain is essential for sequence-specific transcriptional repression and for cell cycle inhibition (45), while the repression domain was essential for suppressing Wnt signaling (17, 41, 48). Neither pmHMG nor delEx7 triggered premature senescence (Fig. 6B and D) or functioned in growth suppression, as assessed by BrdU incorporation (Fig. 6C). These results indicate that the HBP1 DNA binding domain was required for both growth suppression and induction of senescence. An intact repression domain without DNA binding, as is present in pmHMG, was also insufficient to trigger senescence (Fig. 6B and C). Notably, each of the tested HBP1 mutants should still retain RB binding (45, 49) but were still defective for inducing premature senescence. Thus, RB binding is necessary, but not sufficient, for HBP1 and the induction of premature senescence.


Figure 6
View larger version (54K):
[in this window]
[in a new window]
 
FIG. 6. Exogenous human HBP1 induces premature senescence, for which the HBP1 DNA binding domain is required. (A) Diagram of HBP1 and HBP1 C-terminal mutants. HBP1 functional domains are defined as follows: diagonal stripes, repression domain; vertical stripes, p38 MAPK interaction; black, HMG box DNA binding domain; white, LXCXE or IXCXE RB-interacting motif. Amino acids 1, 200, 431, and 513 are located as markers. Triple mutation of the HMG box DNA binding domain is designated with XXX and the protein labeled pmHMG. An HBP1 mutant, derived from a breast cancer patient with a deletion of exon 7, expresses only the N-terminal 263 amino acids and is labeled delEx7. (B) HBP1 expression induces senescence protein markers, but HBP1 mutants fail to induce senescence. Levels of exogenous HBP1, pmHMG, and delEx7 (using anti-HA antibody) were determined by Western blot analysis 14 days after infection of WI-38 cells at PD18 with retrovirus expressing HBP1, pmHMG, delEx7, or a vector control (pBabe). Levels of p53, p16, and p38 MAPK (control) were determined by Western blot analysis. (C) HBP1 mutants fail to inhibit S phase. WI-38 cells (PD18) infected with pBabe, pHBP1, pmHMG, delEx7, or pmL/IXC were labeled with BrdU, and BrdU-positive nuclei were stained at day 14 after infection. The percentages of cell nuclei positive for BrdU are plotted in the graph. Values are means ± standard deviations for three independent experiments. At least 300 cells were counted for each sample. (D) HBP1 mutants fail to induce SA-ß-Gal. WI-38 cells (PD18) infected with pBabe, pHBP1, pmHMG, or delEx7 were stained for SA-ß-Gal at day 14 after infection. The percentages of cells that are positive for SA-ß-Gal are plotted in the graph. Values are means ± standard deviations for three independent experiments. At least 300 cells were counted for each sample. (E) Telomere shortening during replicative senescence. WI-38 cells were allowed to senesce normally (PD42), and TRF lengths in kilobases (kb) were measured at different PD levels. Molecular weight markers to the left show the change in the range of TRF sizes. Mean TRF sizes at different PD levels are shown in the table below. Senescence was achieved at PD42, with a resulting TRF of 5.5 kb. (F) HBP1-imposed senescence does not induce telomere shortening, while HBP1 mutants show normal telomere shortening. WI-38 cells were infected at PD18 with retrovirus expressing HBP1, pmHMG, delEx7, or a vector control (pBabe) and allowed to senesce. TRF lengths in kb were measured at different PD levels. Molecular weight markers to the left show the change in the range of TRF sizes. Mean TRF sizes at different PD levels are shown in the table below. HBP1-induced senescence was achieved at PD35, with a resulting TRF of 6.3 kb.

HBP1 does not regulate replicative senescence. We tested whether the observed senescence by HBP1 expression was truly premature, as shown in previous RAS and p38 MAPK studies (22, 25, 51). If HBP1 is a relevant downstream target, then it should also activate premature, not replicative, senescence. The single distinguishing feature between replicative and premature senescence is telomere length. Premature senescence is characterized by constant telomere length, but replicative senescence is triggered by shortened telomeres in primary cells (26, 27, 28). We measured telomere length in the wild-type- and mutant HBP1-expressing fibroblasts. As a control, normal fibroblasts, which have no telomerase activity, were used. The TRFs are gradually shortened with increasing PD as cells approach senescence (Fig. 6E). Remarkably, the wild-type HBP1-expressing cells became senescent at PD35, with a TRF length of 6.3 kb, which is similar to that of control cells at PD35 that have not undergone senescence (Fig. 6E and F, Babe, 6.1 kb). In normal WI-38 cells, replicative senescence occurs at PD levels of >42, with a TRF of ~5 kb. Thus, HBP1-expressing cells have the hallmarks of premature senescence but not replicative senescence. In contrast, the cell lines expressing the two HBP1 mutants had changes in TRF length that were similar to those for the control cells undergoing replicative senescence. As shown in Fig. 6F, cells expressing HBP1 mutants that were defective in premature senescence exhibited TRF changes and replicative senescence. As the control cells and the two HBP1 mutant-expressing cell types eventually became senescent at PD42, the TRF lengths shortened to 5.0, 5.3, and 5.0 kb, respectively. Note that the wild-type HBP1-expressing cells failed to reach PD42, which is another indication of premature senescence (Fig. 6F). These results indicate that wild-type HBP1-expressing cells exhibited the hallmarks of premature senescence that are independent of changes in telomere length.

While HBP1 may have a role in premature senescence induced by RAS or p38 MAPK, HBP1 unexpectedly had little contribution to normal replicative senescence in primary cells. Our approach was to examine the expression levels of HBP1 as a function of population doubling and test its functionality for replicative senescence. While HBP1 was expressed in both young and senescent cells, the level of HBP1 protein apparently increased with advancing PD during replicative senescence. In addition, there was a detectable increase in protein stability that was coincident with p38 MAPK activation (Fig. 7A and B). The differences in half-life at PD40 (t1/2 = 74 min) and PD20 (t1/2 = 23 min) reflect an ~3-fold difference in HBP1 protein stability. There was also a definable increase in active p38MAP activity as the cells reached PD40 (Fig. 7A). These HBP1 protein half-life differences are remarkably similar to those observed in our previous work, which showed that p38 MAPK activity stabilizes the HBP1 protein (53). These previous experiments represent necessary characterization, but a functional test for the role of HBP1 was still required.

Regardless of the increases in HBP1 protein stability and level, HBP1 nonetheless appeared to have little, if any, contribution to replicative senescence. The growth rate of HBP1 knockdown cells was similar to that of the control cells (infected with the vector control pSuper.retro) (Fig. 7C and D). The percentages of SA-ß-Gal-stained cells in the HBP1 knockdown and in control lines at high passage are nearly identical (Fig. 7E). Telomere lengths were also similar in the control and HBP1 KD lines (Fig. 7F). Finally, p38 MAPK activation and HBP1 levels (Fig. 7G) were increased in control cells. p38 MAPK activation was also increased in the HBP1 KD cells, indicating that the signaling into p38 MAPK was intact in the HBP1 KD. With repeated passage, the cells expressing an HBP1 mutant that does not bind RB (L/IXC) eventually exhibited replicative senescence (data not shown) but did not show any premature senescence in wild-type HBP1-expressing cells (Fig. 6B and C). Similarly, cells expressing pmHMG and delEX7, which did not show premature senescence, eventually underwent replicative senescence (data not shown). Similarly, cells expressing MKK3ala also exhibited normal replicative senescence at PD42 (data not shown). Thus, the data in Fig. 6 and 7 highlight that HBP1 and possibly p38 MAPK signaling have a greater functional role in premature senescence than in replicative senescence. The functional tests were important, as there were increased levels of active p38 MAPK and of HBP1 in both types of senescence. In addition, the specificity of the HBP1 shRNA knockdown for premature senescence but not replicative senescence argues against global off-target effects.

HBP1-induced premature senescence depends upon p38 MAPK activity. Previous work has shown that the inhibition of p38 MAPK activity abolished RAS-induced premature senescence (51). If HBP1 is a functionally relevant target in the RAS/p38 MAPK senescence pathway, the inhibition of p38 MAPK activity should also abrogate HBP1-imposed premature senescence. HBP1-expressing and control cells were cultured with or without SB203580, which specifically inhibits p38 MAPK but not ERK or Jun N-terminal protein kinase (JNK) (29). HBP1 levels were decreased with SB203580 treatment (Fig. 8C). The growth rate of the HBP1-expressing cells was very low compared to those of the two HBP1 mutant-expressing cell types and the control cells in the absence of SB203580 (Fig. 8A). We have made similar observations for other cell types expressing HBP1 (40, 43). The selected HBP1 mutants served as controls, as neither triggered premature senescence. However, in the presence of SB203580, a significant increase in growth rate was observed in HBP1-expressing cells, resulting in a growth rate nearly identical to that of untreated wild-type cells (Fig. 8A). Conversely, SB203580 treatment resulted in a marked decrease in the number of SA-ß-Gal-positive senescent cells of all types. However, in each experiment, overexpression of HBP1 resulted in higher senescence (Fig. 8B). In sum, the inhibition of p38 MAPK activity decreased HBP1-induced premature senescence.


Figure 8
View larger version (43K):
[in this window]
[in a new window]
 
FIG. 8. Inhibition of p38 MAPK activity rescues HBP1-induced premature senescence. (A) p38 MAPK inhibition reverses HBP1-induced increase in population-doubling time. WI-38 cells were infected at PD15 with control vector (pBABE), pmHBP1, or delEx7 and PD measured in a time course experiment. Day 0 on the graph represents the 14th day postinfection. Values are means ± standard deviations for three independent experiments. (B) p38 MAPK inhibition reverses HBP1-induced increase in SA-ß-Gal. Percentages of SA-ß-Gal positive cells infected with pBabe, pHBP1, pmHMG, or delEX7 in the presence of a vehicle control (dimethyl sulfoxide) or SB203580 at day 3 (upper panel) or 6 (lower panel) after treatment are shown. (C) p38 MAPK inhibition reverses HBP1-induced increase in senescence markers. Levels of phospho-p38 MAPK, p38 MAPK (internal control), HBP1, p53, and p16 in WI-38 cells infected with pBabe, pHBP1, pmHMG, or pdelEX7 in the presence of a vehicle control (dimethyl sulfoxide) or 10 µM SB203580 are shown.

WIP1 and HBP1 are clinically relevant genes in breast cancer. The rationale for this section is to determine whether any of the genes in the RAS-mediated pathway could have clinical relevance. Recently, tools and databases have become available for the evaluation of specific gene expression in primary breast tumors for correlation with future relapse, which remains a large clinical problem. We chose breast cancer for the initial investigation because two components (WIP1 and HBP1) have a clinical link to breast cancer and both have functional effects due to variations in gene expression. Our previous study showed that several HBP1 mutations were associated with breast cancers of poor prognosis and that, furthermore, reduced HBP1 expression also had an effect on increased breast cell tumorigenesis and invasiveness (38). WIP1 was initially defined for overexpression in breast cancer (31). Because both genes are linked to breast cancer, we asked whether differential expression levels of WIP1 and HBP1 are correlated with prognosis. The previously mentioned studies suggest that elevated HBP1 expression may predict a potentially better prognosis. The availability of data sets from patients with long-term follow-up allows for the investigation of molecular factors for predicting recurrence without immediate access to a large patient population. We applied survival analysis to existing data from the Oncomine (40) and NCBI Gene Expression Omnibus (GEO) data sets. The Oncomine data set normalizes the GEO data set to allow for comparison across microarray platforms and sorts for differentially expressed genes. We queried for HBP1 and WIP1 in data sets comprising data on 286 primary tumors from patients who received conservative surgery and radiation and then were monitored for up to 14 years (52). Kaplan-Meier survival analysis was subsequently applied to the normalized gene expression data to assess the likelihood of clinical relapse to incurable and often fatal breast cancer. A similar approach was used to assess the relevance of a transcriptional repressor (Snail) to breast cancer recurrence (34). We compared Kaplan-Meier curves to look at the relationship of HBP1 levels or WIP1 levels to time of relapse. As shown in Fig. 9A, underexpressed HBP1 correlated with relapse (log rank test P value, <0.02) (38). Overexpressed HBP1 did not correlate with decreased relapse-free survival (log rank test P value, <0.74) (data not shown). As shown in Fig. 9B, high WIP1 expression correlated with decreased relapse-free survival (log rank test P value, <0.0004). In sum, high WIP1 and/or low HBP1 expression predicts poor outcomes regarding relapse-free survival in breast cancer patients, and both proteins have a clinical association.


Figure 9
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 9. HBP1 underexpression and WIP1 overexpression correlate with breast cancer relapse. Kaplan-Meier analysis was applied to a data set comprising data on 286 breast cancer patients (assembled from Oncomine, NCBI GEO, and the original report) (52). The compiled Excel file is provided in the supplemental material. The gene expression data were derived from the primary tumors of patients who received surgery and radiation and who were then monitored for relapse for up to 14 years. As shown, HBP1 underexpression correlates with decreased relapse-free survival (P < 0.02) (A). Wip1 overexpression correlates with decreased relapse-free survival or recurrence (P < 0.004) (B).


arrow
DISCUSSION
 
Summary and model. The data in this paper support three conclusions that are represented in the model in Fig. 10. First, the data support a role for the HBP1 transcriptional repressor as a downstream effector of RAS and p38 MAPK in a premature-senescence pathway.


Figure 10
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 10. Model for the role of HBP1 in p38 MAPK-mediated senescence. This figure represents a summary and a perspective of the data in this paper. Premature senescence induced by oncogene imbalance is represented by RAS expression in primary cells. From the data in Fig. 1 to 8 and in the literature, activated Ras in primary human cells initiates a premature senescence program that is orchestrated by p38 MAPK pathway activation (MKK6/MKK3 and p38 MAPK) and involves both p53 and RB. Our data indicate that HBP1 is an effector of both p38 MAPK signaling and RB in this premature-senescence pathway. Furthermore, high Wip1 and low HBP1 expression levels were statistically correlated with decreased relapse-free survival in a large database of breast cancer patients (Fig. 9). Thus, the relative expression levels of two components of the premature senescence pathway are correlated with a poor prognosis. In sum, we speculate that overriding a p38 MAPK-mediated premature-senescence pathway reprograms the cell toward a path that leads to malignant tumors, possibly of poor prognosis.

RNA interference experiments indicate that HBP1 has a functional role in premature senescence triggered by either RAS or active p38 MAPK signaling. HBP1 functions are limited to premature senescence, as a knockdown does not prevent replicative senescence. Like RAS and activated MKK6/p38 MAPK, HBP1 itself can also trigger premature senescence. p38 MAPK activity also regulated the ability of HBP1 to induce premature senescence. Second, RB regulation of HBP1 is essential for the induction of premature senescence and thus may identify HBP1 as a relevant transcriptional effector of RB in senescence. RB interaction was necessary for HBP1 in the induction of premature senescence. Using two complementary approaches, we showed that RB, but not p130, was required for induction of premature senescence by HBP1. Third, the data in this paper also add WIP1 as a negative regulator of senescence in human primary cells. These data complement and extend previously published observations that WIP1 deletions in mice prevent tumorigenesis in certain contexts (10, 12). Together with previously published studies (e.g., references 18 and 51), these data indicate that HBP1 lies in a senescence pathway that emanates from RAS and p38 MAPK and further connects RB as a mediator in senescence.As discussed below, at least two members of this pathway (HBP1 and WIP1) have clinical relevance to breast cancer. The survival analysis whose results are shown in Fig. 9 provides a glimpse into future applications for clinical relevance in addressing the difficult problem of recurrence.

Implications for RAS- and p38 MAPK-mediated premature senescence. RAS-mediated senescence is the best-characterized model of oncogene-induced premature senescence. The work in this paper adds HBP1 as a functionally and clinically relevant player in senescence pathways. Several recent reviews have highlighted the need for a better understanding of cellular senescence (14, 36). In human diploid fibroblasts, the expression of RAS can trigger a premature senescence program that limits the promitogenic consequences of excessive RAS signaling (18, 51). Excessive RAS signaling can be mimicked by expression of B-RAF expression, as shown in the benign nevi, in which senescent cells are evident. These benign nevi can be the precursors to malignant melanoma (33). In contrast, RAS expression leads to full transformation in immortalized cells, where senescence has been overridden. These and many other studies highlight that the abrogation of premature senescence imposed by RAS or other oncogenes subsequently forces tumorigenic progression. Thus, identifying players in oncogene-mediated senescence provides a unique opportunity to delineate targets that reimpose senescence to prevent tumorigenic progression.

While RAF, MEK, and ERK are similar in both mitogenic and premature-senescence pathways, the activation of p38 MAPK by RAS is unique to premature senescence and has important implications for blocking tumorigenesis. Several studies with primary human cells have shown that p38 MAPK activity triggers senescence and is specifically required for premature senescence imposed by RAS or its downstream effectors RAF and ERK. There is additional evidence that RAS and non-RAS premature-senescence signals may also signal to p38 MAPK and underscore the importance of this kinase network in senescence (18, 22, 25, 51). Thus, the cell-based studies are consistent with the RAS-MKK6/MKK3-p38 MAPK axis in senescence (see, e.g., references 18 and 51).

It is important to consider the possibility of senescence in previously published studies on p38 MAPK signaling and the suppression of tumorigenesis. In mouse, two different studies have highlighted the role of p38 MAPK signaling in preventing tumorigenesis in several different contexts. Studies by Brancho and colleagues reported that mouse embryo fibroblasts that are double knockouts of MKK6 and MKK3 were susceptible to transformation by viral oncoproteins (9). The deletion of both MKK6 and MKK3 abolished p38 MAPK activation. A similar result was obtained by deletion of p38 MAPK (10). Senescence in either the MKK6–/– MKK3–/– or the p38{alpha}/MAPK14–/– mouse model has not been addressed. Based on published work, previous studies, and this paper, cells defective in p38 MAPK signaling might be refractive to RAS-induced premature senescence.

The data in this paper identify WIP1 as a new regulator of senescence. WIP1 was originally identified as an amplified gene in breast cancer and as a p53-inducible protein (23, 31). WIP1 is also a phosphatase that inactivates p38 MAPK. Therefore, WIP1 would oppose the activating kinases MKK6 and MKK3. In mouse models, the deletion of the WIP1 gene (expected to give high p38 MAPK activity) conferred protection against mammary tumorigenesis in response to transgenic erbB2 or RAS. However, chemical inhibition of p38 MAPK activity restored tumorigenesis by erbB2 and RAS in the WIP1–/– mouse models, indicating that the resulting high p38 MAPK activity created a barrier to tumorigenesis (5, 10, 12, 23). In this study, we showed that a knockdown of WIP1 triggers premature senescence, suggesting that a senescence mechanism may have prevented tumorigenesis in these mouse studies.

The work in this paper adds HBP1 as a functionally relevant player in a RAS-p38 MAPK senescence pathway to premature senescence in primary cells. These studies place p38 MAPK and HBP1 at an important junction regarding premature senescence and suggest that these two proteins may be part of premature-senescence-executing machinery that may be engaged by imbalances of RAS and other signals. If this p38 MAPK/HBP1 "checkpoint" were abrogated, then a cascade of events leading to tumorigenic conversion could be initiated.

Insights into an RB network in senescence. Our study also identifies HBP1 as a new effector of RB in senescence. While p16 is a known RB pathway component in senescence, recent reviews have highlighted that the roles of RB and possible RB effectors of senescence are surprisingly poorly understood (13, 20, 50). A long-standing observation is that RAS-induced senescence requires the RB pathway, as signified by the induction of the p16 CDK4 inhibitor. Some studies have also linked RB to regions of senescence-associated heterochromatin foci by histone methylation (H3K9) (1, 37). However, unlike in the studies with E2Fs in proliferation, few transcriptional targets for RB in senescence have been described.

The data in Fig. 4 and 5 underscore the role of HBP1 as a unique effector of RB in premature senescence. These data suggest that HBP1 may be an important factor for mediating the RB pathway in premature senescence. While HBP1 was initially isolated as an RB- and p130-interacting protein, other signaling contexts have not exhibited a clear dependence on any RB family member (4, 41). The role of RB in senescence is well established (13, 20), although a recent study indicates that p130 may compensate when RB is absent (26). HBP1 can bind both RB and p130, and the results in Fig. 5 demonstrate that the interaction with RB is the more relevant to senescence. However, in senescence, HBP1 clearly requires RB binding to trigger senescence and thus may provide a unique insight into its role as an effector of senescence. Thus, the experiments whose results are shown in Fig. 4 and 5 highlight the importance of the HBP1-RB interaction for premature senescence. It should be noted that the DNA binding domain is also required for premature senescence (Fig. 6). Thus, the RB and DNA binding domains of HBP1 are both necessary for the induction of premature senescence.

This work has the dual benefit of identifying a downstream effector of RAS in senescence and a potentially important mediator of RB in senescence. While p53 and p16 were also elevated with HBP1 expression and premature senescence, we do not yet know whether activation is direct or a consequence of triggering premature senescence. These issues are under investigation. In cancer, abrogation of RB or HBP1 may compromise the senescence-executing mechanisms and facilitate full tumorigenic conversion. While our work was in progress, C/EBPß was also reported to be a new RB target in senescence (42). How this transcription factor might collaborate with p38 MAPK, RAS, and/or HBP1 is not known.

Implications for cancer. While oncogene-mediated senescence is an established phenomenon in human cells, the recent demonstration of senescence in premalignant clinical specimens (33) and in mouse models of premalignant transitions (8, 15) emphasizes that senescence is a general phenomenon in tumorigenesis that is no longer limited to cell culture. When oncogene-induced senescence is abrogated in immortalized human cells, RAS then triggers its well-known functions of uncontrolled mitogenesis and transformation. In human cells, the expressions of telomerase, the simian virus 40 (SV40) early region (large and small T antigen), and RAS are necessary components of transformation. The SV40 large T antigen neutralizes the RB and p53 pathways, which are key players in senescence. Studies by Zhao, Roberts, Hahn, and Weinberg have delineated cellular counterparts that functionally complement SV40 large and small T antigens in the transformation of human cells (7, 59; reviewed in references 6 and 60 and references therein). The possible role of HBP1 or of the p38 MAPK-signaling pathway has not yet been directly addressed for human transformation models, although studies with murine cells suggest a tumor-suppressive function.

A larger and fundamental question regarding breast or any other cancer is whether poor prognosis is specified in the earliest stages of transformation. Cancer prognosis at the level of the primary tumors is an exceedingly important area, as relapse is usually incurable. In breast cancer, relapse is characterized by distant metastases. Investigation of these important questions is greatly aided by the recent availability of public databases with data on gene expression from the primary tumors of patients, which were then observed for up to 14 years for relapse (52). The data in Fig. 9 suggest that the relative expression levels of at least two genes linked to senescence might also correlate with future prognosis. WIP1 and HBP1 are two genes in the RAS and p38 MAPK pathway that are delineated in this paper, but both have previous links to breast cancers. Both genes can exert their functional effect through changes in levels. We have recently completed a study that shows that HBP1 mutations exist in invasive breast cancer, with the molecular studies showing that decreased HBP1 levels also increased tumorigenicity and invasive potential (38). Thus, subtle changes in HBP1 expression levels could have an impact. Similarly, overexpression of WIP1 was associated with human breast cancer (31), while a knockout of the WIP1 gene was associated with suppression of tumorigenicity in some mouse models. Consistently, Fig. 9 shows that low expression levels of HBP1 or of WIP1 in primary tumors can be correlated with later breast cancer relapse, even when the early-stage primary tumors have not yet shown metastases. Thus, the variation in the expression levels of HBP1 and WIP1, which are both associated with premature senescence, could have a lasting impact on tumorigenic progression. For HBP1, we would suggest that decreased HBP1 expression might contribute to interruption of senescence and the deregulation of some signaling pathways (Wnt, EGFR) (reviewed in references 24 and 32) that are linked to poor prognosis in breast and other cancers. While only a first glimpse, the Kaplan-Meier survival analysis in Fig. 9 underscores the potential future clinical relevance of the studies in this paper. New studies that build upon the results of this paper will be necessary to investigate the possible prognostic and therapeutic potential of WIP1, HBP1, and p38 MAPK in breast and other cancers.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the NIH (CA-94187 and CA-104236) to A.S.Y. and from the David E. Wazer breast cancer fund at New England Medical Center and the Susan G. Komen Foundation (BCTR0504367) to K.E.P. We acknowledge the support of the Gene Expression and Genomics Core and of the Antibody and Cell Culture Core of the GRASP Digestive Disease Center (P30-DK34928).

We thank Larry Feig and his laboratory staff for reagents and for helpful discussion on RAS signaling. We also thank Daqin Mao and Phil Hinds for the gift of SAOS-2 cells and helpful suggestions about senescence.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Tufts University School of Medicine, Dept. of Biochemistry (Jaharis 614), 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6850. Fax: (617) 636-2409. E-mail: amy.yee{at}tufts.edu. Back

{triangledown} Published ahead of print on 11 September 2006. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Ait-Si-Ali, S., V. Guasconi, L. Fritsch, H. Yahi, R. Sekhri, I. Naguibneva, P. Robin, F. Cabon, A. Polesskaya, and A. Harel-Bellan.2004 . A Suv39h-dependent mechanism for silencing S-phase genes in differentiating but not in cycling cells. EMBO J. 23:605-615.[CrossRef][Medline]
  2. 2
  3. Alexander, K., and P. W. Hinds. 2001. Requirement for p27KIP1 in retinoblastoma protein-mediated senescence.Mol. Cell. Biol. 21:3616-3631.[Abstract/Free Full Text]
  4. 3
  5. Benanti, J. A., D. K. Williams, K. L. Robinson, H. L. Ozer, and D. A. Galloway.2002 . Induction of extracellular matrix-remodeling genes by the senescence-associated protein APA-1. Mol. Cell. Biol. 22:7385-7397.[Abstract/Free Full Text]
  6. 4
  7. Berasi, S. P., M. Xiu, A. S. Yee, and K. E. Paulson. 2004. HBP1 repression of the p47phox gene: cell cycle regulation via the NADPH oxidase. Mol. Cell. Biol. 24:3011-3024.[Abstract/Free Full Text]
  8. 5
  9. Bernards, R. 2004. Wip-ing out cancer. Nat. Genet. 36:319-320.[CrossRef][Medline]
  10. 6
  11. Boehm, J. S., and W. C. Hahn. 2005. Understanding transformation: progress and gaps. Curr. Opin. Genet. Dev. 15:13-17.[CrossRef][Medline]
  12. 7
  13. Boehm, J. S., M. T. Hession, S. E. Bulmer, and W. C. Hahn. 2005. Transformation of human and murine fibroblasts without viral oncoproteins. Mol. Cell. Biol. 25:6464-6474.[Abstract/Free Full Text]
  14. 8
  15. Braig, M., S. Lee, C. Loddenkemper, C. Rudolph, A. H. Peters, B. Schlegelberger, H. Stein, B. Dorken, T. Jenuwein, and C. A. Schmitt. 2005. Oncogene-induced senescence as an initial barrier in lymphoma development. Nature 436:660-665.[CrossRef][Medline]
  16. 9
  17. Brancho, D., N. Tanaka, A. Jaeschke, J. J. Ventura, N. Kelkar, Y. Tanaka, M. Kyuuma, T. Takeshita, R. A. Flavell, and R. J. Davis. 2003. Mechanism of p38 MAP kinase activation in vivo. Genes Dev. 17:1969-1978.[Abstract/Free Full Text]
  18. 10
  19. Bulavin, D. V., O. N. Demidov, S. Saito, P. Kauraniemi, C. Phillips, S. A. Amundson, C. Ambrosino, G. Sauter, A. R. Nebreda, C. W. Anderson, A. Kallioniemi, A. J. Fornace, Jr., and E. Appella. 2002. Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity. Nat. Genet. 31:210-215.[CrossRef][Medline]
  20. 11
  21. Bulavin, D. V., and A. J. Fornace, Jr.2004 . p38 MAP kinase's emerging role as a tumor suppressor. Adv. Cancer Res. 92:95-118.[CrossRef][Medline]
  22. 12
  23. Bulavin, D. V., C. Phillips, B. Nannenga, O. Timofeev, L. A. Donehower, C. W. Anderson, E. Appella, and A. J. Fornace, Jr. 2004. Inactivation of the Wip1 phosphatase inhibits mammary tumorigenesis through p38 MAPK-mediated activation of the p16(Ink4a)-p19(Arf) pathway. Nat. Genet. 36:343-350.[CrossRef][Medline]
  24. 13
  25. Campisi, J. 2005. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell 120:513-522.[CrossRef][Medline]
  26. 14
  27. Campisi, J. 2005. Suppressing cancer: the importance of being senescent. Science 309:886-887.[Abstract/Free Full Text]
  28. 15
  29. Chen, Z., L. C. Trotman, D. Shaffer, H. K. Lin, Z. A. Dotan, M. Niki, J. A. Koutcher, H. I. Scher, T. Ludwig, W. Gerald, C. Cordon-Cardo, and P. P. Pandolfi. 2005. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis.Nature 436:725-730.[CrossRef][Medline]
  30. 16
  31. Cobrinik, D. 2005. Pocket proteins and cell cycle control.Oncogene 24:2796-2809.[CrossRef][Medline]
  32. 17
  33. de Chiara, C., C. Giannini, S. Adinolfi, J. de Boer, S. Guida, A. Ramos, C. Jodice, D. Kioussis, and A. Pastore. 2003. The AXH module: an independently folded domain common to ataxin-1 and HBP1.FEBS Lett. 551:107-112.[CrossRef][Medline]
  34. 18
  35. Deng, Q., R. Liao, B. L. Wu, and P. Sun. 2004. High intensity ras signaling induces premature senescence by activating p38 pathway in primary human fibroblasts. J. Biol. Chem. 279:1050-1059.[Abstract/Free Full Text]
  36. 19
  37. Dimova, D. K., and N. J. Dyson. 2005. The E2F transcriptional network: old acquaintances with new faces.Oncogene 24:2810-2826.[CrossRef][Medline]
  38. 20
  39. Dimri, G. P. 2005. What has senescence got to do with cancer? Cancer Cell 7:505-512.[CrossRef][Medline]
  40. 21
  41. Dimri, G. P., X. Lee, G. Basile, M. Acosta, G. Scott, C. Roskelley, E. E. Medrano, M. Linskens, I. Rubelj, O. Pereira-Smith, et al. 1995. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 92:9363-9367.[Abstract/Free Full Text]
  42. 22
  43. Haq, R., J. D. Brenton, M. Takahashi, D. Finan, A. Finkielsztein, S. Damaraju, R. Rottapel, and B. Zanke. 2002. Constitutive p38HOG mitogen-activated protein kinase activation induces permanent cell cycle arrest and senescence. Cancer Res. 62:5076-5082.[Abstract/Free Full Text]
  44. 23
  45. Harrison, M., J. Li, Y. Degenhardt, T. Hoey, and S. Powers.2004 . Wip1-deficient mice are resistant to common cancer genes. Trends Mol. Med. 10:359-361.[CrossRef][Medline]
  46. 24
  47. Howe, L. R., and A. M. Brown. 2004. Wnt signaling and breast cancer. Cancer Biol. Ther. 3:36-41.[Medline]
  48. 25
  49. Iwasa, H., J. Han, and F. Ishikawa. 2003. Mitogen-activated protein kinase p38 defines the common senescence-signalling pathway.Genes Cells 8:131-144.[Abstract]
  50. 26
  51. Kapic, A., H. Helmbold, R. Reimer, O. Klotzsche, W. Deppert, and W. Bohn.2006 . Cooperation between p53 and p130(Rb2) in induction of cellular senescence. Cell Death Differ. 13:324-334.[CrossRef][Medline]
  52. 27
  53. Kim, G. Y., S. E. Mercer, D. Z. Ewton, Z. Yan, K. Jin, and E. Friedman. 2002. The stress-activated protein kinases p38 alpha and JNK1 stabilize p21(Cip1) by phosphorylation. J. Biol. Chem. 277:29792-29802.[Abstract/Free Full Text]
  54. 28
  55. Kurz, D. J., S. Decary, Y. Hong, E. Trivier, A. Akhmedov, and J. D. Erusalimsky. 2004. Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells. J. Cell Sci. 117:2417-2426.[Abstract/Free Full Text]
  56. 29
  57. Lavender, P., L. Vandel, A. J. Bannister, and T. Kouzarides.1997 . The HMG-box transcription factor HBP1 is targeted by the pocket proteins and E1A. Oncogene 14:2721-2728.[CrossRef][Medline]
  58. 30
  59. Lemercier, C., K. Duncliffe, I. Boibessot, H. Zhang, A. Verdel, D. Angelov, and S. Khochbin. 2000. Involvement of retinoblastoma protein and HBP1 in histone H10 gene expression. Mol. Cell. Biol. 20:6627-6637.[Abstract/Free Full Text]
  60. 31
  61. Li, J., Y. Yang, Y. Peng, R. J. Austin, W. G. van Eyndhoven, K. C. Nguyen, T. Gabriele, M. E. McCurrach, J. R. Marks, T. Hoey, S. W. Lowe, and S. Powers. 2002. Oncogenic properties of PPM1D located within a breast cancer amplification epicenter at 17q23. Nat. Genet. 31:133-134.[CrossRef][Medline]
  62. 32
  63. Lin, N. U., and E. P. Winer. 2004. New targets for therapy in breast cancer: small molecule tyrosine kinase inhibitors. Breast Cancer Res. 6:204-210.[CrossRef][Medline]
  64. 33
  65. Michaloglou, C., L. C. Vredeveld, M. S. Soengas, C. Denoyelle, T. Kuilman, C. M. van der Horst, D. M. Majoor, J. W. Shay, W. J. Mooi, and D. S. Peeper. 2005. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436:720-724.[CrossRef][Medline]
  66. 34
  67. Moody, S. E., D. Perez, T. C. Pan, C. J. Sarkisian, C. P. Portocarrero, C. J. Sterner, K. L. Notorfrancesco, R. D. Cardiff, and L. A. Chodosh. 2005. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 8:197-209.[CrossRef][Medline]
  68. 35
  69. Mu, D., L. Chen, X. Zhang, L. H. See, C. M. Koch, C. Yen, J. J. Tong, L. Spiegel, K. C. Nguyen, A. Servoss, Y. Peng, L. Pei, J. R. Marks, S. Lowe, T. Hoey, L. Y. Jan, W. R. McCombie, M. H. Wigler, and S. Powers. 2003. Genomic amplification and oncogenic properties of the KCNK9 potassium channel gene. Cancer Cell 3:297-302.[CrossRef][Medline]
  70. 36
  71. Narita, M., and S. W. Lowe. 2005. Senescence comes of age. Nat. Med. 11:920-922.[CrossRef][Medline]
  72. 37
  73. Narita, M., S. Nunez, E. Heard, M. Narita, A. W. Lin, S. A. Hearn, D. L. Spector, G. J. Hannon, and S. W. Lowe. 2003. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113:703-716.[CrossRef][Medline]
  74. 38
  75. Paulson, K. E., M. A. McDevitt, K. R. Christ, M. Hu, J. Sun, J. Kim, S. Berasi, J. Blum, I. Summerhayes, and A. S. Yee. Submitted for publication.
  76. 39
  77. Raingeaud, J., A. J. Whitmarsh, T. Barrett, B. Derijard, and R. J. Davis. 1996. MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol. Cell. Biol. 16:1247-1255.[Abstract]
  78. 40
  79. Rhodes, D. R., J. Yu, K. Shanker, N. Deshpande, R. Varambally, D. Ghosh, T. Barrette, A. Pandey, and A. M. Chinnaiyan.2004 . ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 6:1-6.[Medline]
  80. 41
  81. Sampson, E. M., Z. K. Haque, M. C. Ku, S. G. Tevosian, C. Albanese, R. G. Pestell, K. E. Paulson, and A. S. Yee.2001 . Negative regulation of the Wnt-beta-catenin pathway by the transcriptional repressor HBP1. EMBO J. 20:4500-4511.[CrossRef][Medline]
  82. 42
  83. Sebastian, T., R. Malik, S. Thomas, J. Sage, and P. F. Johnson.2005 . C/EBPbeta cooperates with RB:E2F to implement Ras(V12)-induced cellular senescence. EMBO J. 24:3301-3312.[CrossRef][Medline]
  84. 43
  85. Serrano, M., A. W. Lin, M. E. McCurrach, D. Beach, and S. W. Lowe. 1997. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88:593-602.[CrossRef][Medline]
  86. 44
  87. Shih, H., S. G. Tevosian, and A. S. Yee.1998 . Regulation of differentiation by HBP1, a target of the retinoblastoma protein. Mol. Cell. Biol. 18:4732-4743.[Abstract/Free Full Text]
  88. 45
  89. Shih, H. H., M. Xiu, S. P. Berasi, E. M. Sampson, A. Leiter, K. E. Paulson, and A. S. Yee. 2001. HMG box transcriptional repressor HBP1 maintains a proliferation barrier in differentiated liver tissue.Mol. Cell. Biol. 21:5723-5732.[Abstract/Free Full Text]
  90. 46
  91. Silva, J. M., M. Z. Li, K. Chang, W. Ge, M. C. Golding, R. J. Rickles, D. Siolas, G. Hu, P. J. Paddison, M. R. Schlabach, N. Sheth, J. Bradshaw, J. Burchard, A. Kulkarni, G. Cavet, R. Sachidanandam, W. R. McCombie, M. A. Cleary, S. J. Elledge, and G. J. Hannon. 2005. Second-generation shRNA libraries covering the mouse and human genomes.Nat. Genet. 37:1281-1288.[CrossRef][Medline]
  92. 47
  93. Smith, J. M., J. Bowles, M. Wilson, and P. Koopman.2004 . HMG box transcription factor gene Hbp1 is expressed in germ cells of the developing mouse testis. Dev. Dyn. 230:366-370.[CrossRef][Medline]
  94. 48
  95. Swanson, K. A., P. S. Knoepfler, K. Huang, R. S. Kang, S. M. Cowley, C. D. Laherty, R. N. Eisenman, and I. Radhakrishnan. 2004. HBP1 and Mad1 repressors bind the Sin3 corepressor PAH2 domain with opposite helical orientations. Nat. Struct. Mol. Biol. 11:738-746.[CrossRef][Medline]
  96. 49
  97. Tevosian, S. G., H. Shih, K. G. Mendelson, K. A. Sheppard, K. E. Paulson, and A. S. Yee.1997 . HBP-1: a new transcriptional repressor that is targeted by the retinoblastoma family. Genes Dev. 11:383-396.[Abstract/Free Full Text]
  98. 50
  99. Thomas, D. M., H. S. Yang, K. Alexander, and P. W. Hinds. 2003. Role of the retinoblastoma protein in differentiation and senescence. Cancer Biol. Ther. 2:124-130.[Medline]
  100. 51
  101. Wang, W., J. X. Chen, R. Liao, Q. Deng, J. J. Zhou, S. Huang, and P. Sun. 2002. Sequential activation of the MEK-extracellular signal-regulated kinase and MKK3/6-p38 mitogen-activated protein kinase pathways mediates oncogenic ras-induced premature senescence. Mol. Cell. Biol. 22:3389-3403.[Abstract/Free Full Text]
  102. 52
  103. Wang, Y., J. G. Klijn, Y. Zhang, A. M. Sieuwerts, M. P. Look, F. Yang, D. Talantov, M. Timmermans, M. E. Meijer-van Gelder, J. Yu, T. Jatkoe, E. M. Berns, D. Atkins, and J. A. Foekens. 2005. Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet 365:671-679.[Medline]
  104. 53
  105. Xiu, M., J. Kim, E. Sampson, C. Y. Huang, R. J. Davis, K. E. Paulson, and A. S. Yee.2003 . The transcriptional repressor HBP1 is a target of the p38 mitogen-activated protein kinase pathway in cell cycle regulation. Mol. Cell. Biol. 23:8890-8901.[Abstract/Free Full Text]
  106. 54
  107. Yao, C. J., K. Works, P. A. Romagnoli, and G. E. Austin. 2005. Effects of overexpression of HBP1 upon growth and differentiation of leukemic myeloid cells. Leukemia 19:1958-1968.[CrossRef][Medline]
  108. 55
  109. Yee, A. S., E. K. Paulson, M. A. McDevitt, K. Rieger-Christ, I. Summerhayes, S. P. Berasi, J. Kim, C. Y. Huang, and X. Zhang. 2004. The HBP1 transcriptional repressor and the p38 MAP kinase: unlikely partners in G1 regulation and tumor suppression. Gene 336:1-13.[CrossRef][Medline]
  110. 56
  111. Yee, A. S., H. S. Shih, and S. G. Tevosian. 1998. New perspectives on retinoblastoma family functions in differentiation. Front. Biosci. 3:d532-d547.[Medline]
  112. 57
  113. Yee, A. S., S. G. Tevosian, and H. Shih.1999 . Perspectives on retinoblastoma family functions in differentiation. Pediatr. Pathol. Mol. Med. 18:275-302.[CrossRef]
  114. 58
  115. Zhang, X., Z. Chen, Y. Chen, and T. Tong. 2003. Delivering antisense telomerase RNA by a hybrid adenovirus/ adeno-associated virus significantly suppresses the malignant phenotype and enhances cell apoptosis of human breast cancer cells. Oncogene 22:2405-2416.[CrossRef][Medline]
  116. 59
  117. Zhao, J. J., O. V. Gjoerup, R. R. Subramanian, Y. Cheng, W. Chen, T. M. Roberts, and W. C. Hahn. 2003. Human mammary epithelial cell transformation through the activation of phosphatidylinositol 3-kinase.Cancer Cell 3:483-495.[CrossRef][Medline]
  118. 60
  119. Zhao, J. J., T. M. Roberts, and W. C. Hahn.2004 . Functional genetics and experimental models of human cancer. Trends Mol. Med. 10:344-350.[CrossRef][Medline]
  120. 61
  121. Zhuma, T., R. Tyrrell, B. Sekkali, G. Skavdis, A. Saveliev, M. Tolaini, K. Roderick, T. Norton, S. Smerdon, S. Sedgwick, R. Festenstein, and D. Kioussis. 1999. Human HMG box transcription factor HBP1: a role in hCD2 LCR function. EMBO J. 18:6396-6406.[CrossRef][Medline]


Molecular and Cellular Biology, November 2006, p. 8252-8266, Vol. 26, No. 22
0270-7306/06/$08.00+0     doi:10.1128/MCB.00604-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fan, L. M., Teng, L., Li, J.-M. (2009). Knockout of p47phox Uncovers a Critical Role of p40phox in Reactive Oxygen Species Production in Microvascular Endothelial Cells. Arterioscler. Thromb. Vasc. Bio. 29: 1651-1656 [Abstract] [Full Text]  
  • Okudela, K., Yazawa, T., Woo, T., Sakaeda, M., Ishii, J., Mitsui, H., Shimoyamada, H., Sato, H., Tajiri, M., Ogawa, N., Masuda, M., Takahashi, T., Sugimura, H., Kitamura, H. (2009). Down-Regulation of DUSP6 Expression in Lung Cancer: Its Mechanism and Potential Role in Carcinogenesis. Am. J. Pathol. 175: 867-881 [Abstract] [Full Text]  
  • Su, D., Zhu, S., Han, X., Feng, Y., Huang, H., Ren, G., Pan, L., Zhang, Y., Lu, J., Huang, B. (2009). BMP4-Smad Signaling Pathway Mediates Adriamycin-induced Premature Senescence in Lung Cancer Cells. J. Biol. Chem. 284: 12153-12164 [Abstract] [Full Text]  
  • Tazawa, H., Tsuchiya, N., Izumiya, M., Nakagama, H. (2007). Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc. Natl. Acad. Sci. USA 104: 15472-15477 [Abstract] [Full Text]  
  • Paulson, K. E., Rieger-Christ, K., McDevitt, M. A., Kuperwasser, C., Kim, J., Unanue, V. E., Zhang, X., Hu, M., Ruthazer, R., Berasi, S. P., Huang, C.-Y., Giri, D., Kaufman, S., Dugan, J. M., Blum, J., Netto, G., Wazer, D. E., Summerhayes, I. C., Yee, A. S. (2007). Alterations of the HBP1 Transcriptional Repressor Are Associated with Invasive Breast Cancer. Cancer Res. 67: 6136-6145 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Yee, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Yee, A. S.